Next Article in Journal
Regulatory Effects of Cinnamon–Pepper–Chili Essential Oil Complex on Growth Performance, Immune Function, Complete Blood Count, and Intestinal Microbiota in Simmental CrossBred Cattle During the Late Fattening Stage
Previous Article in Journal
Effects of Gamma Irradiation Pretreatment and Exogenous Fibrolytic Enzyme Supplementation on the Ruminal Fermentation and Nutritional Value of Typha latifolia
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Chestnut Tannin on Nutrient Digestibility, Ruminal Protease Enzymes, and Ruminal Microbial Community Composition of Sheep

1
College of Animal Science, Inner Mongolia Agricultural University, Hohhot 010018, China
2
Key Laboratory of Animal Nutrition, Animal Nutrition and Feed Science, Hohhot 010018, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Fermentation 2025, 11(6), 302; https://doi.org/10.3390/fermentation11060302
Submission received: 14 April 2025 / Revised: 13 May 2025 / Accepted: 21 May 2025 / Published: 23 May 2025
(This article belongs to the Section Industrial Fermentation)

Abstract

The purpose of this research was to investigate the impact of chestnut tannins (CHTs) on nutrient digestibility, nitrogen balance, in situ crude protein (CP) digestibility, protease enzymes, and microbial community composition in sheep. Eighteen 1.5-year-old sheep (43.0 ± 2.0 kg initial BW) fitted with permanent ruminal cannula were selected and randomly divided into three groups, which were fed with CHTs added at 0, 2, and 6%/kg DM. The pre-feeding period lasted for 12 days, and the actual trial period was 18 days. Rumen fluid was collected to assess in situ crude protein (CP) degradability, while rumen digesta was analyzed for total and ruminal proteolytic bacterial populations. Using one-way ANOVA in SAS to analyze data, the results indicated that 2% CHT reduced in situ degradability by 26.23%, while 6% reduced it by 58.01% in the rumen of the sheep. The CP apparent digestibility, nitrogen metabolism, and population of proteolytic bacteria of sheep were decreased in the 6% CHT group (p < 0.05), while the above indices of the 2% CHT group were not affected. Furthermore, CHT supplementation significantly altered the ruminal microbial community structure. Particularly in the 2% CHT group, the relative abundances of Bacteroidota and Prevotella increased. LEfSe analysis revealed that Bacteroidale replaced U29-B03 as the dominant microbiota at 2% CHT. Doses of 2% CHT can be incorporated into sheep diets without impairing digestion. These findings support the inclusion of CHT doses of less than 2% for enhancing protein digestion and increasing the types of beneficial bacteria in the rumen, while doses above 6% should be avoided.

1. Introduction

In ruminants, the rumen plays a crucial role in protein digestion, as it harbors a diverse microbial community, including archaea, bacteria, protozoa, and fungi. Thus, microbial-mediated protein degradation in the rumen is a key biological process that influences the animal’s energy balance and overall productivity. Tannins are plant secondary compounds with the ability to form complexes with proteins. Numerous studies have shown that tannin-rich plants appear to have potential as feed additives to enhance animal performance, regulate the rumen microbial community, control methanogenesis, and modulate rumen fatty acid bio-hydrogenation by ruminants [1,2]. Studies have shown that feeding 1.69–3.5% plants tannin reduced the rate of protein degradation by rumen microorganisms [3,4]. Dietary supplementation with tannin extract modulates the goat rumen microbiome, enhancing nutrient apparent digestibility and ruminant production [5,6]. Min et al. [6] revealed that tannin diets reshape rumen microbiomes, enhancing them via microbial modulation. However, Nelson et al. [7] found that an anti-tannin bacterium isolated from the rumen fluid of goats exhibited a tolerance to tannic acid concentration (up to 7%). This indicates that tannin-rich plants still have anti-nutritional effects [8]. Studies have shown that tannins reduce the growth rate of most bacteria by affecting the structure of their cell membranes [9], and these bacteria play a crucial role in the breakdown of tannins, enabling ruminants to better tolerate and utilize tannin-containing plants in their diet.
Chestnut (Castanea spp.) is a general term for the genus Castanea of the Fagaceae family. Its bark, wood, leaves, and shells (the spine-like structure that encapsulates chestnuts) are rich in tannins [10]. Chestnut tannins (CHTs), a type of hydrolyzed tannin, have gained considerable attention because of their various biological activities, including antimicrobial [11], antioxidant [12], anti-inflammatory, and immune-modulation properties [13]. A previous study indicated that adding 1.5% CHT to the diet of beef cattle could increase rumen by-pass protein, reduce the decomposition of protein by rumen microorganisms, resulting in more dietary protein reaching the small intestine for absorption, and increase the utilization rate of protein [14]. Furthermore, adding 2% CHT to the diets of dairy sheep increased the production of beneficial fatty acid precursors, resulting in enhanced milk fat synthesis [15]. Hence, 2% CHT supplementation level falls within the safe concentration range and exhibits certain beneficial effects on ruminants. The mechanism may be due to the unique protein-binding properties of tannins, which can selectively regulate the rate of rumen protein degradation, thereby significantly improving the rumen nitrogen utilization efficiency of ruminants [16,17]. Existing research also indicates that dietary supplementation with 6–8% CHT in dairy cattle effectively attenuates ruminal proteolysis and reduces urinary nitrogen losses [18]. However, these benefits appear to be dose-dependent, as elevated tannin concentrations progressively inhibit both feed intake and nutrient digestibility [19].
These findings highlight the importance of CHT addition levels in balancing protein protection and nutrient use efficiency. Therefore, in this study, dietary supplementation with 2% and 6% CHT was evaluated in sheep. The composition of the rumen microbial flora was analyzed using 16S rRNA sequencing technology and by finding rumen differential flora affecting protein digestion. Therefore, we integrated experiments to systematically investigate the effects of an appropriate dose (2%) and a high dose (6%) of CHT on animal nutrient utilization, as well as rumen protein digestion, using sheep. We hypothesized that 2% CHT would promote nutrient utilization and 6% CHT could have negative effect on protein digestion. The findings of this study may serve as a scientific reference for the rational utilization of CHT and provide new ideas for future precise regulation of ruminant nutrition.

2. Materials and Methods

2.1. Experimental Design and Treatments

Eighteen 1.5-year-old Mongolian rams (initial body weight 43.0 ± 2.0 kg) fitted with permanent rumen cannulas were ranked by ascending body weight and allocated into six blocks, with three rams per block. Within each block, animals were randomly assigned to one of the following dietary treatments: CON (without CHT); CHT1 (with 2% DM CHT); and CHT2 (with 6% DM CHT) During the trial, the experimental sheep were randomly allocated to individual pens, feeding twice a day at 7:00 am and 5:00 pm, with free access to feed and water. The experiment period lasted 30 days, of which the first 12 days were for adaptation, and the last 18 days were for sampling.
The basal diet was designed according to the “Feeding standard of meat-producing sheep and goats (NYT816-2021)” [20], and the control group was exclusively fed with the basal diet (Table 1). The source of CHTs was purchased from Guang Zhou Silvateam company, whose hydrolyzed tannin content is 76% (tannins-ISO14088 [21]). After being pulverized and sieved, it was mixed with the concentrate supplement feeding.

2.2. Sample Collection and Determination Indicators

2.2.1. Growth Performance

The dry matter intake (DMI) of each sheep was recorded daily according to the amount of feed offered and refusals. The amount offered was adjusted daily in the morning to ensure a 10% refusal (on a fresh basis). Sheep were fasted before weighing, and initial and final body weight (BW) was recorded to calculate average daily gain (ADG). Feed efficiency was calculated as total feed intake divided by total BW gain over the duration of the experiment.

2.2.2. Nutrient Digestibility and Nitrogen Balance

From day 24 to day 30 of the experimental period, feces and urine were collected from all animals. At the same time, feed intake and leftover feed were recorded. The collected feces were thoroughly mixed and weighed over a period of 6 consecutive days. Then, 10% of the total mixed feces were sampled once daily and mixed with 10% H2SO4. The urine was collected using a rubber funnel fixed to the penis area and connected through a PVC tube to a plastic bag. The total volume of urine was recorded daily, and 10% of the urine was sampled in a bottle containing 1mol/L H2SO4 to adjust the urine pH value below 3. The feed samples were taken as well. The feed and feces samples were dried at 65 °C for 48 h, ground through a 1mm sieve, and analyzed for dry matter (DM), organic matter (OM), and crude protein (CP), following AOAC protocols [22]. The acid detergent fiber (ADF) and neutral detergent fiber (NDF) were analyzed according to the methods described by Allen [23]. The total N of the feed, feces, and urine samples was determined using the Kjeldahl method [24]. The crude protein (CP) content was calculated by the total N × 6.25.

2.2.3. Determination of Rumen Protease Enzymes

The above ruminal content (2.0000 g) was mixed with 20 mL 0.1 M phosphate buffer (pH 6.8), which contained 20 μg/mL lysozyme and 2.5 mL tetrachloromethane. After 3 h of incubation at 37 °C, the mixture was centrifuged (15,000 r/min, 15 min) to collect the supernatant for the estimation of enzyme activity. The assay procedure was based on the previous method [25], used colorimetrically by measuring the amount of azo dye released from 2% azocasein (A-2765, Sigma-Aldrich, Saint Louis, MO, USA). A unit of proteolytic activity was defined as the amount of enzyme that would solubilize the equivalent of 1.0 g tyrosine in 1 min (U·g−1·min−1).

2.2.4. In Situ CP Digestibility

In situ crude protein (CP) degradability was determined by using the nylon bag procedure to evaluate the effect of CHT on structural carbohydrate utilization in sheep. Grass, which was used in Exp1, was milled to pass through a 1 mm screen and was used as substrate for the nylon bag procedure. Before the 07:00 feeding, nylon bags (ANKOM R510; size 8 × 12 cm; mean pore size 50 μm) containing 3.0 g milled hay were put simultaneously into the rumen (in triplicate), and removed sequentially at 2, 6, 12, 24, 48, 60, and 72 h of incubation. Blank bags were also inserted in the rumen to correct for bacterial contamination. After collection from the rumen, the nylon bags were soaked in cold water for 30 min and dried for 48 h at 65 °C [26]. The dried residues were collected and milled through a 1 mm screen for subsequent CP analysis. Kinetics of ruminal degradation of CP was calculated using a nonlinear model [27]. The NLIN procedure of SAS (version 9.2; SAS Institute Inc., Cary, NC, USA) was used to fit the following model (Equation (1)):
P (%) = a + b (1 − e−ct),
where P = instantaneous rumen degradability, a = soluble fraction (%), b = slowly degradable (%), c = fractional rate of disappearance of the b fraction (/h), and t = time of incubation (h).
Effective degradability (ERD) of CP was calculated using Equation (2) as follows:
ERD (%) = a + [bc/(c + kp)],
where kp is the ruminal passage rate according to our previous study.

2.2.5. DNA Extraction, Quantitative Reverse Transcription PCR (qRT-PCR) Analysis, and MiSeq Sequencing

The total DNA was extracted from ruminal fluid using the modified CTAB method with bead milling, as described by Burgmann [28]. DNA integrity was assessed by 1% agarose gel electrophoresis. The DNA samples were stored at −80 °C to determine the population of general bacteria, Prevotella, Streptococcus bovis, and Butyrivibrio by using real-time PCR analysis. The primers designed for the real-time PCR are described in Table 2. According to the manufacturer’s instructions, real-time PCR amplification and detection was performed on an Illumina real-time PCR machine (Illumina, San Diego, CA, USA) under the following cycle conditions: an initial denaturation at 95 °C for 5 min, denaturing at 95 °C for 30 s (40 cycles), 40 s at annealing temperature, and an extension at 72 °C for 20 s. Amplicon specificity was performed via dissociation curve analysis of PCR end products by increasing the temperature at a rate of 1 °C every 30 s from 60 to 95 °C.
The standards used in this study were prepared according to the protocol [29]. Briefly, complete and pollution-free DNA was extracted from the ruminal contents and was amplified using normal PCR to produce a high concentration of the target DNA. Then, a specific pure culture of microorganisms was cultured and sequenced to prepare the plasmid DNA using the TIAN pure Mini Plasmid Kit (TIANGEN BIOTECH Co., Ltd., Beijing, China). The sequencing library was prepared using NEXTFLEX Rapid DNA-Seq Kit, and the qualified library was sequenced with Illumina Miseq PE300 platform (Illumina, San Diego, CA, USA). An online formula was used to calculate the number of copies of template DNA per mL of elution buffer. Finally, standard curves were constructed using a serial dilution of plasmid DNA for each bacterial group.
Additionally, the resulting DNA was amplified with barcoded specific bacterial primers targeting the V3-V4 hypervariable region of the bacterial 16s rRNA using universal primers as follows: 338F (5-ATACTAACGGGAGGCAGCAG-3), and 806R (-GGATAACHVGGGTWTTAAAT-3). PCR reactions were performed on a thermocycler PCR system (ABI GeneAmp 9700, Thermo Fisher Scientific, Waltham, MA, USA) in following steps: 95 °C for 180 s; followed by 40 cycles involving 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s; then, 72 °C for 10 min; and 10 °C until halted. The PCR products were checked on a 2% agarose gel and purified according to the manufacturer’s instructions. The amplicons were purified using the AxyPrep DNAGel Extraction Kit (Axygen Biosciences, Union City, NJ, USA) and quantified using QuantiFluor™-ST fluorometer (Promega, Madison, WI, USA), then sequenced on a MiSeq platform (IIIumina, San Diego, CA, USA) according to the protocols in Shanghai MajorBio Bio-Pharm Technology Co., Ltd. (Shanghai, China).

2.3. Statistical Analysis

A randomized complete block design (RCBD) was employed with body weight as the blocking factor. However, statistical analysis indicated that the block effect was not significant (p > 0.05). The data were analyzed using one-way ANOVA in SAS. (version 9.2; SAS Inst. Inc. Cary, NC, USA) using the following model (Equation (3)):
Yij = μ + Ti + ɛij,
where Yij is the observed value of the j-th sheep in the i-th group; μ, overall mean; Ti, fixed effect of the i-th treatment (i = 1, 2, 3); and ɛij, residual error. The results are presented as mean values ± the standard error of the means. Differences between treatment means were determined by Duncan’s multiple range test. Differences between treatments were considered to be significant at p < 0.05.
The apparent digestibility was calculated using the following equation:
Apparent nutrient digestibility = [(Nutrient intake − Fecal nutrient output)/Nutrient intake] × 100;
The N retention and the N retention rate were calculated using the following equations:
N retention (g/d) = Feed N (g/d) − Fecal N (g/d) − Urinary N (g/d)
N-digested (g/d) = Feed N (g/d) − Fecal N (g/d)

3. Results

3.1. Effects of CHT on Growth Performance and Nutrient Digestibility of Sheep

To investigate the effects of different dosages of CHTs on healthy sheep, we determined the growth performance and nutrient digestibility of sheep fed 2% and 6% CHT. Compared to the CON group, the 2% CHT group significantly reduced sheep DMI (p < 0.05), while there was no significant difference on ADG and feed efficiency. Sheep fed 6% CHT had a lower DMI, ADG, and feed efficiency compared to the 2% CHT and CON group (p < 0.05). The results of the apparent digestibility of nutrients in sheep revealed non-significant differences between the control and CHT-supplemented groups (p > 0.05, Table 3).

3.2. Effects of CHTs on Nitrogen Metabolism of Sheep

The effects of CHTs on sheep health were further analyzed from the perspective of N metabolism. N-intake, N-digested, N-retained, N-retained/N-intake and N-retained/N-digested (%) were significantly (p < 0.05) lower in sheep that received a diet supplemented with 6% CHT than the control group (Figure 1). In addition, supplementing 2% CHT did not affect the nitrogen metabolism.

3.3. Effects of CHT In Situ on the CP Digestibility of Sheep

The ruminal dynamic degradation rate and protease activity of CHT in sheep were studied to analyze the effect of CHT on the nutrient degradation rate. Compared to the CON group, the supplementation of CHTs significantly reduced parameters a and ERD (p < 0.05). Parameter b was not affected by the 2% CHT diet treatment, but it significantly decreased in the 6% CHT diet (p < 0.05). In addition, the parameter c was significantly increased in high-dosage CHT; however, it was not affected in the 2% CHT treatment group (p < 0.05). Additionally, the activity of protease enzyme was significantly decreased in the 6% CHT diet treatment as compared with the control (p = 0.05, Table 4).

3.4. Effects of CHTs on Rumen Bacterial Abundance in Sheep

The effects of CHTs on sheep health were investigated in combination with the number of microorganisms. Compared with the control group, the population of general bacteria Prevotella, Streptococcus bovis, and Butyrivibrio were not affected in the group with the low concentration of CHTs (2%) (Figure 2). However, in the group with a high concentration of CHTs (6%) ruminal abundance of all the above microorganisms was reduced.

3.5. Effects of CHTs on Overall Structural Change in Gut Microbiota

3.5.1. Sequencing Coverage and Bacterial Diversity

In order to further explore the effect of CHTs on rumen flora diversity, nine samples of rumen microbiome DNA (n = 3 for per group) were used to sequence the V1–V3 regions of the 16S rRNA gene by Illumina Miseq sequencer after PCR, and a quality check was performed with Agilent 2200 TapeStation and Qubit 2.0. A total of 1197 OTUs were generated via clustering analysis for high-quality sequences at 98–99% similarity cutoff. Cluster analysis revealed that the CHT1 group contained 13 unique OTUs, whereas the CHT2 group had 32 unique OTUs (Figure 3). This suggests that, compared with the normal group of sheep, the addition of CHTs leads to changes in the number of OTUs. The analysis of α-diversity indicated the diets had little effect on shaping phylogenetic diversity, which was based on the α-diversity indexes (p > 0.05) (Figure 4) showing the effect of CHTs on the richness, diversity, and composition of ruminal microbiota. Principal component analysis (PCA) was used to analyze the composition changes in the gut microbiota. The results revealed that the CHT1 and CHT2 groups were separately clustered from the CON group (Figure 5). Significant separation was also noted for the CHT1 and CHT2 groups, indicating that diets play a dominant role in shaping the structure of gut microbiota.

3.5.2. Changes in Bacterial Composition After 2% CHT and 6% CHT Supplementation

This study characterized the rumen bacterial community structure across three treatment groups, focusing on the top 10 most abundant phyla and genera. At the phylum level, among the host microbiota, Firmicutes and Bacteroidetes are the predominant phyla in all treatment groups, followed by the far less abundant Proteobacteria and Fibrobacteres (Figure 6). At the genus level, the gut bacterial community structure could be obviously changed by different dosages of CHT feedings. Among these groups, 2% CHT significantly increased the abundance of Prevotella (Figure 7).
A comparison of the core OTUs by linear discriminant analysis effect size (LEfSe) showed that after 2% CHT was added, the dominant bacterial community in sheep rumen was unclassified_o_Bacteroidia; after 6% CHT was added, the dominant bacterial community in sheep rumen was Hydrogenoanaerobacterium (Figure 8).

4. Discussion

4.1. CHTs Affected the Growth Performance and the In Situ CP Digestibility of Sheep

The results of this experiment reveal that the DMI of the 2% CHT group was significantly lower than that of the control group, but ADG showed no significant difference compared to the control group, suggesting that the addition of an appropriate amount of CHTs may improve feed efficiency. A previous study reported that the effect of tannins on reducing rumen degradability, especially protein degradation, led to improved protein utilization and animal productivity [30]. Some studies have indicated that administering 0.4% CHT has a remarkable influence on the growth performance of sheep [31]. When 1.8% of quebracho–chestnut tannin was added to the diet, the growth performance of dairy cows improved [32]. In conclusion, the addition of less than 2% CHT has a promoting effect on growth performance based on previous studies and based on the results of this experiment. However, the supplementation level of CHTs in ruminant diet higher than the appropriate dosage may lead to a decline in growth performance. The findings of Brutti et al. [33] reported that more than 4% tannin concentration in the diet can inhibit feed intake, affect protein degradation and absorption, and ultimately lead to reduced growth performance, which is consistent with the results of this experimental study. The results of this experiment also show that sheep supplemented with 6% CHT exhibited significantly lower DMI, ADG, and feed efficiency, indicating that 6% CHT supplementation could negatively impact growth performance in sheep, possibly due to the effect of nitrogen metabolism balance. Ahnert et al. [34] observed a linear reduction in urinary nitrogen (N) when dietary tannin levels reached up to 6%. The results of the present trial showed that the supplementation of CHTs up to 2% did not affect the N balance of sheep; however, the supplementation of CHTs up to 6% decreased N-retained (g/d), N-retained/N-intake (%), and N-retained/N-digested (%). The reason for these results could be the inhibition effect of CHTs on N-intake.
In order to further explore the reasons why CHTs reduce growth performance and nitrogen metabolism, this experiment measured protein digestibility. Protein digestibility is a key index to measure the degree to which protein is broken down and absorbed during digestion. Studies have found that the addition of tannin in feed can reduce the apparent digestibility of CP [35]. Similarly to the results of this experiment, apparent CP digestibility showed a decreasing trend in sheep fed with 6% CHT. The possible reduced digestibility of CP and overall bacterial protein outflow are attributed to the binding effects of tannins to dietary proteins, and, due to the large number of phenolic hydroxyl groups, enables tannins to react mainly with protein and to a lesser extent with carbohydrate [36]. Studies have shown that the addition of tannin in feed can reduce the rumen protein degradation rate of ruminants, and the rumen protein degradation rate decreases with the increase in tannin concentration [37,38,39]. The results of this experiment reveal that 2% CHT supplementation had a tendency to promote nutrient utilization, while 6% CHT significantly reduced the apparent digestibility of CP. Studies have demonstrated that tannin-rich forages decreased rumen degradability (in situ) [40]. Research found that tannins linearly reduced the rumen disappearance rate by linearly reducing both passage and digestion rates [41]. Meanwhile, studies indicated that the main reason for reducing rumen degradability was that CHT inhibited the growth of proteolytic rumen micro-organisms and decreased the activity of proteolytic enzymes [42,43], which is similar to the results of this experiment. This was mainly due to the fact that lower tannin levels can prevent the complexation of tannins with nutrients, making it easier for animals to obtain nutrients in feed, thereby obtaining higher digestibility and animal productivity.

4.2. CHT Changes the Ruminal Microbial Community Composition

To further uncover the mechanism of tannins affecting protein degradation, we used quantitative real-time PCR analyses to confirm the effect of CHTs on proteolytic bacteria. Our results showed that the number of general bacteria, Prevotella, Streptococcus bovis, and Butyrivibrio, was not obviously affected in the group fed a low concentration of CHTs (2%). However, those fed a high concentration of CHTs (6%) saw reduced ruminal abundance of all the above microorganisms. Similarly, the inclusion of CHTs to the diet was found to reduce the growth and number of Streptococcus bovis, Butyrivibriofibrisolvens, and the general bacteria in vitro [44,45]. Additionally, tannins seem to affect bacterial growth by way of deprivation of the substrates required for bacterial growth and action upon the bacterial metabolism through the inhibition of oxidative phosphorylation [46]. However, supplementing 2.6% condensed tannins did not affect the relative abundance of Butyrivibriofibrisolvens and Streptococcusbovis [47]. Given the critical role of CHTs in nutrient digestion and absorption in ruminants, further research is needed to explore their effects on rumen microbial communities in diets.
Hence, we used 16S rRNA to confirm the effect of CHTs on the composition of ruminal microbiota. The nutritional status of ruminants and the ecological environment of the rumen significantly influence the composition of the ruminal bacterial community [48]. Consequently, understanding the ruminal bacterial community is vital for enhancing the productivity of ruminants. Growing attention has been paid in recent years to the application of natural plant bioactive substances in animal feed. Substantial evidence indicates that tannins possess a remarkable capacity to regulate gut bacterial communities [13]. Principal component analysis (PCA) showed that dietary supplementation with CHTs led to significantly different clustering patterns of rumen microbiota compared to the control group. The significant separation was also noted for CHT1 and CHT2 groups, indicating that diets play a dominant role in shaping the structure of rumen microbiota. Prevotella represents a key bacterial genus involved in cellulose degradation within the rumen ecosystem [49]. Our study found that the relative abundance of Prevotella was significantly higher in the 2% CHT group compared to the CON and 6% CHT groups. This may indicate that the addition of 2% CHT to sheep diet may enhance the degradation efficiency of fiber substances by promoting rumen bacterial activity. Zhang Y K et al. [50] draws a conclusion that the dominant phyla in sheep rumen are Bacteroidetes, Firmicutes, Proteobacteria, and Fibrobacterota. These findings align with our experimental results, suggesting that CHTs help maintain a stable microbiome structure. Through LEfSe analysis of the bacterial community, the change in bacterial community in the 6% CHT group may be the key factor leading to slow protein digestibility. Based on existing studies examining various CHT dosages, we have elucidated its metabolic processes and mechanisms of action in the ovine rumen. Our findings suggest that higher CHT concentrations may exceed the detoxification capacity of rumen microorganisms or cause irreversible detrimental effects due to prolonged high-level exposure.

5. Conclusions

In conclusion, 2% CHT optimizes protein utilization efficiency and maintains nitrogen metabolism balance by increasing the abundances of Bacteroidota and Prevotella. Conversely, 6% CHT significantly inhibits the activity of proteolytic bacteria (e.g., the abundance of Streptococcus bovis), resulting in a reduction in CP digestibility. Collectively, the addition of 2% CHT had a tendency to promote nutrient utilization, while 6% CHT in the diet had a negative impact on sheep. Therefore, it is recommended to add a dose of less than 2% CHT to sheep diets.

Author Contributions

Conceptualization, M.S. and P.L.; methodology, M.S. and P.L.; software, M.S. and P.L.; validation, M.Z. and Y.Y.; data curation, M.S., P.L., W.W.s and Y.Y.; writing—original draft preparation, M.S. and P.L.; writing—review and editing, M.S., P.L.s and Y.X.; visualization, M.S. and P.L.; supervision, D.L. and Y.X.; funding acquisition, D.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Natural Science Foundation of Inner Mongolia Autonomous Region of China (2023MS03023).

Institutional Review Board Statement

This animal study was approved by the Inner Mongolia Agricultural University Institutional Animal Care and Use Committee and conformed to national animal welfare regulations (protocol No. [2019] 034, approved on 25 December 2019).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article, and further inquiries can be directed to the corresponding author.

Acknowledgments

The authors thank the people who prepared the dataset. The authors thank the funding agencies for their financial support.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of this study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

The following abbreviations are used in this manuscript:
ADGaverage daily gain
ADFIaverage day feed intake
BWbody weight
CHTchestnut tannins
DMdirect mail advertising
ERDeffective degradability

References

  1. Niderkorn, V.; Barbier, E.; Macheboeuf, D.; Torrent, A.; Mueller-Harvey, I.; Hoste, H. In vitro rumen fermentation of diets with different types of condensed tannins derived from sainfoin (Onobrychis viciifolia scop.) pellets and hazelnut (Corylus avellana L.) pericarps. Anim. Feed Sci. Technol. 2020, 259, 114357. [Google Scholar] [CrossRef] [Scilit]
  2. Aboagye, I.A.; Oba, M.; Koenig, K.M.; Zhao, G.Y.; Beauchemin, K.A. Use of gallic acid and hydrolyzable tannins to reduce methane emission and nitrogen excretion in beef cattle fed a diet containing alfalfa silage1,2. J. Anim. Sci. 2019, 97, 2230–2244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Zhou, K.; Bao, Y.; Zhao, G. Effects of dietary crude protein and tannic acid on rumen fermentation, rumen microbiota and nutrient digestion in beef cattle. Arch. Anim. Nutr. 2019, 73, 30–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Jakhesara, S.J.; Koringa, P.G.; Ramani, U.V.; Ahir, V.; Tripathi, A.; Soni, P.; Singh, K.; Bhatt, V.; Patel, J.; Patel, M.; et al. Comparative study of tannin challenged rumen microbiome in goat using high throughput sequencing technology. Dev. Microbiol. Mol. Biol. 2010, 1, 95–106. [Google Scholar]
  5. de Sant’Ana, A.S.; Ribeiro Silva, A.P.; Oliveira do Nascimento, S.P. Tannin as a modulator of rumen microbial profile, apparent digestibility and ingestive behavior of lactating goats: A preliminary metagenomic view of goats adaptability to tannin. Res. Vet. Sci. 2022, 145, 159–168. [Google Scholar] [CrossRef] [Scilit]
  6. Min, B.R.; Wang, W.; Pitta, D.W.; Nagaraju, I.; Patra, A.K.; Wang, H.H.; Frank, A.; Mariline, H.; Ryszard, P. Characterization of the ruminal microbiota in sheep and goats fed different levels of tannin-rich sericea lespedeza hay. J. Anim. Sci. 2024, 102, skae198. [Google Scholar] [CrossRef] [Scilit]
  7. Nelson, K.; Pell, A.; Schofield, P.; Zinder, S.H. Isolation and characterization of an anaerobic ruminal bacterium capable of degrading hydrolyzable tannins. Appl Env. Microbiol. 1995, 61, 3293–3298. [Google Scholar] [CrossRef] [Scilit]
  8. Min, B.R.; Attwood, G.T.; McNabb, W.C.; Molan, A.L.; Barry, T.N. The effect of condensed tannins from lotus corniculatus on the proteolytic activities and growth of rumen bacteria. Anim. Feed. Sci. Technol. 2005, 121, 45–58. [Google Scholar] [CrossRef] [Scilit]
  9. Caprarulo, V.; Giromini, C.; Rossi, L. Review: Chestnut and quebracho tannins in pig nutrition: The effects on performance and intestinal health. Anim. Int. J. Anim. Biosci. 2021, 15, 100064. [Google Scholar] [CrossRef] [Scilit]
  10. Khatib, M.; Campo, M.; Bellumori, M.; Cecchi, L.; Vignolini, P.; Innocenti, M.; Mulinacci, N. Tannins from different parts of the chestnut trunk (Castanea sativa mill.): A green and effective extraction method and their profiling by high-performance liquid chromatography-diode array detector-mass spectrometry. ACS Food Sci. Technol. 2023, 3, 1903–1912. [Google Scholar] [CrossRef] [Scilit]
  11. Du, L.; Li, J.; Zhang, X. Pomegranate peel polyphenols inhibits inflammation in LPS-induced RAW264.7 macrophages via the suppression of MAPKs activation. J. Funct. Foods 2018, 43, 62–69. [Google Scholar] [CrossRef] [Scilit]
  12. Reggi, S.; Giromini, C.; Dell’anno, M.; Baldi, A.; Rebucci, R.; Rossi, L. In vitro digestion of chestnut and quebracho tannin extracts: Antibacterial effect, anti-oxidant capacity and cytomodulatory activity in swine Intestinal Ipec-j2 cells. Animals. 2020, 10, 195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Buccioni, A.; Pallara, G.; Pastorelli, R.; Antongiovanni, M.; Mele, M. Effect of Dietary Chestnut or Quebracho Tannin Supplementation on Microbial Community and Fatty Acid Profile in the Rumen of Dairy Ewes. Biomed Res. Int. 2017, 2017, 4969076. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Zhang, W.; Qi, S.; Xue, X. Understanding the gastrointestinal protective effects of polyphenols using foodomics-based approaches. Front. Immunol. 2021, 12, 671150. [Google Scholar] [CrossRef] [Scilit]
  15. Aboagye, I.A.; Oba, M.; Castillo, A.; Koenig, K.M.; Iwaasa, A.D.; Beauchemin, K.A. Effects of hydrolyzable tannin with or without condensed tannin on methane emissions, nitrogen use, and performance of beef cattle fed a high-forage diet. Anim Sci. 2018, 96, 5276–5286. [Google Scholar] [CrossRef] [Scilit]
  16. Avila, S.; Kozloski, G.; Orlandi, T. Impact of a tannin extract on digestibility, ruminal fermentation and duodenal flow of amino acids in steers fed maize silage and concentrate containing soybean meal or canola meal as protein source. J. Agric. Sci. 2015, 153, 943–953. [Google Scholar] [CrossRef] [Scilit]
  17. Dentinho, M.T.P.; Belo, A.T.; Bessa, R.J.B. Digestion, ruminal fermentation and bacterial nitrogen supply in sheep fed soybean meal treated with Cistus ladanifer L. tannins. Small Rumin. Res. 2014, 119, 57–64. [Google Scholar] [CrossRef] [Scilit]
  18. Battelli, M.; Colombini, S.; Parma, P.; Galassi, G.; Crovetto, G.M.; Spanghero, M.; Pravettoni, D.; Zanzani, S.A.; Manfredi, M.T.; Rapetti, L. In vitro effects of different levels of quebracho and chestnut tannins on rumen me-thane production, fermentation parameters, and microbiota. Front. Vet. Sci. 2023, 10, 1178288. [Google Scholar] [CrossRef] [Scilit]
  19. Fitri, A.; Yanza, Y.R.; Jayanegara, A.; Ridwan, R.; Astuti, W.D.; Sarwono, K.A.; Fidriyanto, R.; Rohmatussolihat, R.; Widyastuti, Y.; Obitsu, T. Divergence effects between dietary acacia and quebracho tannin extracts on nutrient utilization, performance, and methane emission of ruminants: A meta-analysis. Anim. Sci. J. 2022, 93, e13765. [Google Scholar] [CrossRef] [Scilit]
  20. NYT816-2021; Feeding Standard of Meat-Producing Sheep and Goats. Agricultural Industry Standard of the People’s Republic of China: Beijing, China, 2021.
  21. ISO14088; Leather—Chemical Tests—Quantitative Analysis of Tanning Agents by Filter Method. ISO: Geneva, Switzerland, 2020.
  22. Association of Official Analytical Chemists. Official Methods of Analysis, 15th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 1990. [Google Scholar]
  23. Allen, M.S. Relationship between fermentation acid production in the rumen and the requirement for physically effective fiber. Dairy Sci. 1997, 80, 1447–1462. [Google Scholar] [CrossRef] [Scilit]
  24. Krieg, J.; Koenzen, E.; Seifried, N.; Steingass, H.; Schenkel, H.; Rodehutscord, M. Prediction of CP and starch concentrations in ruminal in situ studies and ruminal degradation of cereal grains using NIRS. Anim. Int. J. Anim. Biosci. 2018, 12, 472–480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Raffrenato, E.; Badenhorst, M.J.; Shipandeni, M.N.T.; van Zyl, W.H. Rumen fluid handling affects measurements of its enzymatic activity and in vitro digestibility. Anim. Feed. Sci. Technol. 2021, 280, 115060. [Google Scholar] [CrossRef] [Scilit]
  26. Zhang, C.; Ma, T.; Tu, Y. Effects of Circadian Rhythm and Feeding Modes on Rumen Fermentation and Microorganisms in Hu Sheep. Microorganisms 2022, 10, 2308. [Google Scholar] [CrossRef] [Scilit]
  27. Liu, C.; Li, D.; Chen, W.; Li, Y.; Wu, H.; Meng, Q.; Zhou, Z. Estimating ruminal crude protein degradation from beef cattle feedstuff. Sci. Rep. 2019, 9, 11368. [Google Scholar] [CrossRef] [Scilit]
  28. Bürgmann, H.; Pesaro, M.; Widmer, F. A strategy for optimizing quality and quantity of DNA extracted from soil. J. Microbiol. Methods 2001, 45, 7–20. [Google Scholar] [CrossRef] [Scilit]
  29. Navidshad, B.; Liang, J.B.; Jahromi, M.F. Correlation coefficients between different methods of expressing bacterial quantification using real time PCR. Int. J. Mol. Sci. 2012, 13, 2119–2132. [Google Scholar] [CrossRef] [Scilit]
  30. Wischer, G.; Greiling, A.M.; Boguhn, J.; Steingass, H.; Schollenberger, M.; Hartung, K.; Rodehutscord, M. Effects of long-term supplementation of chestnut and valonea extracts on methane release, digestibility and nitrogen excretion in sheep. Anim. Int. J. Anim. Biosci. 2014, 8, 938–948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Huang, Q.; Liu, X.; Zhao, G.; Hu, T.; Wang, Y. Potential and challenges of tannins as an alternative to in-feed antibiotics for farm animal production. Anim. Nutr. 2018, 4, 137–150. [Google Scholar] [CrossRef] [Scilit]
  32. Aguerre, M.J.; Duval, B.; Powell, J.M.; Vadas, P.A.; Wattiaux, M.A. Effects of feeding a quebracho–chestnut tannin extract on lactating cow performance and nitrogen utilization efficiency. J. Dairy Sci. 2020, 103, 2264–2271. [Google Scholar] [CrossRef] [Scilit]
  33. Brutti, D.D.; Canozzi, M.E.A.; Sartori, E.D.; Colombatto, D.; Barcellos, J.O.J. Effects of the use of tannins on the ruminal fermentation of cattle: A me-ta-analysis and meta-regression. Anim. Feed Sci. Technol. 2023, 306, 115806. [Google Scholar] [CrossRef] [Scilit]
  34. Ahnert, S.; Dickhoefer, U.; Schulz, F. Influence of ruminal quebracho tannin extract infusion on apparent nutrient digestibility, nitrogen balance, and urinary purine derivatives excretion in heifers. Livest. Sci. 2015, 177, 63–70. [Google Scholar] [CrossRef] [Scilit]
  35. Min, B.R.; Solaiman, S.; Terrill, T. The effects of tannins-containing ground pine bark diet upon nutrient digestion, nitrogen balance, and mineral retention in meat goats. J. Anim. Sci. Biotechnol. 2015, 6, 25. [Google Scholar] [CrossRef] [Scilit]
  36. Ku-Vera, J.C.; Jiménez-Ocampo, R.; Valencia-Salazar, S.S. Role of secondary plant metabolites on enteric methane mitigation in ruminants. Front. Vet. Sci. 2020, 7, 584. [Google Scholar] [CrossRef] [Scilit]
  37. Patra, A.K.; Saxena, J. Exploitation of dietary tannins to improve rumen metabolism and ruminant nutrition. Sci. Food Agric. 2011, 91, 24–37. [Google Scholar] [CrossRef] [Scilit]
  38. Qi, M.; Wen, H.; Zhou, Y.; Shi, W.; Wang, L.; Han, L.; Wu, G. Effects of chestnut tannin on Growth Performance, Meat Quality and fatty acid Composition of Muscle of Tan Sheep. Chin. J. Anim. Nutr. 2022, 34, 3857–3866. (In Chinese) [Google Scholar]
  39. González-Barrio, R.; Truchado, P.; García-Villalba, R.; Hervás, G.; Frutos, P.; Espín, J.C.; Tomás-Barberán, F.A. Metabolism of oak leaf ellagitannins and urolithin production in beef cattle. J. Agric. Food Chem. 2012, 60, 3068–3077. [Google Scholar] [CrossRef] [Scilit]
  40. Zhang, J.; Xu, X.F.; Cao, Z.J.; Azarfar, A.; Li, S. Effect of different tannin sources on nutrient intake, digestibility, performance, nitrogen utilization, and blood parameters in dairy cows. Animals 2019, 9, 507. [Google Scholar] [CrossRef] [Scilit]
  41. Tseu, R.J.; Junior, P.; Flavio; Acácio Sene, G.; Tropaldi, C.B.; Peres, A.H.; Rodrigues, P.H.M. Effect of tannins and monensin on feeding behaviour, feed intake, digestive parameters and bacterial efficiency of nellore cows. Ital. J. Anim. Sci. 2020, 19, 262–273. [Google Scholar] [CrossRef] [Scilit]
  42. Coblentz, W.K.; Grabber, J.H. In situ protein degradation of alfalfa and birdsfoot trefoil hays and silages as influenced by condensed tannin concentration. J. Dairy Sci. 2013, 96, 3120–3137. [Google Scholar] [CrossRef] [Scilit]
  43. Chen, L.; Bao, X.Y.; Guo, G.; Huo, W.; Xu, Q.; Wang, C.; Liu, Q. Effects of hydrolysable tannin with or without condensed tannin on alfalfa silage fermentation characteristics and in vitro ruminal methane production, fermentation patterns, and microbiota. Animals 2021, 11, 1967. [Google Scholar] [CrossRef] [Scilit]
  44. Rira, M.; Morgavi, D.P.; Archimède, H.; Marie-Magdeleine, C.; Popova, M.; Bousseboua, H.; Doreau, M. Potential of tannin-rich plants for modulating ruminal microbes and ruminal fer-mentation in sheep. J. Anim. Sci. 2015, 93, 334–347. [Google Scholar] [CrossRef] [Scilit]
  45. Carrasco, J.M.D.; Cabral, C.; Redondo, L.M.; Colombatto, D.; Farber, M.D.; Miyakawa, M.E.F. Impact of chestnut and quebracho tannins on rumen microbiota of bovines. BioMed Res. Int. 2017, 2017, 9610810. [Google Scholar] [CrossRef] [Scilit]
  46. Okuda, T.; Ito, H. Tannins of constant structure in medicinal and food plants-hydrolyzable tannins and polyphenols related to tannins. Molecules 2011, 16, 2191–2217. [Google Scholar] [CrossRef] [Scilit]
  47. Yang, K.; Wei, C.; Zhao, G.Y.; Xu, Z.W.; Zhao, S.X. Effects of dietary supplementing tannic acid in the ration of beef cattle on rumen fermentation, methane emission, bacterial flora and nutrient digestibility. Anim. Physiol. Anim. Nutr. 2016, 101, 302–310. [Google Scholar] [CrossRef] [Scilit]
  48. Ge, T.; Yang, C.; Li, B.; Huang, X.; Zhao, L.; Zhang, X.; Tian, L.; Zhang, E. High-energy diet modify rumen bacterial composition and bacterial energy metabolism pattern in fattening sheep. BMC Vet. Res. 2023, 19, 32. [Google Scholar] [CrossRef] [Scilit]
  49. Huws, S.A.; Edwards, J.E.; Creevey, C.J.; Stevens, P.R.; Lin, W.; Girdwood, S.E.; Pachebat, J.A.; Kingston-Smith, A.H. Temporal dynamics of the metabolically active rumen bacteria colonizing fresh perennial ryegrass. FEMS Microbiol. Ecol. 2016, 92, fiv137. [Google Scholar] [CrossRef] [Scilit]
  50. Zhang, Y.K.; Zhang, X.X.; Li, F.D.; Li, C.; Li, G.Z.; Zhang, D.Y.; Song, Q.Z.; Li, X.L.; Zhao, Y.; Wang, W.M. Characterization of the rumen microbiota and its relationship with residual feed intake in sheep. Anim. Int. J. Anim. Biosci. 2021, 15, 100161. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Nitrogen metabolism in sheep fed experiment diets (%). Different letters indicate significant differences among groups (p < 0.05).
Figure 1. Nitrogen metabolism in sheep fed experiment diets (%). Different letters indicate significant differences among groups (p < 0.05).
Fermentation 11 00302 g001
Figure 2. Rumen general bacteria and bacteria population in sheep fed experiment diets. Different letters indicate significant differences among groups (p < 0.05).
Figure 2. Rumen general bacteria and bacteria population in sheep fed experiment diets. Different letters indicate significant differences among groups (p < 0.05).
Fermentation 11 00302 g002
Figure 3. Venn graph of bacteria in rumen.
Figure 3. Venn graph of bacteria in rumen.
Fermentation 11 00302 g003
Figure 4. Effect of CHTs on the alpha diversity indexes of rumen bacteria in rumen.
Figure 4. Effect of CHTs on the alpha diversity indexes of rumen bacteria in rumen.
Fermentation 11 00302 g004
Figure 5. Principal coordinate analysis (PCoA) of rumen microbiome in sheep.
Figure 5. Principal coordinate analysis (PCoA) of rumen microbiome in sheep.
Fermentation 11 00302 g005
Figure 6. Comparison of the bacteria (phylum level) present within the rumen of sheep.
Figure 6. Comparison of the bacteria (phylum level) present within the rumen of sheep.
Fermentation 11 00302 g006
Figure 7. Comparison of the bacteria (genus level) present within the rumen of sheep.
Figure 7. Comparison of the bacteria (genus level) present within the rumen of sheep.
Fermentation 11 00302 g007
Figure 8. LEfSe analysis reveals key bacterial biomarkers.
Figure 8. LEfSe analysis reveals key bacterial biomarkers.
Fermentation 11 00302 g008
Table 1. Composition and nutrient levels of the experimental basal diet (air-dried basis).
Table 1. Composition and nutrient levels of the experimental basal diet (air-dried basis).
IngredientsContent (%)Nutrient LevelsLevel, %
Oat grass31.00Metabolizable energy, (MJ/kg) (2)7.86
Alfalfa29.00Crude protein (%)15.47
Sunflower husk10.00Neutral detergent fiber (%)46.90
Corn15.00Acid detergent fiber (%)28.57
Corn husk2.00Calcium (%)0.89
Soybean meal7.50Available phosphorus (%)0.71
Canola meal3.00
Limestone0.00
CaHPO41.00
NaCl0.50
Premix (1)1.00
Total100.00
(1) The premix provided the following per kg of diets: Se 0.30 mg, Cu 25.00 mg, Fe 55.00 mg, I 5.00 mg, Mn 25.00 mg, S 60.00 mg, Zn 16.00 mg, VA 18 00 IU, VD 3 000 IU, VE 576 IU. (2) ME was a calculated value, while the others were measured values.
Table 2. PCR primers for ruminal bacteria.
Table 2. PCR primers for ruminal bacteria.
Primers NamePrimer Sequence (5→3)Tm (°C)Product
Size (bp)
PrevotellaF: CGGTAAACGATGGATGTAC58133
R: ATGTTCTACCGTATGTGC
Streptococcus bovisF: ATTTATAGAGATAGGGTTTTATAT60134
R: ACTATATGATGGCAATAAACAATA
ButyrivibrioF: CGCATGATGCAGTGTGAAAAGTAC56125
R: CTACCCGACACTAATTATTCATCG
General bacteriaF: CGGCAACGAGCGCAACCC60130
R: CCATTGTAGCACGTGTGTAGCC
Table 3. Growth performance and nutrients’ apparent digestibility in sheep fed experimental diets.
Table 3. Growth performance and nutrients’ apparent digestibility in sheep fed experimental diets.
ItemTreatment Group (%) 1SEMp-Value 2
CONCHT1CHT2
Growth performance
Dry matter intake, g/d1342.33 a1097.62 b504.93 c58.40<0.01
Average daily gain, g/d128.44 a119.92 a−13.83 b9.03<0.01
Feed efficiency, g/g0.10 a0.11 a−0.03 b0.005<0.01
Nutrients apparent digestibility
DM66.3269.170.210.020.49
OM69.2971.6166.980.020.23
CP77.537965.830.020.46
NDF70.0372.2676.270.020.19
ADF57.9860.9759.340.040.61
1 CON: basal diet, 2% CHT: 2% chestnut tannic and basal diet, 6% CHT: 6% chestnut tannic and basal diet. 2 Values are mean ± SEM (n = 6). Data were analyzed by one-way ANOVA, and differences among treatments were analyzed post hoc via Duncan’s test. a,b,c Values within a row with different superscripts differ significantly at p < 0.05.
Table 4. In situ CP digestibility and enzyme activity in sheep fed experiment diets.
Table 4. In situ CP digestibility and enzyme activity in sheep fed experiment diets.
ItemTreatment Group (%)SEMp-Value
CONCHT1CHT2
In situ CP digestibility
a5.80 a3.21 b2.63 b0.24<0.01
b47.66 a41.31 a12.12 b2.87<0.01
c (%/h)2.55 b2.18 b6.35 a0.580.02
Kp (%/h)4.254.254.25
ERD (%)22.72 a16.76 b9.54 c0.35<0.01
enzyme activity (U·g−1·min−1)
Protease enzyme2.86 ab2.32 b2.67 a0.520.05
p = instantaneous rumen degradability, a = rapidly degradable fraction, b = slowly degradable fraction, c = constant rate of degradation of fraction; ERD (effective ruminal degradability) = a + [bc/(c + kp)]. a,b,c Values within a row with different superscripts differ significantly at p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sun, M.; Liu, P.; Xing, Y.; Zhang, M.; Yu, Y.; Wang, W.; Li, D. Effects of Chestnut Tannin on Nutrient Digestibility, Ruminal Protease Enzymes, and Ruminal Microbial Community Composition of Sheep. Fermentation 2025, 11, 302. https://doi.org/10.3390/fermentation11060302

AMA Style

Sun M, Liu P, Xing Y, Zhang M, Yu Y, Wang W, Li D. Effects of Chestnut Tannin on Nutrient Digestibility, Ruminal Protease Enzymes, and Ruminal Microbial Community Composition of Sheep. Fermentation. 2025; 11(6):302. https://doi.org/10.3390/fermentation11060302

Chicago/Turabian Style

Sun, Mei, Peinan Liu, Yuanyuan Xing, Meimei Zhang, Yongqiang Yu, Weiyun Wang, and Dabiao Li. 2025. "Effects of Chestnut Tannin on Nutrient Digestibility, Ruminal Protease Enzymes, and Ruminal Microbial Community Composition of Sheep" Fermentation 11, no. 6: 302. https://doi.org/10.3390/fermentation11060302

APA Style

Sun, M., Liu, P., Xing, Y., Zhang, M., Yu, Y., Wang, W., & Li, D. (2025). Effects of Chestnut Tannin on Nutrient Digestibility, Ruminal Protease Enzymes, and Ruminal Microbial Community Composition of Sheep. Fermentation, 11(6), 302. https://doi.org/10.3390/fermentation11060302

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop