Preliminary Study on Screening and Genetic Characterization of Lactic Acid Bacteria Strains with Cadmium, Lead, and Chromium Removal Potentials
Abstract
1. Introduction
2. Materials and Methods
2.1. Microorganism and Materials
2.2. Screening of Lead-Resistant Lactobacilli
2.3. Screening of Chromium-Resistant Lactobacilli
2.4. Determination of Minimum Inhibitory Concentration (MIC) of Compound Heavy Metal Resistant Lactobacilli
2.5. Heavy Metal Removal Performance of Resistant Strains
2.6. Resistance Gene Testing
2.7. Identification of Strains
2.8. Statistical Analysis
3. Results
3.1. Pb-Resistant Ability of LAB Strains
3.2. Cr-Resistant Ability of LAB Strains
3.3. The MIC of Compound Heavy Metal Resistant Strains
3.4. Re-Screening of Heavy Metal Removal Strains
3.5. Resistance Gene Identification
3.5.1. PCR Amplification of Heavy Metal Resistance Genes
3.5.2. Real-Time PCR of Heavy Metal Resistance Genes
3.5.3. Absolute Quantitative Detection of the Expression of Three Resistance Genes in Different Resistant Strains
3.6. Homology Analysis of Selected LABs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jin, Z.H. Study on improvement of industrial heavy metal wastewater treatment process. Petrochem. Ind. Technol. 2019, 26, 321–323. [Google Scholar] [CrossRef]
- Li, R.; Feng, P.Y.; Ye, Z.; Chen, X.; Li, X.K.; Liu, P. Gut remediation: A new approach to reduce the accumulation of heavy metals by using probiotics. Microbiol. Bull. 2019, 46, 1712–1722. [Google Scholar] [CrossRef]
- Beglari, S.; Fereshteh, S.; Milani, M.; Rezaie, N.; Rohani, M. Lactoremediation: Heavy metals elimination from the gastrointestinal tract by lactic acid bacteria. Food Biosci. 2023, 56, 103202. [Google Scholar] [CrossRef] [Scilit]
- Chellaiah, E.R. Cadmium (heavy metals) bioremediation by Pseudomonas aeruginosa: A mini review. Appl. Water Sci. 2018, 8, 154. [Google Scholar] [CrossRef] [Scilit]
- Peng, W.H.; Li, X.M.; Song, J.X.; Jiang, W.; Liu, Y.Y. Bioremediation of cadmium- and zinc-contaminated soil using Rhodobacter sphaeroides. Chemosphere 2018, 197, 33–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Divya, M.; Aanand, S.; Srinivasan, A.; Ahilan, B. Efficiency of indigenous mixed microbial consortium in bioremediation of seafood processing plant effluent. Biochem. Cell. Arch. 2016, 16, 303–310. [Google Scholar]
- Hsueh, Y.M.; Lee, C.Y.; Chien, S.N.; Chen, W.J.; Shiue, H.S.; Huang, S.R.; Lin, M.I.; Mu, S.C.; Hsieh, R.L. Association of blood heavy metals with developmental delays and health status in children. Sci. Rep. 2017, 7, 43608. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Yao, J.; Yuan, Z.M.; Wang, T.; Zhang, Y.; Wang, F. Bioremediation of Cd by strain GZ-22 isolated from mine soil based on biosorption and microbially induced carbonate precipitation. Environ. Sci. Pollut. Res. 2017, 24, 372–380. [Google Scholar] [CrossRef] [Scilit]
- Bai, X.; Yuan, Z.H.; Wang, J.P.; Ding, X.M.; Bai, S.P.; Zeng, Q.F.; Zhang, K.Y. Study on the Distribution of Heavy Metals in Commonly Used Energy Feed and Protein Feed in Sichuan Province. J. Anim. Nutr. 2016, 28, 2847–2860. [Google Scholar] [CrossRef]
- Xie, Y.; Fan, J.; Zhu, W.; Erick, A.; Lou, Y.; Chen, L.; Fu, J. Effect of heavy metals pollution on soil microbial diversity and bermudagrass genetic variation. Front. Plant Sci. 2016, 7, 755. [Google Scholar] [CrossRef] [Scilit]
- Shu, G.W.; Shi, X.Y.; Chen, L.; Kou, J.; Meng, J.; Chen, H. Antioxidant Peptides from Goat Milk Fermented by Lactobacillus casei L61: Preparation, Optimization, and Stability Evaluation in Simulated Gastrointestinal Fluid. Nutrients 2018, 10, 797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, G.; Zhao, Y.; Tian, F.W.; Jin, X.; Chen, H.Q.; Liu, X.M.; Zhang, Q.X.; Zhao, J.X.; Chen, Y.Q.; Zhang, H. Screening of adhesive lactobacilli with antagonistic activity against Campylobacter jejuni. Food Control 2014, 44, 49–57. [Google Scholar] [CrossRef] [Scilit]
- Pakdel, M.; Soleimanian-Zad, S.; Akbari-Alavijeh, S. Screening of lactic acid bacteria to detect potent biosorbents of lead and cadmium. Food Control 2019, 100, 144–150. [Google Scholar] [CrossRef] [Scilit]
- Lynch, K.M.; Zannini, E.; Coffey, A.; Arendt, E.K. Lactic Acid Bacteria Exopolysaccharides in Foods and Beverages: Isolation, Properties, Characterization, and Health Benefits. Annu. Rev. Food Sci. Technol. 2018, 9, 155–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheng, G.P.; Xu, J.; Luo, H.W.; Li, W.W.; Hu, F.C. Thermodynamic analysis on the binding of heavy metals onto extracellular polymeric substances (EPS) of activated sludge. Water Res. 2013, 47, 607–614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Jia, Y.B.; Zhao, X.F.; He, Y.F. Research progress in the adsorption of heavy metals by lactic acid bacteria. Microbiol. China 2018, 45, 2254–2262. [Google Scholar] [CrossRef]
- Zhao, X.F.; He, Y.F.; Li, C. Study on the lead adsorption characteristics of a lead-resistant lactic acid bacteria. J. Chin. Inst. Food Sci. Technol. 2021, 21, 58–64. [Google Scholar] [CrossRef]
- Bhakta, J.N.; Ohnishi, K.; Munekage, Y.; Iwasaki, K.; Wei, M.Q. Characterization of lactic acid bacteria-based probiotics as potential heavy metal sorbents. J. Appl. Microbiol. 2012, 112, 1193–1206. [Google Scholar] [CrossRef] [Scilit]
- Fu, Y.P.; Liao, L.Y.; Liu, Y.; Wu, W.G. Optimization of fermentation process of removal of cadmium in rice powder using lactic acid bacteria. Chin. J. Agric. Eng. 2015, 31, 319–326. [Google Scholar] [CrossRef]
- Lin, X.Y.; Mu, R.X.; Cao, Z.Y.; Zhu, Z.W.; Chen, M.X. Isolation and Cadmium Adsorption Mechanisms of Cadmium-Resistant Bacteria Strains. Environ. J. Agric. Sci. 2015, 34, 1700–1706. [Google Scholar] [CrossRef]
- Xia, S.; Gu, S.S.; Guan, N.Y.; Ge, J.W.; Cui, W. Isolation and identification of lead-resistant lactic acid bacteria with probiotic characteristics in animal intestine. China Vet. Sci. 2015, 45, 1254–1259. [Google Scholar]
- Shu, G.W.; Zheng, Q.Q.; Chen, L.; Jiang, F.F.; Dai, C.J.; Hui, Y.; Du, G.L. Screening and identification of Lactobacillus with potential cadmium removal and its application in fruit and vegetable juices. Food Control 2021, 126, 108053. [Google Scholar] [CrossRef] [Scilit]
- Li, R.; Ou, J.; Dai, Q.H.; Ma, C.C. Relativity Comparison of Tolerance and Adsorption of Lactobacillus plantarum on Heavy Metals Pb2+, Cr6+ and Cu2+. J. Microbiol. 2019, 39, 52–58. [Google Scholar] [CrossRef]
- Liu, S.L.; Zheng, Y.; Ma, Y.; Sarwar, A.; Zhao, X.; Luo, T.Q.; Yang, Z.N. Evaluation and Proteomic Analysis of Lead Adsorption by Lactic Acid Bacteria. Int. J. Mol. Sci. 2019, 20, 5540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhai, Q.X.; Yin, R.J.; Yu, L.L.; Wang, G.; Tian, F.W.; Yu, R.P.; Zhao, J.X.; Liu, X.M.; Chen, Y.Q.; Zhang, H.; et al. Screening of lactic acid bacteria with potential protective effects against cadmium toxicity. Food Control 2015, 54, 23–30. [Google Scholar] [CrossRef] [Scilit]
- GB 4789.2-2022; Food Safety National Standard Food Microbiological Test Total Bacterial Count. National Health Commission, State Administration for Market Regulation: Beijing, China, 2022.
- Ni, H.Y. Screening of Lactic Acid Bacteria Tolerant to Heavy Metal Copper and Study on Their Copper Binding Properties. Master’s Thesis, Jinan University, Guangzhou, China, 2014. [Google Scholar]
- Yi, J.M. Using High-Throughput Sequencing Technology to Study the Molecular Mechanism of Electromagnetic Radiation Accelerating the Development of Caenorhabditis elegans and the Factorial Analysis of the Inverted “S”-Shaped Curve of PCR Amplification Efficiency. Master’s Thesis, Anhui Medical University, Hefei, China, 2014. [Google Scholar]
- Liu, B. Analysis of Clinical and Molecular Biological Prognostic Factors in EBV-Positive Diffuse Large B-Cell Lymphoma. Master’s Thesis, Chinese People’s Liberation Army Naval Medical University, Shanghai, China, 2018. [Google Scholar]
- Li, Y.Y.; Jie, W.F.; Zhu, T.; Li, Q.W. Identification of proteins related to immune stimulation by Aeromonas in intestinal response of Northeast lamprey. Chin. J. Biochem. Mol. Biol. 2016, 32, 1256–1263. [Google Scholar]
- Bhakta, J.N.; Munekage, Y.; Ohnishi, K. Isolation and Characterization of Cadmium- and Arsenic-Absorbing Bacteria for Bioremediation. Water Air Soil Pollut. 2014, 225, 2151. [Google Scholar] [CrossRef] [Scilit]
- Zhou, W.; Li, Y.G.; Cheng, G.J.; Yang, K. Isolation, identification and genotypic analysis of a bacterium strain with resistance to chromium. J. Huazhong Agric. Univ. 2008, 2, 248–250. [Google Scholar] [CrossRef]
- Zhou, S.M.; Dong, L.L.; He, Y.; Xiao, H. Characterization of chromate resistance in genetically engineered Escherichia coli expressing chromate ion transporter ChrA. J. South. Med. Univ. 2017, 37, 1290–1295. [Google Scholar] [CrossRef]
- Wang, N.H. Sequence Variation of Cotton R2R3-MYB Gene Family between Sea and Terrestrial Species and Its Correlation with Fiber Traits. Ph.D. Thesis, Northwest A&F University, Yangling, China, 2019. [Google Scholar]
- Zhao, C.F. Observation of Endoto and Tumor Microvascular Normalization Time Window Combined with Cisplatin in the Treatment of Lung Cancer Experimental Study. Master’s Thesis, Kawakita Medical School, Nanchong, China, 2014. [Google Scholar]
- Lajayer, B.A.; Najafi, N.; Moghiseh, E.; Mosaferi, M.; Hadian, J. Micronutrient and Heavy Metal Concentrations in Basil Plant Cultivated on Irradiated and Non-Irradiated Sewage Sludge-Treated Soil and Evaluation of Human Health Risk. Regul. Toxicol. Pharmacol. 2019, 104, 141–150. [Google Scholar] [CrossRef] [Scilit]
- Lajayer, B.A.; Ghorbanpour, M.; Nikabadi, S. Heavy metals in contaminated environment: Destiny of secondary metabolite biosynthesis, oxidative status and phytoextraction in medicinal plants. Ecotoxicol. Environ. Saf. 2017, 145, 377–390. [Google Scholar] [CrossRef] [Scilit]
- Bazireh, H.; Shariati, P.; Azimzadeh Jamalkandi, S.; Ahmadi, A.; Boroumand, M.A. Isolation of novel probiotic Lactobacillus and Enterococcus strains from human salivary and fecal sources. Front. Microbiol. 2020, 11, 597946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, S.; Li, Y.; Wang, P.; Zhang, H.; Ali, E.F.; Li, R.; Shaheen, S.M.; Zhang, Z. Lactic acid bacteria promoted soil quality and enhanced phytoextraction of Cd and Zn by mustard: A trial for bioengineering of toxic metal contaminated mining soils. Environ. Res. 2023, 216, 114646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.; Song, W.C. Research progress on the mechanism of microbial adsorption of heavy metalions. Anhui Agric. Sci. 2018, 46, 15–17. [Google Scholar] [CrossRef]
- Zhai, Q.X. Study on the Effect and Mechanism of Lactic Acid Bacteria in Reducing the Harm of Cadmium. Ph.D. Thesis, Gangnam University, Wuxi, China, 2015. [Google Scholar]
- Halttunen, T.; Salminen, S.; Tahvonen, R. Rapid removal of lead and cadmium from water by specific lactic acid bacteria. Int. J. Food Microbiol. 2007, 114, 30–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.J.; Du, L.; Xie, J.L. Study on the ability of Lactobacillus plantarum X7021 in the adsorption of heavy metals and degradation of nitrite. J. Food Saf. Qual. 2021, 12, 4786–4792. [Google Scholar] [CrossRef]
- Liu, S.L.; Yang, Z.N. Recent Progress in the Adsorption of Heavy Metals by Lactic Acid Bacteria. Dairy Sci. Technol. 2019, 42, 23–27. [Google Scholar] [CrossRef]
- Feng, M.Q.; Chen, X.H.; Li, C.C.; Nurgul, R.H.; Dong, M.S. Isolation and identification of an exopolysaccharide producing lactic acid bacterium strain from Chinese paocai and biosorption of Pb(II) by its exopolysaccharide. J. Food Sci. 2012, 77, 111–117. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.F. Study on Isolation, Identification, Adsorption Characteristics and Mechanism of Lead-Resistant Lactic Acid Bacteria. Ph.D. Thesis, Inner Mongolia Agricultural University, Hohhot, China, 2020. [Google Scholar]
- Shao, X.; Sun, K.; Xiong, Q.; Yu, C.; Xu, X.Y. Adsorption mechanism of heavy metal cadmium by cadmium-tolerant lactic acid bacteria. Food Ferment. Ind. 2017, 43, 48–53. [Google Scholar]
- Wang, Y.; Han, J.; Ren, Q.; Liu, Z.; Zhang, X.; Wu, Z. The involvement of lactic acid bacteria and their exopolysaccharides in the biosorption and detoxication of heavy metals in the gut. Biol. Trace Elem. Res. 2023, 2023, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Fan, C.H.; Ma, H.R.; Hua, L.; Wang, J.H.; Wang, H.J. FTIR and XPS Analysis of Characteristics of Synthesized Zeolite and Removal Mechanisms for Cr(III). Spectrosc. Spectr. Anal. 2012, 32, 324–329. [Google Scholar] [CrossRef]
- Gerbino, E.; Mobili, P.; Tymczyszyn, E.; Fausto, R.; Gómez-Zavaglia, A. FTIR spectroscopy structural analysis of the interaction between Lactobacillus kefir S-layers and metal ions. J. Mol. Struct. 2011, 987, 186–192. [Google Scholar] [CrossRef] [Scilit]
- Qu, C.; Yang, S.; Mortimer, M.; Zhang, M.; Chen, J.; Wu, Y.; Chen, W.; Cai, P.; Huang, Q. Functional group diversity for the adsorption of lead (Pb) to bacterial cells and extracellular polymeric substances. Environ. Pollut. 2022, 295, 118651. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Resistance Gene | Primer Name | Sequence |
|---|---|---|
| pbrT | pbrT-F | AGCGCGCCCAGGAGCGCAGCGTCTT |
| pbrT-R | GGCTCGAAGCCGTCGAGRTA | |
| chrA | chrA-F | TGGCTCTCGCTGTTCTTTGT |
| chrA-R | TAAGTGCGACAAGGGCAACT | |
| czcD | czcD-F | TCATCGCCGGTGCGATCATCAT |
| czcD-R | TGTCATTCACGACATGAACC |
| Strain Number | Heavy Metal Concentration (mg/L) | |||||
|---|---|---|---|---|---|---|
| Pb2+ | 0 | 100 | 500 | 1000 | 1500 | |
| Cd2+ | 0 | 30 | 50 | 100 | 150 | |
| Cr6+ | 0 | 100 | 500 | 1000 | 1500 | |
| K5 | +++ | +++ | +++ | +++ | ++ | |
| B27 | +++ | +++ | ++ | ++ | + | |
| 22 | +++ | +++ | ++ | + | - | |
| L4 | +++ | +++ | + | - | - | |
| S73 | +++ | +++ | + | - | - | |
| 7469 | +++ | +++ | +++ | ++ | - | |
| L19 | +++ | +++ | + | + | - | |
| KD-3 | +++ | +++ | +++ | +++ | ++ | |
| LB6 | +++ | +++ | + | - | - | |
| Strain Number | Lactobacilli | Similarity (%) |
|---|---|---|
| 7469 | Lacticaseibacillus rhamnosus | 100 |
| B27 | Limosilactobacillus fermentum | 99.25 |
| KD-3 | Lactobacillus helveticus | 100 |
| K5 | Lactobacillus helveticus | 99.98 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, Y.; Shu, G.; Liu, Z.; Wang, Z.; Lei, H.; Zheng, Q.; Kang, H.; Chen, L. Preliminary Study on Screening and Genetic Characterization of Lactic Acid Bacteria Strains with Cadmium, Lead, and Chromium Removal Potentials. Fermentation 2024, 10, 41. https://doi.org/10.3390/fermentation10010041
Xu Y, Shu G, Liu Z, Wang Z, Lei H, Zheng Q, Kang H, Chen L. Preliminary Study on Screening and Genetic Characterization of Lactic Acid Bacteria Strains with Cadmium, Lead, and Chromium Removal Potentials. Fermentation. 2024; 10(1):41. https://doi.org/10.3390/fermentation10010041
Chicago/Turabian StyleXu, Yunli, Guowei Shu, Zhengxin Liu, Zifei Wang, Huan Lei, Qiqi Zheng, Hongjuan Kang, and Li Chen. 2024. "Preliminary Study on Screening and Genetic Characterization of Lactic Acid Bacteria Strains with Cadmium, Lead, and Chromium Removal Potentials" Fermentation 10, no. 1: 41. https://doi.org/10.3390/fermentation10010041
APA StyleXu, Y., Shu, G., Liu, Z., Wang, Z., Lei, H., Zheng, Q., Kang, H., & Chen, L. (2024). Preliminary Study on Screening and Genetic Characterization of Lactic Acid Bacteria Strains with Cadmium, Lead, and Chromium Removal Potentials. Fermentation, 10(1), 41. https://doi.org/10.3390/fermentation10010041

