Cytoprotective Effects of Lactobacilli on Mouse Epithelial Cells during Salmonella Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture Conditions
2.2. Lysozyme Resistance Assay
2.3. Bile and pH Resistance Assays
2.4. In Vitro Resistance to Gastrointestinal Conditions
2.5. Exopolysaccharide Production Test
2.6. Co-Culture of Lactobacilli Strains (AR1, AR2, AR3) and Pathogens
2.7. Assessment of Pathogenic Growth Inhibitory Effects of Lactobacilli Strain (AR1, AR2, AR3) Metabolites
2.8. Cell Line and Culture Conditions
2.9. Antibacterial Activity of Lactobacilli (AR1, AR2, AR3)-Treated MODE-K Cell Culture Supernatant
2.10. Adhesion and Adhesion Inhibition Assays
2.11. Real-Time PCR for mRNA Expression of Tight Junction Proteins, Cytokines, and Defensin Peptides
3. Statistical Analysis
4. Results
4.1. Tolerance to Lysozyme
4.2. pH and Bile Salt Resistance
4.3. Tolerance of the Simulated Condition of GIT
4.4. Exopolysaccharide Production
4.5. Co-Culture of Lactobacilli and Pathogens
4.6. Inhibitory Effects of Lactobacilli Metabolites on Pathogenic Growth
4.7. Host Defensin Peptide Assessment
4.8. Adhesion and Adhesion Inhibition Assays
4.9. Real-Time PCR for mRNA Expression of Tight Junction Proteins, Cytokines, and Defensin Peptides
5. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Adriana, N.; Ilona, M.; Katarzyna, Ś.; Zdzisława, L.; Elżbieta, K. Adherence of probiotic bacteria to human colon epithelial cells and inhibitory effect against enteric pathogens—In vitro study. Int. J. Dairy Technol. 2016, 69, 532–539. [Google Scholar] [CrossRef]
- Anderson, R.C.; Cookson, A.L.; McNabb, W.C.; Park, Z.; McCann, M.J.; Kelly, W.J.; Roy, N.C. Lactobacillus plantarum MB452 enhances the function of the intestinal barrier by increasing the expression levels of genes involved in tight junction formation. BMC Microbiol. 2010, 10, 316. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, R.C.; Young, W.; Clerens, S.; Cookson, A.L.; McCann, M.J.; Armstrong, K.M.; Roy, N.C. Human Oral Isolate Lactobacillus fermentum AGR1487 Reduces Intestinal Barrier Integrity by Increasing the Turnover of Microtubules in Caco-2 Cells. PLoS ONE 2013, 8, e78774. [Google Scholar] [CrossRef] [PubMed]
- Aziz, K.; Zaidi, A.H.; Fatima, H.N.; Tariq, M. Lactobacillus fermentum strains of dairy-product origin adhere to mucin and survive digestive juices. J. Med. Microbiol. 2019, 68, 1771–1786. [Google Scholar] [CrossRef] [PubMed]
- Azizi, F.; Najafi, M.B.H.; Dovom, M.R.E. The biodiversity of Lactobacillus spp. from Iranian raw milk Motal cheese and antibacterial evaluation based on bacteriocin-encoding genes. AMB Express 2017, 7, 176. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bacanlı, M.; Başaran, N. Importance of antibiotic residues in animal food. Food Chem. Toxicol. 2019, 125, 462–466. [Google Scholar] [CrossRef] [PubMed]
- Baillon, M.-L.A.; Marshall-Jones, Z.V.; Butterwick, R.F. Effects of probiotic Lactobacillus acidophilus strain DSM13241 in healthy adult dogs. Am. J. Vet. Res. 2004, 65, 338–343. [Google Scholar] [CrossRef]
- Baindara, P.; Korpole, S.; Grover, V. Bacteriocins: Perspective for the development of novel anticancer drugs. Appl. Microbiol. Biotechnol. 2018, 102, 10393–10408. [Google Scholar] [CrossRef]
- Becattini, S.; Taur, Y.; Pamer, E.G. Antibiotic-induced changes in the intestinal microbiota and disease. Trends Mol. Med. 2016, 22, 458–478. [Google Scholar] [CrossRef] [Green Version]
- Begley, M.; Gahan, C.G.; Hill, C. The interaction between bacteria and bile. FEMS Microbiol. Rev. 2005, 29, 625–651. [Google Scholar] [CrossRef] [Green Version]
- Begley, M.; Hill, C.; Gahan, C.G. Bile salt hydrolase activity in probiotics. Appl. Environ. Microbiol. 2006, 72, 1729–1738. [Google Scholar] [CrossRef] [Green Version]
- Borrero, J.; Kelly, E.; O’Connor, P.M.; Kelleher, P.; Scully, C.; Cotter, P.D.; van Sinderen, D. Plantaricyclin A, a novel circular bacteriocin produced by Lactobacillus plantarum NI326: Purification, characterization, and heterologous production. Appl. Environ. Microbiol. 2018, 84, e01801-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, C.Y.; Tsen, H.Y.; Lin, C.L.; Yu, B.; Chen, C.S. Oral administration of a combination of select lactic acid bacteria strains to reduce the Salmonella invasion and inflammation of broiler chicks. Poult. Sci. 2012, 91, 2139–2147. [Google Scholar] [CrossRef] [PubMed]
- Claesson, M.J.; Jeffery, I.B.; Conde, S.; Power, S.E.; O’connor, E.M.; Cusack, S.; O’Sullivan, O. Gut microbiota composition correlates with diet and health in the elderly. Nature 2012, 488, 178–184. [Google Scholar] [CrossRef] [PubMed]
- Coman, M.; Verdenelli, M.; Cecchini, C.; Belà, B.; Gramenzi, A.; Orpianesi, C.; Silvi, S. Probiotic characterization of Lactobacillus isolates from canine faeces. J. Appl. Microbiol. 2019, 126, 1245–1256. [Google Scholar] [CrossRef]
- Corzo, G.; Gilliland, S. Bile salt hydrolase activity of three strains of Lactobacillus acidophilus. J. Dairy Sci. 1999, 82, 472–480. [Google Scholar] [CrossRef]
- Cotter, P.D.; Hill, C. Surviving the acid test: Responses of gram-positive bacteria to low pH. Microbiol. Mol. Biol. Rev. 2003, 67, 429–453. [Google Scholar] [CrossRef] [Green Version]
- Delucchi, L.; Fraga, M.; Zunino, P. Effect of the probiotic Lactobacillus murinus LbP2 on clinical parameters of dogs with distemper-associated diarrhea. Can. J. Vet. Res. 2017, 81, 118–121. [Google Scholar]
- Dinev, T.; Beev, G.; Tzanova, M.; Denev, S.; Dermendzhieva, D.; Stoyanova, A. Antimicrobial activity of Lactobacillus plantarum against pathogenic and food spoilage microorganisms: A review. Bulg. J. Vet. Med. 2018, 21, 253–268. [Google Scholar] [CrossRef]
- El Halfawy, N.M.; El-Naggar, M.Y.; Andrews, S.C. Complete genome sequence of Lactobacillus plantarum 10CH, a potential probiotic lactic acid bacterium with potent antimicrobial activity. Genome Announc. 2017, 5, e01398-17. [Google Scholar] [CrossRef] [Green Version]
- Falah, F.; Vasiee, A.; Behbahani, B.A.; Yazdi, F.T.; Moradi, S.; Mortazavi, S.A.; Roshanak, S. Evaluation of adherence and anti-infective properties of probiotic Lactobacillus fermentum strain 4–17 against Escherichia coli causing urinary tract infection in humans. Microb. Pathog. 2019, 131, 246–253. [Google Scholar] [CrossRef] [PubMed]
- Fayol-Messaoudi, D.; Berger, C.N.; Coconnier-Polter, M.H.; Lievin Le Moal, V.; Servin, A.L. pH-, Lactic acid-, and non-lactic acid-dependent activities of probiotic Lactobacilli against Salmonella enterica Serovar Typhimurium. Appl. Environ. Microbiol. 2005, 71, 6008–6013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, Y.; Huang, Y.; Wang, Y.; Wang, P.; Song, H.; Wang, F. Antibiotics induced intestinal tight junction barrier dysfunction is associated with microbiota dysbiosis, activated NLRP3 inflammasome and autophagy. PLoS ONE 2019, 14, e0218384. [Google Scholar] [CrossRef] [PubMed]
- Fukuda, K. Is it feasible to control pathogen infection by competitive binding of probiotics to the host? Virulence 2017, 8, 1502–1505. [Google Scholar] [CrossRef] [Green Version]
- Garai-Ibabe, G.; Areizaga, J.; Aznar, R.; Elizaquivel, P.; Prieto, A.; Irastorza, A.; Dueñas, M.A.T. Screening and selection of 2-branched (1, 3)-β-D-glucan producing lactic acid bacteria and exopolysaccharide characterization. J. Agric. Food Chem. 2010, 58, 6149–6156. [Google Scholar] [CrossRef]
- García-Ruiz, A.; de Llano, D.G.; Esteban-Fernández, A.; Requena, T.; Bartolomé, B.; Moreno-Arribas, M.V. Assessment of probiotic properties in lactic acid bacteria isolated from wine. Food Microbiol. 2014, 44, 220–225. [Google Scholar] [CrossRef]
- Gebremariam, H.G.; Qazi, R.K.; Somiah, T.; Psthak, S.K.; Sjölinder, H.; Sverremark-Ekström, E.; Jonsson, A.B. Lactobacillus gasseri suppresses the production of the proinflammatory cytokines in Helicobacter pylori-infected macrophages by inhibiting the expression of ADAM17. Front. Immunol. 2019, 10, 2326. [Google Scholar] [CrossRef]
- Glenting, J.; Beck, H.C.; Vrang, A.; Riemann, H.; Ravn, P.; Hansen AMMadsen, S. Anchorless surface associated glycolytic enzymes from Lactobacillus plantarum 299v bind to epithelial cells and extracellular matrix proteins. Microbiol. Res. 2013, 168, 245–253. [Google Scholar] [CrossRef]
- Guerra-Ordaz, A.; González-Ortiz, G.; La Ragione, R.; Woodward, M.; Collins, J.; Pérez, J.; Martín-Orúe, S. Lactulose and Lactobacillus plantarum, a potential complementary synbiotic to control postweaning colibacillosis in piglets. Appl. Environ. Microbiol. 2014, 80, 4879–4886. [Google Scholar] [CrossRef] [Green Version]
- Hashemi, S.M.B.; Shahidi, F.; Mortazavi, S.A.; Milani, E.; Eshaghi, Z. Potentially probiotic Lactobacillus strains from traditional Kurdish cheese. Probiotics Antimicrob. Proteins 2014, 6, 22–31. [Google Scholar] [CrossRef]
- Heeney, D.D.; Zhai, Z.; Bendiks, Z.; Barouei, J.; Martinic, A.; Slupsky, C.; Marco, M.L. Lactobacillus plantarum bacteriocin is associated with intestinal and systemic improvements in diet-induced obese mice and maintains epithelial barrier integrity in vitro. Gut Microbes 2019, 10, 382–397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jankowska, A.; Laubitz, D.; Antushevich, H.; Zabielski, R.; Grzesiuk, E. Competition of Lactobacillus paracasei with Salmonella enterica for adhesion to Caco-2 cells. J. Biomed. Biotechnol. 2008, 2008, 357964. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jayashree, S.; Karthikeyan, R.; Nithyalakshmi, S.; Ranjani, J.; Gunasekaran, P.; Rajendhran, J. Anti-adhesion property of the potential probiotic strain Lactobacillus fermentum 8711 against methicillin-resistant Staphylococcus aureus (MRSA). Front. Microbiol. 2018, 9, 411. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kainulainen, V.; Tang, Y.; Spillmann, T.; Kilpinen, S.; Reunanen, J.; Saris, P.E.; Satokari, R. The canine isolate Lactobacillus acidophilus LAB20 adheres to intestinal epithelium and attenuates LPS-induced IL-8 secretion of enterocytes in vitro. BMC Microbiol. 2015, 15, 4. [Google Scholar] [CrossRef] [Green Version]
- Karczewski, J.; Troost, F.J.; Konings, I.; Dekker, J.; Kleerebezem, M.; Brummer, R.-J.M.; Wells, J.M. Regulation of human epithelial tight junction proteins by Lactobacillus plantarum in vivo and protective effects on the epithelial barrier. Am. J. Physiol. Gastrointest. Liver Physiol. 2010, 298, G851–G859. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koponen, J.; Laakso, K.; Koskenniemi, K.; Kankainen, M.; Savijoki, K.; Nyman, T.A.; Varmanen, P. Effect of acid stress on protein expression and phosphorylation in Lactobacillus rhamnosus GG. J. Proteom. 2012, 75, 1357–1374. [Google Scholar] [CrossRef]
- Lehri, B.; Seddon, A.; Karlyshev, A. Lactobacillus fermentum 3872 as a potential tool for combatting Campylobacter jejuni infections. Virulence 2017, 8, 1753–1760. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Tang, H.; Lin, Z.; Xu, P. Mechanisms of acid tolerance in bacteria and prospects in biotechnology and bioremediation. Biotechnol. Adv. 2015, 33, 1484–1492. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Masuoka, H.; Shimada, K.; Kiyosue Yasuda, T.; Kiyosue, M.; Oishi, Y.; Kimura SHirayama, K. Transition of the intestinal microbiota of dogs with age. Biosci. Microbiota Food Health 2017, 36, 27–31. [Google Scholar] [CrossRef] [Green Version]
- Mathara, J.M.; Schillinger, U.; Kutima, P.M.; Mbugua, S.K.; Guigas, C.; Franz, C.; Holzapfel, W.H. Functional properties of Lactobacillus plantarum strains isolated from Maasai traditional fermented milk products in Kenya. Curr. Microbiol. 2008, 56, 315–321. [Google Scholar] [CrossRef]
- Nowak, A.; Motyl, I. In vitro anti-adherence effect of probiotic Lactobacillus strains on human enteropathogens. Res. Pharm. Sci. 2017, 8, 260–268. [Google Scholar]
- Otte, J.-M.; Podolsky, D.K. Functional Modulation of Enterocytes by Gram-Positive and Gram-Negative Microorganisms. Am. J. Physiol. Gastrointest. Liver Physiol. 2004, 286, G613–G626. [Google Scholar] [CrossRef] [Green Version]
- Paolillo, R.; Carratelli, C.R.; Sorrentino, S.; Mazzola, N.; Rizzo, A. Immunomodulatory effects of Lactobacillus plantarum on human colon cancer cells. Int. Immunopharmacol. 2009, 9, 1265–1271. [Google Scholar] [CrossRef]
- Pascher, M.; Hellweg, P.; Khol Parisini, A.; Zentek, J. Effects of a probiotic Lactobacillus acidophilus strain on feed tolerance in dogs with non-specific dietary sensitivity. Arch. Anim. Nutr. 2008, 62, 107–116. [Google Scholar] [CrossRef]
- Pinto, M.G.V.; Franz, C.M.; Schillinger, U.; Holzapfel, W.H. Lactobacillus spp. with in vitro probiotic properties from human faeces and traditional fermented products. Int. J. Food Microbiol. 2006, 109, 205–214. [Google Scholar] [CrossRef]
- Pisano, M.B.; Viale, S.; Conti, S.; Fadda, M.E.; Deplano, M.; Melis, M.P.; Cosentino, S. Preliminary evaluation of probiotic properties of Lactobacillus strains isolated from Sardinian dairy products. BioMed Res. Int. 2014, 2014, 286390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qin, H.; Zhang, Z.; Hang, X.; Jiang, Y.L. plantarum prevents enteroinvasive Escherichia coli-induced tight junction proteins changes in intestinal epithelial cells. BMC Microbiol. 2009, 9, 63. [Google Scholar] [CrossRef] [Green Version]
- Raheem, A.; Liang, L.; Zhang, G.; Cui, S. Modulatory Effects of Probiotics During Pathogenic Infections With Emphasis on Immune Regulation. Front. Immunol. 2021, 12, 616713. [Google Scholar] [CrossRef]
- Sagdic, O.; Ozturk, I.; Yapar, N.; Yetim, H. Diversity and probiotic potentials of lactic acid bacteria isolated from gilaburu, a traditional Turkish fermented European cranberrybush (Viburnum opulus L.) fruit drink. Food Res. Int. 2014, 64, 537–545. [Google Scholar] [CrossRef] [PubMed]
- Sagheddu, V.; Guidesi, E.; Galletti, S.; Elli, M. Original Paper Selection and Characterization Criteria of Probiotics Intended for Human Use from the Past to the Future. Food Sci. Nutr. 2019, 3, 73. [Google Scholar]
- Schlee, M.; Harder, J.; Köten, B.; Stange, E.; Wehkamp, J.; Fellermann, K. Probiotic Lactobacilli and VSL† 3 induce enterocyte β-defensin 2. Clin. Exp. Immunol. 2008, 151, 528–535. [Google Scholar] [CrossRef] [PubMed]
- Spor, A.; Koren, O.; Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat. Rev. Microbiol. 2011, 9, 279–290. [Google Scholar] [CrossRef] [PubMed]
- Strompfová, V.; Kubašová, I.; Farbáková, J.; Maďari, A.; Gancarčíková, S.; Mudroňová, D.; Lauková, A. Evaluation of Probiotic Lactobacillus fermentum CCM 7421 Administration with Alginite in Dogs. Probiotics Antimicrob. Proteins 2017, 10, 577–588. [Google Scholar] [CrossRef] [PubMed]
- Strompfová, V.; Kubašová, I.; Lauková, A. Health benefits observed after probiotic Lactobacillus fermentum CCM 7421 application in dogs. Appl. Microbiol. Biotechnol. 2017, 101, 6309–6319. [Google Scholar] [CrossRef]
- Thakur, N.; Rokana, N.; Panwar, H. Probiotics, Selection criteria, safety and role in health and. J. Innov. Biol. Jan. 2016, 3, 259–270. [Google Scholar]
- Turchi, B.; Mancini, S.; Fratini, F.; Pedonese, F.; Nuvoloni, R.; Bertelloni, F.; Cerri, D. Preliminary evaluation of probiotic potential of Lactobacillus plantarum strains isolated from Italian food products. World J. Microbiol. Biotechnol. 2013, 29, 1913–1922. [Google Scholar] [CrossRef]
- Van den Abbeele, P.; Van de Wiele, T.; Verstraete, W.; Possemiers, S. The host selects mucosal and luminal associations of coevolved gut microorganisms: A novel concept. FEMS Microbiol. Rev. 2011, 35, 681–704. [Google Scholar] [CrossRef] [Green Version]
- Vasiee, A.; Behbahani, B.A.; Yazdi, F.T.; Mortazavi, S.A.; Noorbakhsh, H. Diversity and probiotic potential of lactic acid bacteria isolated from horreh, a traditional Iranian fermented food. Probiotics Antimicrob. Proteins 2018, 10, 258–268. [Google Scholar] [CrossRef]
- Vastano, V.; Salzillo, M.; Siciliano, R.A.; Muscariello, L.; Sacco, M.; Marasco, R. The E1 beta-subunit of pyruvate dehydrogenase is surface-expressed in Lactobacillus plantarum and binds fibronectin. Microbiol. Res. 2014, 169, 121–127. [Google Scholar] [CrossRef]
- Wan, L.; Chen, Z.; Shah, N.; El-Nezami, H. Modulation of intestinal epithelial defense responses by probiotic bacteria. Crit. Rev. Food Sci. Nutr. 2016, 56, 2628–2641. [Google Scholar] [CrossRef]
- Wan, M.L.; Ling, K.; Wang, M.; El Nezami, H. Green tea polyphenol epigallocatechin-3-gallate improves epithelial barrier function by inducing the production of antimicrobial peptide pBD-1 and pBD-2 in monolayers of porcine intestinal epithelial IPEC-J2 cells. Mol. Nutr. Food Res. 2016, 60, 1048–1058. [Google Scholar] [CrossRef] [PubMed]
- Wan, M.L.Y.; Forsythe, S.J.; El-Nezami, H. Probiotics interaction with foodborne pathogens: A potential alternative to antibiotics and future challenges. Crit. Rev. Food Sci. Nutr. 2019, 59, 3320–3333. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Cui, Y.; Qu, X. Mechanisms and improvement of acid resistance in lactic acid bacteria. Arch. Microbiol. 2018, 200, 195–201. [Google Scholar] [CrossRef]
- Wang, J.; Zeng, Y.; Wang, S.; Liu, H.; Zhang, D.; Zhang, W.; Ji, H. Swine-derived probiotic Lactobacillus plantarum inhibits growth and adhesion of Enterotoxigenic Escherichia coli and mediates host defense. Front. Microbiol. 2018, 9, 1364. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Wang, Q.; Yang, E.; Yan, L.; Li, T.; Zhuang, H. Antimicrobial compounds produced by vaginal Lactobacillus crispatus are able to strongly inhibit Candida albicans growth, hyphal formation and regulate virulence-related gene expressions. Front. Microbiol. 2017, 8, 564. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Yan, X.; Han, D.; Liu, Y.; Song, W.; Tong, T.; Ma, Y. Lactobacillus casei DBN023 protects against jejunal mucosal injury in chicks infected with Salmonella pullorum CMCC-533. Res. Vet. Sci. 2019, 127, 33–41. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.; Huang, J.; Zhou, R. Progress in engineering acid stress resistance of lactic acid bacteria. Appl. Microbiol. Biotechnol. 2014, 98, 1055–1063. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.; Zhang, J.; Du, G.; Chen, J. Aspartate protects Lactobacillus casei against acid stress. Appl. Microbiol. Biotechnol. 2013, 97, 4083–4093. [Google Scholar] [CrossRef]
- Wu, C.; Zhang, J.; Wang, M.; Du, G.; Chen, J. Lactobacillus casei combats acid stress by maintaining cell membrane functionality. J. Ind. Microbiol. Biotechnol. 2012, 39, 1031–1039. [Google Scholar] [CrossRef] [PubMed]
- Yan, T.; Zhang, F.; He, Y.; Wang, X.; Jin, X.; Zhang, P.; Bi, D. Enterococcus faecium HDR sEf1 elevates the intestinal barrier defense against enterotoxigenic Escherichia coli and regulates occludin expression via activation of TLR2 and PI3K signalling pathways. Lett. Appl. Microbiol. 2018, 67, 520–527. [Google Scholar] [CrossRef]
- Zago, M.; Fornasari, M.E.; Carminati, D.; Burns, P.; Suàrez, V.; Vinderola, G.; Giraffa, G. Characterization and probiotic potential of Lactobacillus plantarum strains isolated from cheeses. Food Microbiol. 2011, 28, 1033–1040. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.; Wang, H.; Zhang, J.; Tang, X.; Raheem, A.; Wang, M.; Zhu, Y.J.A. Modulatory Effects of Bacillus subtilis on the Performance, Morphology, Cecal Microbiota and Gut Barrier Function of Laying Hens. Animals 2021, 11, 1523. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Deng, J.; Li, Y.; Yang, Q. The effect of Lactobacillus on the expression of porcine β-defensin-2 in the digestive tract of piglets. Livest. Sci. 2011, 138, 259–265. [Google Scholar] [CrossRef]
- Zhang, Y.-G.; Wu, S.; Xia, Y.; Sun, J. Salmonella infection upregulates the leaky protein claudin-2 in intestinal epithelial cells. PLoS ONE 2013, 8, e58606. [Google Scholar] [CrossRef] [PubMed] [Green Version]















| Genes | Forward Sequence | Reverse Sequence |
|---|---|---|
| Occludin | CACACTTGCTTGGGACAGAG | TAGCCATAGCCTCCATAGCC |
| Defb3 | GCTAGGGAGCACTTGTTTGC | TTGTTTGAGGAAAGGAGGCA |
| IL-8 | CGGCAATGAAGCTTCTGTAT | CCTTGAAACTCTTTGCCTCA |
| IL-6 | CAAAGCCAGAGTCCTTCAGAG | GCCACTCCTTCTGTGACTCC |
| IL-1β | GGGCCTCAAAGGAAAGAATC | TACCAGTTGGGGAACTCTGC |
| GAPDH | AGCTTGTCATCAACGGG AAG | TTTGATGTTAGTGGGGTCT CG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, G.; Raheem, A.; Gao, X.; Zhang, J.; Shi, L.; Wang, M.; Li, M.; Yin, Y.; Li, S.; Cui, X.; et al. Cytoprotective Effects of Lactobacilli on Mouse Epithelial Cells during Salmonella Infection. Fermentation 2022, 8, 101. https://doi.org/10.3390/fermentation8030101
Zhang G, Raheem A, Gao X, Zhang J, Shi L, Wang M, Li M, Yin Y, Li S, Cui X, et al. Cytoprotective Effects of Lactobacilli on Mouse Epithelial Cells during Salmonella Infection. Fermentation. 2022; 8(3):101. https://doi.org/10.3390/fermentation8030101
Chicago/Turabian StyleZhang, Guangzhi, Abdul Raheem, Xintao Gao, Jianwei Zhang, Lijun Shi, Mingyan Wang, Ming Li, Yajie Yin, Shaohan Li, Xiaodong Cui, and et al. 2022. "Cytoprotective Effects of Lactobacilli on Mouse Epithelial Cells during Salmonella Infection" Fermentation 8, no. 3: 101. https://doi.org/10.3390/fermentation8030101
APA StyleZhang, G., Raheem, A., Gao, X., Zhang, J., Shi, L., Wang, M., Li, M., Yin, Y., Li, S., Cui, X., Yan, X., Yue, M., Wen, H., & Qin, T. (2022). Cytoprotective Effects of Lactobacilli on Mouse Epithelial Cells during Salmonella Infection. Fermentation, 8(3), 101. https://doi.org/10.3390/fermentation8030101

