Oxidative Stress and Its Modulation by Ladostigil Alter the Expression of Abundant Long Non-Coding RNAs in SH-SY5Y Cells
Abstract
1. Introduction
2. Results
2.1. Ladostigil Suppresses Cell Death
2.2. Apoptotic Signal in SH-SY5Y Cells Exposed to Sin1
2.3. LncRNA Expression Levels in SH-SY5Y Cells
2.4. Chronic Oxidative Stress Upregulated a Collection of LncRNAs
2.5. Cancer-Related SNHG Family Members Are Differentially Expressed by Sin1
2.6. Impact of Ladostigil on ncRNA Profiles
2.7. A Shift in Abundant ncRNAs upon Stress Is Cell-State-Dependent
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. SH-SY5Y Cell Culture
4.3. Cell Viability Assay
4.4. Flow Cytometry
4.5. RNA Sequencing
4.6. Reverse Transcription Polymerase–Chain Reaction (RT-PCR)
4.7. Bioinformatic Analysis and Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AD | Alzheimer’s disease |
| CNS | central nervous system |
| DE | differentially expressed |
| ER | endoplasmic reticulum |
| FACS | fluorescence-activated cell sorting |
| FC | fold change |
| FCS | fetal calf serum |
| FDR | false discovery rate |
| H2O2 | hydrogen peroxide |
| MBSs | miRNA binding sites |
| MEM | minimum essential medium |
| NT | not treated |
| Nrf2 | nuclear factor erythroid 2-related factor 2 |
| O2− | superoxide anion |
| ONOO− | peroxynitrite |
| PD | Parkinson’s disease |
| PI | propidium iodide |
| I/R | ischemia and reperfusion |
| RNS | reactive nitrogen species |
| ROS | reactive oxygen species |
| TF | transcription factor |
| TMM | trimmed mean of M-values. |
References
- Head, E.; Liu, J.; Hagen, T.; Muggenburg, B.; Milgram, N.; Ames, B.; Cotman, C. Oxidative damage increases with age in a canine model of human brain aging. J. Neurochem. 2002, 82, 375–381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, H.; Lim, H.-W.; More, S.V.; Kim, B.-W.; Koppula, S.; Kim, I.S.; Choi, D.-K. The role of free radicals in the aging brain and Parkinson’s disease: Convergence and parallelism. Int. J. Mol. Sci. 2012, 13, 10478–10504. [Google Scholar] [CrossRef] [Scilit]
- Stefanatos, R.; Sanz, A. The role of mitochondrial ROS in the aging brain. FEBS Lett. 2018, 592, 743–758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cobb, C.A.; Cole, M.P. Oxidative and nitrative stress in neurodegeneration. Neurobiol. Dis. 2015, 84, 4–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gandhi, S.; Abramov, A.Y. Mechanism of oxidative stress in neurodegeneration. Oxidative Med. Cell. Longev. 2012, 2012, 428010. [Google Scholar] [CrossRef] [Scilit]
- Loring, J.; Wen, X.; Lee, J.; Seilhamer, J.; Somogyi, R. A gene expression profile of Alzheimer’s disease. DNA Cell Biol. 2001, 20, 683–695. [Google Scholar] [CrossRef] [Scilit]
- Cooper-Knock, J.; Kirby, J.; Ferraiuolo, L.; Heath, P.R.; Rattray, M.; Shaw, P.J. Gene expression profiling in human neurodegenerative disease. Nat. Rev. Neurol. 2012, 8, 518–530. [Google Scholar] [CrossRef] [Scilit]
- Weinreb, O.; Amit, T.; Bar-Am, O.; Youdim, M.B. Ladostigil: A novel multimodal neuroprotective drug with cholinesterase and brain-selective monoamine oxidase inhibitory activities for Alzheimer’s disease treatment. Curr. Drug Targets 2012, 13, 483–494. [Google Scholar] [CrossRef] [Scilit]
- Panarsky, R.; Luques, L.; Weinstock, M. Anti-inflammatory effects of ladostigil and its metabolites in aged rat brain and in microglial cells. J. Neuroimmune Pharmacol. 2012, 7, 488–498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shoham, S.; Linial, M.; Weinstock, M. Age-Induced Spatial Memory Deficits in Rats Are Correlated with Specific Brain Region Alterations in Microglial Morphology and Gene Expression. J. Neuroimmune Pharm. 2019, 14, 251–262. [Google Scholar] [CrossRef] [Scilit]
- Linial, M.; Stern, A.; Weinstock, M. Effect of ladostigil treatment of aging rats on gene expression in four brain areas associated with regulation of memory. Neuropharmacology 2020, 177, 108229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zohar, K.; Lezmi, E.; Eliyahu, T.; Linial, M. Ladostigil Attenuates Induced Oxidative Stress in Human Neuroblast-like SH-SY5Y Cells. Biomedicines 2021, 9, 1251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geisler, S.; Coller, J. RNA in unexpected places: Long non-coding RNA functions in diverse cellular contexts. Nat. Rev. Mol. Cell Biol. 2013, 14, 699–712. [Google Scholar] [CrossRef] [Scilit]
- Ang, C.E.; Trevino, A.E.; Chang, H.Y. Diverse lncRNA mechanisms in brain development and disease. Curr. Opin. Genet. Dev. 2020, 65, 42–46. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Shen, C.; Zhu, J.; Shen, G.; Li, Z.; Dong, J. Long Noncoding RNAs in the Regulation of Oxidative Stress. Oxidative Med. Cell. Longev. 2019, 2019, 1318795. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.; Lee, H.; Haspel, J.A.; Jin, Y. Long noncoding RNA FOXD3-AS1 regulates oxidative stress-induced apoptosis via sponging microRNA-150. FASEB J. 2017, 31, 4472–4481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, W.; Zhang, Q.; Zhang, J.; Pan, W.; Zhao, J.; Xu, Y. Long non-coding RNA MALAT1 contributes to cell apoptosis by sponging miR-124 in Parkinson disease. Cell Biosci. 2017, 7, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Xu, Z.; Yu, Y.; Cao, J.; Qiao, Y.; Qiao, H.; Suo, G. Comprehensive analysis of the lncRNA-associated ceRNA network identifies neuroinflammation biomarkers for Alzheimer’s disease. Mol. Omics. 2019, 15, 459–469. [Google Scholar] [CrossRef] [Scilit]
- Yao, J.; Wang, X.Q.; Li, Y.J.; Shan, K.; Yang, H.; Wang, Y.N.Z.; Yao, M.D.; Liu, C.; Li, X.M.; Shen, Y. Long non-coding RNA MALAT 1 regulates retinal neurodegeneration through CREB signaling. EMBO Mol. Med. 2016, 8, 346–362. [Google Scholar] [CrossRef] [Scilit]
- Saeedi Borujeni, M.J.; Esfandiary, E.; Baradaran, A.; Valiani, A.; Ghanadian, M.; Codoner-Franch, P.; Basirat, R.; Alonso-Iglesias, E.; Mirzaei, H.; Yazdani, A. Molecular aspects of pancreatic beta-cell dysfunction: Oxidative stress, microRNA, and long noncoding RNA. J. Cell Physiol. 2019, 234, 8411–8425. [Google Scholar] [CrossRef] [Scilit]
- Meng, K.; Jiao, J.; Zhu, R.-R.; Wang, B.-Y.; Mao, X.-B.; Zhong, Y.-C.; Zhu, Z.-F.; Yu, K.-W.; Ding, Y.; Xu, W.-B. The long noncoding RNA hotair regulates oxidative stress and cardiac myocyte apoptosis during ischemia-reperfusion injury. Oxidative Med. Cell. Longev. 2020, 2020, 1645249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, H.; Du, G.; Song, X.; Li, L. Non-coding transcripts from enhancers: New insights into enhancer activity and gene expression regulation. Genom. Proteom. Bioinform. 2017, 15, 201–207. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Wang, Z.; Xu, B.; Ji, N.; Meng, P.; Gu, L.; Li, Y. Long non-coding RNA NORAD protects against cerebral ischemia/reperfusion injury induced brain damage, cell apoptosis, oxidative stress and inflammation by regulating miR-30a-5p/YWHAG. Bioengineered 2021, 12, 9174–9188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moran, V.A.; Perera, R.J.; Khalil, A.M. Emerging functional and mechanistic paradigms of mammalian long non-coding RNAs. Nucleic Acids Res. 2012, 40, 6391–6400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, M.; Lu, H.; Liu, J.; Wu, S.; Kim, P.; Zhou, X. lncRNAfunc: A knowledgebase of lncRNA function in human cancer. Nucleic Acids Res. 2022, 50, D1295–D1306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; He, W.; Ibrahim, S.A.; He, Q.; Jin, J. Circular RNAs: Novel Players in the Oxidative Stress-Mediated Pathologies, Biomarkers, and Therapeutic Targets. Oxidative Med. Cell. Longev. 2021, 2021, 6634601. [Google Scholar] [CrossRef] [Scilit]
- Kim, C.; Kang, D.; Lee, E.K.; Lee, J.S. Long noncoding RNAs and RNA-binding proteins in oxidative stress, cellular senescence, and age-related diseases. Oxidative Med. Cell. Longev. 2017, 2017, 2062384. [Google Scholar] [CrossRef] [Scilit]
- Forster, J.; Köglsberger, S.; Trefois, C.; Boyd, O.; Baumuratov, A.; Buck, L.; Balling, R.; Antony, P. Characterization of differentiated SH-SY5Y as neuronal screening model reveals increased oxidative vulnerability. J. Biomol. Screen. 2016, 21, 496–509. [Google Scholar] [CrossRef] [Scilit]
- Singh, R.J.; Hogg, N.; Joseph, J.; Konorev, E.; Kalyanaraman, B. The peroxynitrite generator, SIN-1, becomes a nitric oxide donor in the presence of electron acceptors. Arch. Biochem. Biophys. 1999, 361, 331–339. [Google Scholar] [CrossRef] [Scilit]
- Mathy-Hartert, M.; Mouithys-Mickalad, A.; Kohnen, S.; Deby-Dupont, G.; Lamy, M.; Hans, P. Effects of propofol on endothelial cells subjected to a peroxynitrite donor (SIN-1). Anaesthesia 2000, 55, 1066–1071. [Google Scholar] [CrossRef] [Scilit]
- Cuddy, L.K.; Gordon, A.C.; Black, S.A.; Jaworski, E.; Ferguson, S.S.; Rylett, R.J. Peroxynitrite donor SIN-1 alters high-affinity choline transporter activity by modifying its intracellular trafficking. J. Neurosci. 2012, 32, 5573–5584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rieger, A.M.; Nelson, K.L.; Konowalchuk, J.D.; Barreda, D.R. Modified annexin V/propidium iodide apoptosis assay for accurate assessment of cell death. J. Vis. Exp. 2011, 50, e2597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tripathi, S.; Shree, B.; Mohapatra, S.; Swati; Basu, A.; Sharma, V. The Expanding Regulatory Mechanisms and Cellular Functions of Long Non-coding RNAs (lncRNAs) in Neuroinflammation. Mol. Neurobiol. 2021, 58, 2916–2939. [Google Scholar] [CrossRef] [Scilit]
- Giannakakis, A.; Zhang, J.; Jenjaroenpun, P.; Nama, S.; Zainolabidin, N.; Aau, M.Y.; Yarmishyn, A.A.; Vaz, C.; Ivshina, A.V.; Grinchuk, O.V. Contrasting expression patterns of coding and noncoding parts of the human genome upon oxidative stress. Sci. Rep. 2015, 5, 9737. [Google Scholar] [CrossRef] [Scilit]
- Zimta, A.A.; Tigu, A.B.; Braicu, C.; Stefan, C.; Ionescu, C.; Berindan-Neagoe, I. An Emerging Class of Long Non-coding RNA With Oncogenic Role Arises From the snoRNA Host Genes. Front Oncol. 2020, 10, 389. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Zhu, T.; Li, Q.; Sun, G.; Sun, X. Long Non-Coding RNA-Mediated Competing Endogenous RNA Networks in Ischemic Stroke: Molecular Mechanisms, Therapeutic Implications, and Challenges. Front Pharm. 2021, 12, 765075. [Google Scholar] [CrossRef] [Scilit]
- Nagy, A.; Munkacsy, G.; Gyorffy, B. Pancancer survival analysis of cancer hallmark genes. Sci. Rep. 2021, 11, 6047. [Google Scholar] [CrossRef] [Scilit]
- Mahmoudi, E.; Cairns, M.J. MiR-137: An important player in neural development and neoplastic transformation. Mol. Psychiatry 2017, 22, 44–55. [Google Scholar] [CrossRef] [Scilit]
- Beneventi, G.; Munita, R.; Cao Thi Ngoc, P.; Madej, M.; Ciesla, M.; Muthukumar, S.; Krogh, N.; Nielsen, H.; Swaminathan, V.; Bellodi, C. The small Cajal body-specific RNA 15 (SCARNA15) directs p53 and redox homeostasis via selective splicing in cancer cells. NAR Cancer 2021, 3, zcab026. [Google Scholar] [CrossRef] [Scilit]
- Fishilevich, S.; Nudel, R.; Rappaport, N.; Hadar, R.; Plaschkes, I.; Iny Stein, T.; Rosen, N.; Kohn, A.; Twik, M.; Safran, M.; et al. GeneHancer: Genome-wide integration of enhancers and target genes in GeneCards. Database 2017, 2017. [Google Scholar] [CrossRef] [Scilit]
- Lang, B.; Armaos, A.; Tartaglia, G.G. RNAct: Protein-RNA interaction predictions for model organisms with supporting experimental data. Nucleic Acids Res. 2019, 47, D601–D606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeggari, A.; Marks, D.S.; Larsson, E. miRcode: A map of putative microRNA target sites in the long non-coding transcriptome. Bioinformatics 2012, 28, 2062–2063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Korecka, J.A.; van Kesteren, R.E.; Blaas, E.; Spitzer, S.O.; Kamstra, J.H.; Smit, A.B.; Swaab, D.F.; Verhaagen, J.; Bossers, K. Phenotypic characterization of retinoic acid differentiated SH-SY5Y cells by transcriptional profiling. PLoS ONE 2013, 8, e63862. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weinberg, M.S.; Wood, M.J. Short non-coding RNA biology and neurodegenerative disorders: Novel disease targets and therapeutics. Hum. Mol. Genet. 2009, 18, R27–R39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Riva, P.; Ratti, A.; Venturin, M. The long non-coding RNAs in neurodegenerative diseases: Novel mechanisms of pathogenesis. Curr. Alzheimer Res. 2016, 13, 1219–1231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.Y.; Kuo, H.C. Functional roles and networks of non-coding RNAs in the pathogenesis of neurodegenerative diseases. J. Biomed. Sci. 2020, 27, 49. [Google Scholar] [CrossRef] [Scilit]
- Lyu, Y.; Bai, L.; Qin, C. Long noncoding RNAs in neurodevelopment and Parkinson’s disease. Anim. Model Exp. Med. 2019, 2, 239–251. [Google Scholar] [CrossRef] [Scilit]
- Fan, Y.; Li, J.; Yang, Q.; Gong, C.; Gao, H.; Mao, Z.; Yuan, X.; Zhu, S.; Xue, Z. Dysregulated Long Non-coding RNAs in Parkinson’s Disease Contribute to the Apoptosis of Human Neuroblastoma Cells. Front Neurosci. 2019, 13, 1320. [Google Scholar] [CrossRef] [Scilit]
- Jathar, S.; Kumar, V.; Srivastava, J.; Tripathi, V. Technological Developments in lncRNA Biology. In Long Non Coding RNA Biology; Rao, M.R.S., Ed.; Springer: Singapore, 2017; pp. 283–323. [Google Scholar]
- Isin, M.; Ozgur, E.; Cetin, G.; Erten, N.; Aktan, M.; Gezer, U.; Dalay, N. Investigation of circulating lncRNAs in B-cell neoplasms. Clin. Chim. Acta 2014, 431, 255–259. [Google Scholar] [CrossRef] [Scilit]
- Taft, R.J.; Pang, K.C.; Mercer, T.R.; Dinger, M.; Mattick, J.S. Non-coding RNAs: Regulators of disease. J. Pathol. 2010, 220, 126–139. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.-T.; Ye, H.; Wei, P.-P.; Han, B.-W.; He, B.; Chen, Z.-H.; Chen, Y.-Q. LncRNAs H19 and HULC, activated by oxidative stress, promote cell migration and invasion in cholangiocarcinoma through a ceRNA manner. J. Hematol. Oncol. 2016, 9, 117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeni, P.F.; Mraz, M. LncRNAs in adaptive immunity: Role in physiological and pathological conditions. RNA Biol. 2021, 18, 619–632. [Google Scholar] [CrossRef] [Scilit]
- Yan, W.; Chen, Z.-Y.; Chen, J.-Q.; Chen, H.-M. LncRNA NEAT1 promotes autophagy in MPTP-induced Parkinson’s disease through stabilizing PINK1 protein. Biochem. Biophys. Res. Commun. 2018, 496, 1019–1024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Butler, A.A.; Johnston, D.R.; Kaur, S.; Lubin, F.D. Long noncoding RNA NEAT1 mediates neuronal histone methylation and age-related memory impairment. Sci. Signal. 2019, 12, eaaw9277. [Google Scholar] [CrossRef] [Scilit]
- Kang, Y.; Zhu, X.; Xu, Y.; Tang, Q.; Huang, Z.; Zhao, Z.; Lu, J.; Song, G.; Xu, H.; Deng, C. Energy stress-induced lncRNA HAND2-AS1 represses HIF1α-mediated energy metabolism and inhibits osteosarcoma progression. Am. J. Cancer Res. 2018, 8, 526. [Google Scholar]
- Wu, Q.; Yi, X. Down-regulation of Long Noncoding RNA MALAT1 Protects Hippocampal Neurons Against Excessive Autophagy and Apoptosis via the PI3K/Akt Signaling Pathway in Rats with Epilepsy. J. Mol. Neurosci. 2018, 65, 234–245. [Google Scholar] [CrossRef] [Scilit]
- Zeng, R.; Zhang, R.; Song, X.; Ni, L.; Lai, Z.; Liu, C.; Ye, W. The long non-coding RNA MALAT1 activates Nrf2 signaling to protect human umbilical vein endothelial cells from hydrogen peroxide. Biochem. Biophys. Res. Commun. 2018, 495, 2532–2538. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Xu, Y.; Zhao, M.; Gao, Z. Neuro-protective roles of long non-coding RNA MALAT1 in Alzheimer’s disease with the involvement of the microRNA-30b/CNR1 network and the following PI3K/AKT activation. Exp. Mol. Pathol. 2020, 117, 104545. [Google Scholar] [CrossRef] [Scilit]
- Jia, Y.; Yi, L.; Li, Q.; Liu, T.; Yang, S. LncRNA MALAT1 aggravates oxygen-glucose deprivation/reoxygenation-induced neuronal endoplasmic reticulum stress and apoptosis via the miR-195a-5p/HMGA1 axis. Biol. Res. 2021, 54, 8. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Zhu, L.; Guan, F.; Yan, Z.; Liu, D.; Han, W.; Chen, T. Relationship between schizophrenia and changes in the expression of the long non-coding RNAs Meg3, Miat, Neat1 and Neat2. J. Psychiatr. Res. 2018, 106, 22–30. [Google Scholar] [CrossRef] [Scilit]
- Pandey, A.; Sarkar, S.; Yadav, S.K.; Yadav, S.S.; Srikrishna, S.; Siddiqui, M.H.; Parmar, D.; Yadav, S. Studies on Regulation of Global Protein Profile and Cellular Bioenergetics of Differentiating SH-SY5Y Cells. Mol. Neurobiol. 2022, 59, 1799–1818. [Google Scholar] [CrossRef] [Scilit]
- Mahlab-Aviv, S.; Linial, N.; Linial, M. miRNA Combinatorics and its Role in Cell State Control-A Probabilistic Approach. Front Mol. Biosci. 2021, 8, 772852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamang, S.; Acharya, V.; Roy, D.; Sharma, R.; Aryaa, A.; Sharma, U.; Khandelwal, A.; Prakash, H.; Vasquez, K.M.; Jain, A. SNHG12: An LncRNA as a Potential Therapeutic Target and Biomarker for Human Cancer. Front Oncol. 2019, 9, 901. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, L.; Li, L.; Lei, J. Long noncoding RNA small nucleolar RNA host gene 12/microRNA-138-5p/nuclear factor I/B regulates neuronal apoptosis, inflammatory response, and oxidative stress in Parkinson’s disease. Bioengineered 2021, 12, 12867–12879. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lan, T.; Ma, W.; Hong, Z.; Wu, L.; Chen, X.; Yuan, Y. Long non-coding RNA small nucleolar RNA host gene 12 (SNHG12) promotes tumorigenesis and metastasis by targeting miR-199a/b-5p in hepatocellular carcinoma. J. Exp. Clin. Cancer Res. 2017, 36, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gu, R.; Liu, R.; Wang, L.; Tang, M.; Li, S.-R.; Hu, X. LncRNA RPPH1 attenuates Aβ25-35-induced endoplasmic reticulum stress and apoptosis in SH-SY5Y cells via miR-326/PKM2. Int. J. Neurosci. 2021, 131, 425–432. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J.; Geng, L.; Chen, Y.; Wu, C. SNHG1 promotes MPP(+)-induced cytotoxicity by regulating PTEN/AKT/mTOR signaling pathway in SH-SY5Y cells via sponging miR-153-3p. Biol. Res. 2020, 53, 1. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.K.; Shen, Z.A.; Yu, H.; Luo, T.; Gao, Y.; Du, P.F. Predicting lncRNA-Protein Interactions With miRNAs as Mediators in a Heterogeneous Network Model. Front Genet 2019, 10, 1341. [Google Scholar] [CrossRef] [Scilit]
- Imig, J.; Brunschweiger, A.; Brummer, A.; Guennewig, B.; Mittal, N.; Kishore, S.; Tsikrika, P.; Gerber, A.P.; Zavolan, M.; Hall, J. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nat. Chem. Biol. 2015, 11, 107–114. [Google Scholar] [CrossRef] [Scilit]
- Sanctuary, M.R.; Huang, R.H.; Jones, A.A.; Luck, M.E.; Aherne, C.M.; Jedlicka, P.; de Zoeten, E.F.; Collins, C.B. miR-106a deficiency attenuates inflammation in murine IBD models. Mucosal. Immunol. 2019, 12, 200–211. [Google Scholar] [CrossRef] [Scilit]
- Warburton, A.; Breen, G.; Rujescu, D.; Bubb, V.J.; Quinn, J.P. Characterization of a REST-regulated internal promoter in the schizophrenia genome-wide associated gene MIR137. Schizophr. Bull. 2015, 41, 698–707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fries, G.R.; Carvalho, A.F.; Quevedo, J. The miRNome of bipolar disorder. J. Affect. Disord. 2018, 233, 110–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, N.; Yin, Y.; Yao, Y.; Zhang, P. SNHG3/miR-2682-5p/HOXB8 promotes cell proliferation and migration in oral squamous cell carcinoma. Oral. Dis. 2021, 27, 1161–1170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhattacharjee, S.; Li, J.; Dashwood, R.H. Emerging crosstalk between long non-coding RNAs and Nrf2 signaling. Cancer Lett. 2020, 490, 154–164. [Google Scholar] [CrossRef] [Scilit]
- Padmavathi, G.; Ramkumar, K.M. MicroRNA mediated regulation of the major redox homeostasis switch, Nrf2, and its impact on oxidative stress-induced ischemic/reperfusion injury. Arch. Biochem. Biophys. 2021, 698, 108725. [Google Scholar] [CrossRef] [Scilit]
- Jayasuriya, R.; Ramkumar, K.M. Role of long non-coding RNAs on the regulation of Nrf2 in chronic diseases. Life Sci. 2021, 270, 119025. [Google Scholar] [CrossRef] [Scilit]
- Shipley, M.M.; Mangold, C.A.; Szpara, M.L. Differentiation of the SH-SY5Y Human Neuroblastoma Cell Line. J. Vis. Exp. 2016, 108, 53193. [Google Scholar] [CrossRef] [Scilit]
- Cheung, Y.-T.; Lau, W.K.-W.; Yu, M.-S.; Lai, C.S.-W.; Yeung, S.-C.; So, K.-F.; Chang, R.C.-C. Effects of all-trans-retinoic acid on human SH-SY5Y neuroblastoma as in vitro model in neurotoxicity research. Neurotoxicology 2009, 30, 127–135. [Google Scholar] [CrossRef] [Scilit]
- Schneider, L.; Giordano, S.; Zelickson, B.R.; Johnson, M.S.; Benavides, G.A.; Ouyang, X.; Fineberg, N.; Darley-Usmar, V.M.; Zhang, J. Differentiation of SH-SY5Y cells to a neuronal phenotype changes cellular bioenergetics and the response to oxidative stress. Free Radic. Biol. Med. 2011, 51, 2007–2017. [Google Scholar] [CrossRef] [Scilit]
- Lopes, F.M.; da Motta, L.L.; De Bastiani, M.A.; Pfaffenseller, B.; Aguiar, B.W.; de Souza, L.F.; Zanatta, G.; Vargas, D.M.; Schonhofen, P.; Londero, G.F.; et al. RA Differentiation Enhances Dopaminergic Features, Changes Redox Parameters, and Increases Dopamine Transporter Dependency in 6-Hydroxydopamine-Induced Neurotoxicity in SH-SY5Y Cells. Neurotox Res. 2017, 31, 545–559. [Google Scholar] [CrossRef] [Scilit]
- Meerloo, J.V.; Kaspers, G.J.; Cloos, J. Cell sensitivity assays: The MTT assay. In Cancer Cell Culture; Springer: Berlin/Heidelberg, Germany, 2011; pp. 237–245. [Google Scholar]
- Crowley, L.C.; Marfell, B.J.; Scott, A.P.; Waterhouse, N.J. Quantitation of Apoptosis and Necrosis by Annexin V Binding, Propidium Iodide Uptake, and Flow Cytometry. Cold Spring Harb. Protoc. 2016, 2016. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sawai, H.; Domae, N. Discrimination between primary necrosis and apoptosis by necrostatin-1 in Annexin V-positive/propidium iodide-negative cells. Biochem. Biophys. Res. Commun. 2011, 411, 569–573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brazma, A.; Parkinson, H.; Sarkans, U.; Shojatalab, M.; Vilo, J.; Abeygunawardena, N.; Holloway, E.; Kapushesky, M.; Kemmeren, P.; Lara, G.G. ArrayExpress—A public repository for microarray gene expression data at the EBI. Nucleic Acids Res. 2003, 31, 68–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brown, J.; Pirrung, M.; McCue, L.A. FQC Dashboard: Integrates FastQC results into a web-based, interactive, and extensible FASTQ quality control tool. Bioinformatics 2017, 33, 3137–3139. [Google Scholar] [CrossRef] [Scilit]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.; Hung, L.-H.; Lloyd, W.; Yeung, K.Y. Hot-starting software containers for STAR aligner. GigaScience 2018, 7, giy092. [Google Scholar] [CrossRef] [Scilit]
- Robinson, M.; McCarthy, D.; Chen, Y.; Smyth, G.K. edgeR: Differential expression analysis of digital gene expression data. User’s Guide 2013. Available online: http://rileylab.org/wp-content/uploads/2016/08/edgeRUsersGuide.pdf (accessed on 24 September 2022).






| LncRNA | LncRNA—Full Name | FDR | DE (Fold) | TMM a |
|---|---|---|---|---|
| MALAT1 | Metastasis-associated lung adenocarcinoma transcript 1 | 2.5 × 10−4 | 1.24 | 1963.7 |
| HAND2-AS1 | HAND2 antisense RNA 1 | 6.7 × 10−25 | 1.33 | 671.8 |
| GABPB1-AS1 | GABPB1 antisense RNA 1 | 1.7 × 10−18 | 1.38 | 280.8 |
| MIAT | Myocardial infarction associated transcript | 6.3 × 10−21 | 1.35 | 176.9 |
| NEAT1 | Nuclear paraspeckle assembly transcript 1 | 3.5 × 10−5 | 1.49 | 154.0 |
| CASC15 | Cancer susceptibility 15 | 1.5 × 10−16 | 1.27 | 85.8 |
| AC093849.2 | Novel transcript | 2.9 × 10−33 | 1.46 | 85.0 |
| CCDC144NL-AS1 | CCDC144NL antisense RNA 1 | 1.6 × 10−12 | 1.32 | 67.5 |
| MIR137HG | MIR137 host gene | 4.5 × 10−23 | 1.47 | 58.7 |
| GABPB1-IT1 | GABPB1 intronic transcript | 4.6 × 10−15 | 1.35 | 45.6 |
| LINC02268 | Long intergenic non-protein coding RNA 2268 | 1.2 × 10−16 | 1.45 | 44.6 |
| TTN-AS1 | TTN antisense RNA 1 | 1.2 × 10−6 | 1.26 | 43.0 |
| LINC01833 | Long intergenic non-protein coding RNA 1833 | 6.8 × 10−14 | 1.32 | 42.0 |
| LINC00632 | Long intergenic non-protein coding RNA 632 | 5.0 × 10−8 | 1.31 | 40.2 |
| AL392083.1 | Novel transcript, sense intronic to ADARB2 | 1.8 × 10−33 | 1.78 | 37.6 |
| GATA3-AS1 | GATA3 antisense RNA 1 | 2.3 × 10−8 | 1.32 | 36.5 |
| AC012354.1 | Novel transcript | 2.1 × 10−8 | 1.28 | 32.7 |
| AC015813.1 | Novel transcript | 4.3 × 10−7 | 1.35 | 31.8 |
| AC136621.1 | Novel transcript (TEC) | 2.6 × 10−27 | 0.56 | 37.7 |
| AL645608.2 | Novel transcript | 4.7 × 10−8 | 0.71 | 35.9 |
| AC010931.1 | Novel transcript | 1.5 × 10−19 | 0.68 | 34.9 |
| LINC01128 | Long intergenic non-protein coding RNA 1128 | 1.2 × 10−16 | 0.71 | 32.2 |
| EP400P1 | EP400 pseudogene 1 | 4.3 × 10−6 | 0.78 | 32.1 |
| ncRNA | GH Score | Total Score | Elite GH a | TSS (kb) | # of DB Evidence | TFs | Coding Targets | ncRNA Targets | Selected Target |
|---|---|---|---|---|---|---|---|---|---|
| AC010680.1 | 0.3 | 250.7 | * | 64.0 | 1/5 | 1.2 | 2 | 3 | FKBP7 |
| AC022400.6 | 1.9 | 250.7 | ** | 486.4 | 5/5 | 4.6 | 10 | 13 | SEC24C |
| AC105339.2 | 2.1 | 11.3 | * | 24.1 | 5/5 | 9.8 | 7 | 5 | WHAMM |
| RPARP-AS1 | 2.1 | 257.3 | ** | 546.8 | 5/5 | 6.6 | 13 | 5 | PPRC1 |
| Symbol | Transcript | Forward Primer | Reverse Primer | Amplicon (nt) |
|---|---|---|---|---|
| MALAT1 | NR_144568.1 | GCTCTGTGGTGTGGGATTGA | CTCGGGCGAGGCGTATTTAT | 386 |
| NEAT1 | NR_028272.1 | GGGACAACATTGACCAACGC | ACCACGGTCCATGAAGCATT | 356 |
| MIAT | NR_033321.2 | TCCCATTCCCGGAAGCTAGA | GAGGCATGAAATCACCCCCA | 274 |
| SNHG12 | NR_146383.1 | CCTTCTCTCGCTTCGGACTG | ATCTGCTTAAGTACGCCGGG | 167 |
| ACTB | NM_001101.5 | ACAGAGCCTCGCCTTTGCCGA | CATGCCCACCATCACGCCCTGG | 196 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zohar, K.; Giladi, E.; Eliyahu, T.; Linial, M. Oxidative Stress and Its Modulation by Ladostigil Alter the Expression of Abundant Long Non-Coding RNAs in SH-SY5Y Cells. Non-Coding RNA 2022, 8, 72. https://doi.org/10.3390/ncrna8060072
Zohar K, Giladi E, Eliyahu T, Linial M. Oxidative Stress and Its Modulation by Ladostigil Alter the Expression of Abundant Long Non-Coding RNAs in SH-SY5Y Cells. Non-Coding RNA. 2022; 8(6):72. https://doi.org/10.3390/ncrna8060072
Chicago/Turabian StyleZohar, Keren, Eliran Giladi, Tsiona Eliyahu, and Michal Linial. 2022. "Oxidative Stress and Its Modulation by Ladostigil Alter the Expression of Abundant Long Non-Coding RNAs in SH-SY5Y Cells" Non-Coding RNA 8, no. 6: 72. https://doi.org/10.3390/ncrna8060072
APA StyleZohar, K., Giladi, E., Eliyahu, T., & Linial, M. (2022). Oxidative Stress and Its Modulation by Ladostigil Alter the Expression of Abundant Long Non-Coding RNAs in SH-SY5Y Cells. Non-Coding RNA, 8(6), 72. https://doi.org/10.3390/ncrna8060072

