Next Article in Journal
Arthrobotrys mendozadegivensis sp. nov. (Fungi: Orbiliales) from Mexico: Predatory Activity and Nematocidal Activity of Its Liquid Culture Filtrates Against Haemonchus contortus (Nematoda: Trichostrongylidae)
Previous Article in Journal
Optimization of Protoplast Preparation Conditions in Lyophyllum decastes and Transcriptomic Analysis Throughout the Process
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Geographical Distribution, Host Range and Genetic Diversity of Fusarium oxysporum f. sp. cubense Causing Fusarium Wilt of Banana in India

by
Raman Thangavelu
1,*,
Hadimani Amaresh
1,
Muthukathan Gopi
1,
Murugan Loganathan
1,
Boopathy Nithya
1,
Perumal Ganga Devi
1,
Chelliah Anuradha
1,
Anbazhagan Thirugnanavel
2,
Kalyansing Baburao Patil
3,
Guy Blomme
4 and
Ramasamy Selvarajan
1
1
ICAR—National Research Center for Banana, Plant Pathology Division, Tiruchirappalli 620102, Tamil Nadu, India
2
ICAR—Central Citrus Research Institute, Nagpur 440033, Maharashtra, India
3
Jain Irrigation System Ltd., Jalgaon 425002, Maharashtra, India
4
Bioversity International, c/o ILRI, Addis Ababa P.O. Box 5689, Ethiopia
*
Author to whom correspondence should be addressed.
J. Fungi 2024, 10(12), 887; https://doi.org/10.3390/jof10120887
Submission received: 12 November 2024 / Revised: 6 December 2024 / Accepted: 9 December 2024 / Published: 21 December 2024

Abstract

Fusarium wilt of banana is a major production constraint in India, prompting banana growers to replace bananas with less remunerative crops. Effective disease management practices thus need to be developed and implemented to prevent further spread and damage caused by Fusarium oxysporum f. sp. cubense (Foc), the cause of Fusarium wilt. Currently, knowledge of disease incidence, affected varieties, and the geographical spread of Foc races in India are only scantily available. An extensive field survey was conducted in 53 districts of 16 major banana-growing states of and one union territory of India that covered both tropical and subtropical regions. Disease incidence ranged from 0 to 95% on farms, with Cavendish bananas (AAA) most affected. No Fusarium wilt symptoms due to Foc R1 were observed in Nendran (AAB) or Red Banana (AAA) in South India. During the survey, 293 Foc isolates were collected from Cavendish, Pisang Awak (ABB), Silk (AAB), Monthan (ABB), Neypoovan (AB), and Mysore (AAB) bananas. Isolate diversity was assessed through Vegetative Compatibility Group (VCG) analyses, sequencing of EF1α gene sequences, phylogenetic analyses, and characterisation by SIX gene composition. Thirteen VCGs were identified, of which VCGs 0124, 0125, 01220, and 01213/16 were dominant and infected Cavendish bananas. Phylogenetic analysis divided the Indian Foc isolates into race 1 (R1), subtropical race 4 (STR4), and tropical race 4 (TR4). Secreted in Xylem (SIX) gene analyses indicated that the effector genes SIX4 and SIX6 were present in the VCGs 0124, 0124/5, 0125, and 01220 of race 1, SIX7 was present only in Foc STR4, and SIX8 was found only in Foc R4 (TR4 and STR4) isolates. Insights into the geographical distribution of Foc races, and their interactions with banana varieties, can guide integrated disease management intervention strategies across India.

1. Introduction

Banana is a major fruit crop, with annual global production estimated at 135 million tonnes (MT). Of these, 24.3 MT are exported (https://www.nab.com.na/wp-content/uploads/2024/04/Market-Intelligence-Report-Bananas-revised-NAB-29032024.pdf, accessed on 4 November 2024). The global banana trade is worth USD 13.88 billion per year [1], making the commodity one of the most important in the world. Additionally, it is an important source of income, employment, and export revenue for developing countries in Latin America, Southeast Asia, and Africa [2]. In Asia, major banana-producing countries include India, China, and Indonesia (https://www.nab.com.na/wp-content/uploads/2024/04/Market-Intelligence-Report-Bananas-revised-NAB-29032024.pdf, accessed on 4 November 2024), where tropical climates favour their cultivation. Of the more than 1000 varieties of bananas known in the world, the Cavendish (AAA) variety contributes 47% to world banana production (https://www.fao.org/economic/est/est-commodities/oilcrops/bananas/bananafacts/en/, accessed on 4 November 2024). Cavendish banana is known to achieve high yields per hectare and, due to their short stems, are less prone to damage from environmental influences such as storms [3].
In India, banana ranks first of all fresh fruits produced, with a total production of 36.61 million tonnes cultivated on 0.996 million ha (https://www.indiastat.com/table/agriculture/selected-state-wise-area-production-productivity-b/1441986, accessed on 4 November 2024). Most bananas produced in the country are consumed locally, with only 0.36 million tonnes exported mainly to Iran, Iraq, UAE, Oman, Uzbekistan, Saudi Arabia, Nepal, Qatar, Kuwait, Bahrain, Afghanistan, and the Maldives ((https://pib.gov.in/PressReleaseIframePage.aspx?PRID=1976245, accessed on 4 November 2024). Bananas in India are grown in a range of climatic conditions, including the tropical southern states of Tamil Nadu, Kerala, Karnataka, Andhra Pradesh, Maharashtra, and Odisha, and the subtropical states in northern and north-eastern India (Madhya Pradesh, Uttar Pradesh, Bihar, West Bengal, Gujarat, Assam, Nagaland, Meghalaya, and Nagaland). The major banana-producing states include Andhra Pradesh (6.11 MT), Maharashtra (5.56 MT), Tamil Nadu (4.48 MT), Uttar Pradesh (3.39 MT), Gujarat (3.97 MT), Karnataka (2.55 MT), Madhya Pradesh (2.27 MT), Bihar (2.00 MT) and West Bengal (1.20 MT) (Source: Ministry of Agriculture & Farmers Welfare, Govt. of India, ON3447, accessed on 5 December 2024), while the key varieties grown are Gran Nain (AAA), Robusta (AAA), Dwarf Cavendish (AAA), Red Banana (AAA), NeyPoovan (AB), Nendran (Plantain-AAB), Poovan (Mysuru-AAB), Rasthali (Silk-AAB), Karpuravalli (Pisang Awak-ABB), and Monthan (Cooking banana-ABB). However, among these varieties, the Cavendish group of bananas is the major variety grown in the subtropical regions of India like Gujarat, Maharashtra, Madhya Pradesh, West Bengal, and Bihar states. In these locations, Cavendish is mainly grown as a monoculture crop.
Several biotic constraints affect banana production in India. These include black Sigatoka (or black leaf streak), caused by Mycosphaerella fijiensis, and Fusarium wilt, caused by Fusarium oxysporum f. sp. cubense (Foc) [4,5]. Foc is a soil-borne pathogen that produces resting spores, called chlamydospores, which help the pathogen survive for decades without its host [6]. Once Foc enters a banana field it cannot be eradicated, which hampers the future cultivation of susceptible banana varieties. The pathogen infects plants through the root system and colonises plant vascular tissues, thereby disrupting water and nutrient transportation in the xylem vessels of the rhizome and pseudostem [6]. This results in a reddish-brown discolouration of infected vascular tissue, which results in yellowing and browning of leaves, pseudostem splitting, and plant wilting [4,5]. Infected plants often die before flower emergence/shooting takes place. In heavily infested fields, symptoms are even produced on 1-month-old plants, forcing farmers to abandon their fields (personal observation).
Banana Fusarium wilt disease was first reported in Australia in 1874 and is now found in almost all the major banana-producing regions of the world [6]. Foc, the causal agent of Fusarium wilt, is divided into three races, based on the banana varieties it affects. These are Foc race 1 (R1), Foc race 2 (R2), and Foc race 4 (R4). Foc race 4 is further divided into subtropical race 4 (STR4) and tropical race 4 (TR4), depending on the climatic conditions where Cavendish bananas are affected [6]. The dessert banana variety “Gros Michel”, which once dominated world trade, was almost wiped out by Foc R1 in the 1900s, forcing trade to shift to the Cavendish subgroup, which was resistant to this race. However, in the 1990s, Cavendish bananas succumbed to Foc TR4 in Taiwan, Indonesia, Australia, and Malaysia [6]. Foc TR4 causes wilt in Cavendish bananas under both tropical and sub-tropical conditions and affects more varieties than any other Foc race. In India, Cavendish bananas were also reported to be affected by Foc R1, both in tropical and subtropical regions [7,8]. This rarity was first reported in the Theni district of Tamil Nadu in 2010, but it subsequently spread to Gujarat and is now found in most banana-growing regions of India [9].
FocTR4 was first isolated from Robusta (AAA) and Grand Nain (AAA) bananas in the Katihar district of Bihar State in India in 2015 [10]. The pathogen has since spread to neighbouring states like Uttar Pradesh, West Bengal, Gujarat, Maharashtra, and Madhya Pradesh. Heavy yield losses caused by Foc TR4 in Cavendish-producing regions forced growers to plant less profitable crops like maize and paddy in infested fields, which has negatively affected employment opportunities for banana workers (unpublished data). As both Foc R1 and TR4 might be spreading rapidly in northern India, Cavendish production on more than 4 million ha, worth INR 30,000 to 40,000 crores (USD 48 million), is at risk.
There is an urgent need to develop and implement management practices to mitigate Fusarium wilt and prevent the further spread of Foc in India. Information on the geographical occurrence and incidence of Fusarium wilt, and the distribution of Foc VCGs/races, is crucial for effective decision-making and timely deployment of available management practices. Thus, the present study conducted field surveys in major banana-growing regions of India to gain insight into the extent of the spread of the disease and to know the distribution of different Foc races and VCGs of the pathogen, all aiming to prevent the pathogen’s spread and effective management of this deadly disease.

2. Materials and Methods

2.1. Survey on Fusarium Wilt Disease

A roving survey was conducted on 286 farms in 53 districts and 16 banana-growing states and one union territory of India from 2019 to 2023 to assess the incidence of banana Fusarium wilt and to collect Foc samples for the isolation and characterisation of the pathogen (Table 1). Banana varieties grown in both tropical and subtropical regions were covered in the survey. In each farm surveyed, a minimum of 500 to 1000 plants were examined for disease symptoms, and at least two to three samples were collected per farm for the isolation of the Foc pathogen. Farmers were also interviewed to gather information about the farm: cultivar(s) grown, source of planting material (tissue cultured/suckers), current management practices (chemical/biological/cultural practices like disinfestation of tools and implements, removal and destruction of infected plants), type of irrigation used (drip/flood), quarantine measures, and crop rotation practices. The goal of the questionnaire was to determine modes of disease spread and management practices being applied by farmers, which could aid in designing effective future management strategies for Fusarium wilt in India.

2.2. Sample Collection and Pathogen Isolation

During the field survey, plants showing symptoms of Fusarium wilt, such as leaf yellowing and pseudostem splitting, were cut down and examined for vascular discolouration in the rhizome and pseudostem. Pieces of discoloured vascular tissue from both rhizome and pseudostem were collected and dried on sterile filter paper. The filter papers were changed daily until these were brought to the laboratory at ICAR-National Research Centre for Banana (NRCB), Tiruchirapalli, for the isolation of the pathogen.
At the laboratory, 5–8 mm long dried diseased tissue sections were excised from the discoloured vascular strands and surface sterilised, and four dried pieces of each sample were plated onto plates of quarter-strength potato-dextrose agar (PDA). After 3 days, isolates of F. oxysporum were sub-cultured onto PDA plates and incubated at 25 °C. Single spore (monoconidial) cultures were generated after 7 to 10 days by using a dilution plating technique [11]. The cultures were then stored on PDA and dried filter papers at 4 °C for short-term storage, and in 15% glycerol at −80 °C for long-term storage.

2.3. Morphological Identification

The Fusarium cultures isolated from diseased banana tissues were grown on PDA and Carnation Leaf Agar plates at 25 °C for 10 days. Isolates were identified to species level based on their colony colour and the morphological characteristics [12] of macro and micro conidia and chlamydospores.

2.4. Pathogenicity Testing

The pathogenicity of each F. oxysporum isolate was tested by inoculating 3-month-old tissue-cultured banana plants (Grand Nain, NeyPoovan, Poovan, Monthan, Rasthali and Karpuravalli) obtained from Jain Irrigation Pty. Ltd. (Udumalpet, Coimbatore, India) with the isolated fungi. The individual isolates were first multiplied in a sand–maize (19:1) medium (briefly, 190 g of river sand and 10 g of maize flour were taken in a plastic container, and 20 mL of water was added and mixed well; the mixture was taken in an autoclavable bag and sterilised by autoclaving at 15 lb for 20 min, 2 times at a one–day interval). The sand–maize meal medium was inoculated with a piece of actively growing fungal culture and incubated at 30 °C for 15 days, and inoculations were performed on 3-month-old potted TC plants by applying 30 g of inoculums to each plant at the sub-surface soil [13]. Five plants were inoculated with each isolate and the pots were arranged in a completely randomised design. Five plants grown in a non-inoculated sand:maize meal mixture served as control. The plants were then maintained in a greenhouse at 25 °C with a 12 h photoperiod. The inoculated plants were inspected for external and internal Fusarium wilt symptoms 3 months after inoculation, and rhizome discolouration was rated on a 0–5 scale using the method of Zuo et al. [14]. The fungus was re-isolated from the pseudostem of diseased plants and identified by PCR using race-specific Foc primers [15].

2.5. Vegetative Compatibility Group Analysis

Chlorate-resistant, nitrate-non utilising (nit) mutants were developed for all the Foc isolates collected in India, and phenotyped, as described by Correll et al. [16]. The unknown nit-mutants were then paired with Nit-M tester strains obtained from the Department of Agriculture and Fisheries, Queensland, Australia, using the method described by Thangavelu et al. [17]. Briefly, a mycelial disc (2 mm in diameter) of a known Nit-M tester was placed in the centre of a Petri dish containing minimal medium, and small nit-1 mutant disks of an unknown VCG were placed 10–15 mm away. The plates were then incubated at room temperature (24 ± 2 °C) and examined regularly for the formation of wild-type growth (heterokaryons) at the line of contact between the two colonies. Isolates that formed heterokaryons were assigned to the same VCG.

2.6. Cross Infection Studies

To determine whether Foc R1 isolates, particularly those belonging to VCGs 0124, 0125, 0124/5, and 01220, isolated in this study from cultivars other than Cavendish could also infect Cavendish bananas, a cross-infection study was conducted under glasshouse conditions using Grand Nain. For this, 3-month-old disease-free tissue-cultured banana plants of the cv. Grand Nain were inoculated with Foc R1 isolates as described before, with 10 replications per isolate. After 3 months, the plants were rated for internal rhizome symptoms on a scale of 0 to 5 as described earlier [14].

2.7. Molecular Identification of Foc Isolates

2.7.1. Extraction of Fungal Genomic DNA

Five-day-old Foc cultures were inoculated into potato-dextrose broth (PDB) amended with streptomycin sulphate (0.1 g L1). The cultures were subsequently incubated at 25 °C with a 12 h alternating light and dark cycle for 5 days. After incubation, the mycelial mat from the broth was removed for DNA extraction [18] using the method of Raeder and Broda [19] with some modifications. Briefly, the powdered mycelium was suspended in 800 µL of extraction buffer (200 mM Tris-HCL pH 8.5, 25 mM NaCl, 25 mM EDTA, 0.5% SDS) and incubated for 2 h at 37 °C. After incubation, the tubes were centrifuged at 10,000 rpm for 10 min. The supernatant alone was transferred to a new tube and an equal volume of phenol–chloroform–isoamyl alcohol (25:24:1) was added. The tubes were then again centrifuged at 10,000 rpm for 10 min. The aqueous phase was transferred to a new tube and an equal amount of phenol–chloroform–isoamyl alcohol (25:24:1) was added. The tubes were again centrifuged at 10,000 rpm for 10 min. DNA was precipitated with isopropanol and 3 M sodium acetate by incubating the tubes at −20 °C overnight. The DNA pellet was rinsed with 70% ethanol and re-suspended thoroughly in TE buffer (10 mM Tris-HCL, 1 mM EDTA, pH8.0). The purification was performed by incubating the isolated DNA with 5 µL RNAse A at 37 °C for 1 h to remove RNA. The extraction was re-suspended in a TE buffer and stored at −20 °C until further use. The quality and concentration of DNA were determined using a DU640 spectrophotometer (Lambda 25, PerkinElmer, and Norwalk, CT, USA) and visualised on 0.8% agarose gel. The concentration of DNA was adjusted to 25 ng µL−1.

2.7.2. Identification of Foc Races by PCR

DNA amplification was performed in a Master cycler nexus gradient PCR machine (Eppendorf India PVT. LTD., Chennai, India) using Foc R1-, TR4-, and STR4-specific markers (Table 2) developed and described by Thangavelu et al. [15]. Briefly, 20 µL of the PCR reaction mixture containing forward and reverse primers (0.5 µM µL−1 each), EmeraldAmp® PCR master mix (9.0 µL), ultra-pure water (8 µL), and 50 ng µL−1 DNA was used for PCR amplification. PCR was performed using the following conditions in a thermocycler (Takara, Shiga, Japan): denaturation at 95 °C for 5 min followed by 30 cycles of amplification at 95 °C for 30 s, annealing at 65 °C for 40 s and 72 °C for 45 s, and final elongation at 72 °C for 5 min; in the case of Foc TR4-, R4-, and STR4-specific amplification, annealing was carried out at 66 °C for 40 s. Electrophoresis was undertaken using 2% agarose gel at 100 V for 30 min and visualised on the gel documentation system under ultraviolet light (302 nm).

2.7.3. Sequencing of TEF-1α Gene and Phylogenetic Analyses

The translation elongation factor-1α (TEF-1α) gene of 46 representative Foc isolates belonging to major VCGs that have been infecting most of the banana varieties, including Cavendish cultivars, and frequently encountered in most of the banana-growing regions in India, such as VCGs 0124, 0124/5, 0125, and 01220 of Foc R1, VCG 0120 of Foc STR4, and VCG 01213/16 of Foc TR4, were amplified with primers EF-1 and EF-2 as follows. For PCR, a reaction volume of 40 μL was prepared consisting of 1 unit of Taq polymerase (BIOTAQ, UK), 1× PCR buffer, 3.5 mM MgCl2, 200 μM of each dNTP, bovine serum albumin (BSA), 0.2 μM of each primer, and genomic DNA (50 ng), and the PCR program as set at 95 °C for 2 min followed by 35 cycles of 95 °C for 30 s; 50 °C for 30 s; and 72 °C for 1 min, and an additional extension time for 10 min at 72 °C. The PCR products were separated by electrophoresis in a 1% agarose gel. The PCR products were then purified using the DNA Gel Extraction kit TSP601, and sequenced from both ends using an ABI3730 XL DNA analyser (Genurem Biotech Ltd., Bengaluru, India). The TEF-1α sequences of a FocTR4 isolate from Malaysia and two isolates of Fusarium equiseti (as an outgroup) were retrieved from the NCBI website (https://www.ncbi.nlm.nih.gov/, accessed on 2 November 2024). The TEF-1α gene sequences of all Fusarium isolates were aligned with clustalW, and the phylogenetic analyses performed using the maximum likelihood method. The phylogenetic tree was constructed using MEGA 11 software with the Kimura 2-parameter model. Branches were tested for the inferred tree by bootstrap analysis on 1000 random trees.

2.7.4. Characterisation of Foc Isolates by SIX Genes Amplification

The primers of SIX genes specifically designed for Indian Foc isolates were used in this study [20]. Also, in earlier studies, it was found that out of 14 SIX effector gene primers (SIX1SIX14), all the SIX primers except SIX3, SIX5, SIX10-SIX12, and SIX14 generated the expected amplicon from the Indian Foc isolates [20]. Hence, in this study, only eight different SIX primers (SIX1, SIX2, SIX4, SIX6-SIX9, and SIX13) were used for characterisation of Foc isolates (). The presence/absence of SIX effector genes in Indian Foc was determined using isolates representative of VCGs in Foc R1, TR4, and STR4 collected in different banana-growing regions of India. The SIX gene-PCR reaction mixture was set up in a total volume of 15 µL containing forward and reverse primers (1 µM µL−1 each), Emerald Amp® PCR master mix (7.5 µL), ultra-pure water (3.5 µL), and 2 µL of 50 ng µL−1 DNA. The PCR for the SIX genes was set up with standard thermocycling conditions: initial denaturation at 95 °C for 5 min, 30 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C/60 °C for 45 s, extension at 72 °C for 45 s, followed by one cycle of final extension at 72 °C for 10 min (Table 2). Electrophoresis was undertaken using 2% agarose gel at 100 V for 30 min, and visualised on the gel documentation system under ultraviolet light (302 nm).

3. Results

3.1. Distribution and Incidence of Fusarium Wilt

The Fusarium wilt symptoms were observed in Cavendish (Grand Nain, Singapuri and Robusta), Rasthali-Silk (Malbhog, Mortaman, Amritapani, Nanjangod Rasabale), Poovan-Mysuru (Cheni champa, Alpon), Karpuravalli (Chinia, Manohar, Kanthali), NeyPoovan, and Athiakol, but not in Nendran or Red Banana, which are grown only in Tamil Nadu and Kerala where Foc R1 is omnipresent and TR4 is currently absent. In general, the disease incidence was ranged from 0 to 95%, with maximum incidences of 90–95% observed in Grand Nain grown in the Theni district of Tamil Nadu (tropical) and the Lakhimpur-Keri district of Uttar Pradesh (sub-tropical). This was followed by the varieties Poovan (West Bengal) and Rasthali (Tamil Nadu), which recorded a 45–50% incidence in both tropical and subtropical regions of India (Table 1).
A total of 732 Fusarium wilt-affected samples were collected, from which 293 representative Fusarium isolates were obtained for further characterisation. Among these, 51.2% were isolated from Cavendish cultivars, 18.08% from Rasthali, 10.88% from Karpuravalli, 9.52% from Monthan, 5.78% from NeyPoovan, 3.4% from Poovan, and 1.02% from other varieties (Table 3). The interview with farmers revealed that more than 60% of the farmers in India use suckers as planting material and follow flood irrigation. Unfortunately, in most of the cases, no management practices were followed including quarantine and crop rotation.

3.2. Pathogenicity and Cross Infection Studies

Banana plants of respective varieties inoculated with Fusarium isolates (293 isolates) revealed typical symptoms of Fusarium wilt such as leaf yellowing and chlorosis in 30–40 days, and whole plant wilting occurred mostly in 80 to 90 days. Internal rhizome discolouration had scores ranging from 4 to 5 on a 0–5 scale.
Cross-infection studies also indicated that VCGs 0124, 0125, 0124/5, and 01220 caused internal disease scores of 3 to 5 on a 0–5 disease scale in Cavendish cv Grand Nain plantlets (Figure 1). The pathogen was re-isolated from infected portions of the rhizome and was reconfirmed by using molecular markers specific to Foc R1 and Foc TR4.

3.3. Morphological Identification

The mycelia of all Fusarium cultures were cottony, white to pale violet, and produced dark red or pale violet colour pigments in PDA. They produced numerous one- or two-celled, oval micro conidia in false heads. The four- to eight-celled macro conidia were sickle-shaped with foot-shaped basal cells. Chlamydospores were globose and formed singly or in pairs. Based on these morphological characters, the Fusarium isolates were identified as F. oxysporum.

3.4. VCG Analyses

Thirteen Foc VCGs and VCG complexes were identified from isolates collected in India. These were VCGs 0124, 0124/5, 0125, 0128, 01220, 01212, 01214, 01217, 01218 in Foc R1, VCGs 0120, 0129, 01211 of FocSTR4, and VCG 01213/16 of Foc TR4 (Table 4). Among the cultivars grown, Rasthali was associated with the highest number of VCGs (10), followed by Karpuravalli (7), NeyPoovan (6), and Grand Nain (5). Poovan and Athiakol were associated with two VCGs each (Figure 2). Foc TR4 VCG 01213/16 was isolated from varieties such as Cavendish (Grand Nain, Robusta, and Singapuri), Karpuravalli, and Poovan in subtropical regions of India. Foc R1 VCGs 0125, VCG 0124, and 01220 affected most banana varieties in India, including Cavendish bananas, both in tropical and subtropical regions of India. Foc STR4 VCG 0120 affected Cavendish bananas in the Gujarat and Madhya Pradesh states in subtropical regions of India, whereas VCG 0129 was associated with Rasthali bananas in the subtropical state of Assam and the tropical state of Andhra Pradesh. VCG 01211 affected NeyPoovan in Karnataka state (tropics) and Karpuravalli in Assam state (subtropics) (Table 4 and Figure 3).

3.5. Molecular Identification

3.5.1. Identification of Foc Races by PCR

The primer sets Foc R1F and Foc R1R, which are specific to Foc R1, Foc STR4F and FocSTR4R, which are specific to STR4, and FocR4F and FocR4R, specific to FocR4, and the primer sets FocTR4F and FocTR4R, which are specific to TR4, yielded the expected amplificons with the size of 320 bp, 250 bp, 400 bp, and 250 bp, respectively, for Foc isolates belonging to VCGs in Foc R1, STR4, and TR4 (Table 5).

3.5.2. TEF-1α Gene Sequencing and Phylogenetic Analyses

PCR amplification of the TEF1-α gene produced ~690 bp fragments for sequencing. The TEF1-α gene sequences of 46 Foc isolates were deposited into the GenBank repository (accession number MN867468; MW286790–91, 93, 96; MW286802–04, 06, 10; MW339762, 63, 66, 67, 70–73, 75, 77, 79–81; OR468255–57, 61–63, 67–79, 82–85). A phylogenetic tree generated from the Foc sequences indicated two major clades, A and B (Figure 4). Clade A contains all the Foc R1 isolates, and clade B contains all the Foc R4 isolates, which include TR4 and STR4 isolates. The TR4 and STR4 isolates in clade B were also clearly separated. The outgroup members of F. equiseti (MZ669768 and KX463032) were also separated from all the Foc isolates. The genetic similarity of Indian Foc isolates ranged from 97.4 to 100%, while the genetic dissimilarity between the outgroups F. equiseti and Foc isolates ranged from 41.4 to 49.2%. The genetic similarity between the Foc TR4 of China and Malaysia isolates, and the Indian Foc TR4 isolates ranged from 96.8 to 99.8%, and between the Foc R1 isolates of China and Central Africa, and the Indian Foc R1 isolates ranged from 97.6 to 99.8%. In this study, interestingly there was a clear separation of all the Indian Foc isolates into three major groups based on the races Foc R1, Foc STR4, and Foc TR4, irrespective of the geographical origin. However, the genetic similarity among the Indian Foc R1, STR4, and TR4 isolates ranged from 99.2 to 100%, 99.8 to 100%, and 99.5 to 100%, respectively. Genetic dissimilarity between Foc R1 and Foc TR4, which both infected most of the commercial cultivars, including Cavendish, ranged from 0 to 4.4% (Figure 4 and Supplementary Figure S1).

3.5.3. SIX Gene Analyses

The PCR amplification of SIX genes of Indian representative Foc isolates indicated that the expected amplicon sizes of effector genes SIX4 (717 bp) and SIX6 (412 bp) were generated for VCGs 0124, 0124/5, 0125, and 01220 of Foc R1, with SIX7 (365 bp) being amplified only in Foc STR4, and SIX 8 (450 bp) amplified only in Foc TR4 isolates. The effector genes SIX1, SIX9, and SIX13 were amplified in all the VCGs, whereas SIX2 (214 bp) was amplified in both Foc STR4 (VCG0120) and Foc TR4 (VCG01213/16) (Table 6 and Figure 5).

4. Discussion

Fusarium wilt is a major threat to banana cultivation in India. A Fusarium field survey conducted in 2019 showed lower infection rates: 6–65% in Bihar, 30–45% in Uttar Pradesh, and 5–15% in Gujarat in the subtropical regions, and 15–21% in Tamil Nadu in the tropical region [8]. Similarly, in the Jalgaon district of Maharashtra, which is considered the “Banana city of India” as it produces 0.43 million tonnes of banana from 0.062 million hectares, the incidence in 2019 was only 2% [21]. However, during the current 2024 survey, a 30% field level incidence was observed. These observations point to a fast pathogen/disease spread over the past 5 years. The major banana varieties affected by Fusarium wilt disease in the latest survey were Cavendish, Silk, Cooking type (ABB), Pisang Awak, Poovan, and NeyPoovan. However, among different varieties, the Cavendish bananas were heavily affected by Fusarium wilt, with infection rates ranging from 2 to 95% in tropical regions (maximum of 90% in Tamil Nadu), and from 0.5 to 90% in subtropical regions. Various reasons for the observed sharp increase in disease incidence and geographical spread emerged during the banana farmer interviews: (i) continuous cultivation of banana without any crop rotation as the farmers receive high profits from banana (USD 2500 to 3500 from banana as against USD 300 to 600 from maize/paddy rice/ sugarcane); (ii) lack of awareness of the modes of spread of the pathogen and eventual impact; (iii) no application of measures to prevent pathogen spread or to mitigate disease impact; (iv) use of suckers as planting material sourced from diseased mats or fields; and (iv) application of flood irrigation instead of drip irrigation. Farmers from the Baruch district of Gujarat expressed that severe flooding, caused by the overflow of water from the Narmada River, led to an extensive spread and high incidence of Foc TR4. The same means of spread was reported in other studies [22,23,24,25,26]. The high disease incidence in India resulted in most farmers planting resistant banana varieties like Nendran (AAB) or Red Banana (AAA), particularly in Theni district of Tamil Nadu, where Foc R1 is the major problem in Cavendish, or other crops like potato, maize, or sugarcane in Bihar, Uttar Pradesh, and West Bengal, where TR4 is the major problem and affects all cultivars.
Most of the Foc isolates collected in India in this study were from Cavendish bananas (51.2%). This may be because approximately 57% of the banana-growing areas in India are occupied by the Cavendish group [10]. The isolates were not only members of Foc TR4 (VCG 01213/16), as would be expected, but also Foc R1 VCGs, including VCG 0124, 0125, 0124/5, and 01220. The Foc R1 strains also infected Cavendish cv. Grand Nain under glasshouse conditions, as was previously reported by Thangavelu et al. [8,17,27]. Interestingly, among the VCGs, VCGs 0124, 0125, and 01220 of Foc R1, which were initially recorded in Cavendish bananas grown in the Theni district of Tamil Nadu [8,9], later spread to Uttar Pradesh and Gujarat. These VCGs are now found to affect all commercial cultivars grown in other major banana-producing states of India, including Cavendish (but not Nendran and Red Banana, which are grown only in southern India), and are encountered more frequently as well [9]. Regarding VCG 01213/16 (TR4), which was initially recorded in Katihar and Purnia districts of Bihar [10], the present study has revealed its further spread to other major banana-growing neighbouring states like Maharashtra (Jalgaon district), Gujarat (Surat and Bhruch districts), Uttar Pradesh (Maharajkanj,, Kushi Nagar, Shravasti, Ayodhya, Lakhimpur-Kheri, and Barabanki), Madhya Pradesh (Burhanpur), Bihar (Bhagalpur), and West Bengal (Nadia and Mushidabad). It is obvious from the present study that in addition to VCG 01213/16, the fast spread of Foc R1 VCGs (VCG 0124, 0125, and 1220) increasingly threatens Cavendish production landscapes. Therefore, understanding the banana–Foc race interaction is essential for the development and deployment of resistant bananas, and for other disease management strategies such as the development of effective biocontrol strains.
VCG analysis is a key method used for diversity analysis of Foc, which is crucial for understanding the diversity both between races and within races of this pathogen [16,28]. In the present study, a total of 13 different VCGs were observed and among these, 8 VCGs, viz., 124, 0125, 0128, 0129, 01211, 01212, 01220, and 0124/5, were identified in both tropical and subtropical regions. In contrast, VCGs 01214 and 01217 were identified exclusively in tropical regions, while VCGs 0120, 01216, 01218, and 01213/16 were found only in subtropical regions. Around 20 different varieties of bananas are grown commercially across 0.96 million hectares in various climatic regions, both tropical and subtropical, in India. This diversity in banana cultivation, across a wide geographical region, may be one of the reasons for the great number of VCGs found in the country. Li et al. [29] conducted similar studies on the diversity and distribution of Foc in China and found that Foc was highly diverse, with a total of 11 VCGs identified. Of these, six VCGs (0120/15, 0123, 012313/16, and 01221) were found in Cavendish bananas. They also observed that VCG 01213/16 (TR4) was the major VCG affecting Cavendish bananas in Guangdong province, located in the southern subtropics. The identification of these VCGs and their locations is valuable for implementing quarantine measures and integrated disease management (IDM) practices, including the timely deployment of resistant varieties.
The phylogenetic tree grouped Foc isolates in India into three major groups as per the races Foc R1, Foc STR4, and Foc TR4, irrespective of their geographical origin and variety from which they were isolated. It also indicated the polyphyletic nature of Indian Foc isolates, as there was a wide genetic diversity among the Foc isolates of each race of India, which were all found to infect the Cavendish group of cultivars. Similar studies conducted previously by many researchers indicated that the Foc isolates have a wide genetic diversity and are polyphyletic in nature [17,30,31,32,33]. The phylogenetic tree results were supported by results obtained with a set of SIX genes, which verifies host specificity in the banana Fusarium wilt pathogen [34]. Czislowski et al. [35] demonstrated that VCGs of Foc races 1 and 2 were distinguishable from the VCGs of race 4 by both the presence and absence of several SIX genes. They indicated that SIX2 (all R4 VCGs except 0122 and 01212) and SIX8 (SIX8a in R4 and SIX8b in STR4) were present only in Foc R4, and SIX7 was present only in STR4, while SIX 1, 4, 6, 9, and 13 were present in all Foc races. It was also observed in the present study that the SIX genes such as SIX1, SIX9, and SIX13 were present in all the VCGs of Foc R1, STR4, and TR4. In contrast, Czislowski et al. [35] stated that, of the seven SIX genes detected in the VCGs of Foc, only SIX1 and SIX9 were identified in all VCGs. However, the SIX 13 gene was not identified in all VCGs. In accordance with our findings, An et al. [36] observed that SIX1, SIX8, and SIX9, which are present in Foc TR4, are involved in the infection and colonisation of banana plants. In addition, in the present study it was found that the SIX2 and SIX8 were present only in Foc R4. In line with these findings, An et al. [36] showed that SIX2 and SIX8 effector genes were only present in Foc R4 and were not detected in Foc R1. Another study [20] carried out on multiple sequence alignment of extracted SIX1 gene segments revealed significant variations between the VCGs of Indian isolates and those isolated by Czislowski et al. [35] and Guo et al. [37], specifically in the aligned positions of 207–230 and 535–552. This variation observed in the SIX gene sequences might be the reason why Indian Foc isolates, particularly the VCGs 0124, 1025, 0124/5, and 01220 of Foc R1, are infecting Cavendish bananas in India.

5. Conclusions

The present study highlights that Fusarium wilt disease caused by Foc R1 and TR4 is severely affecting bananas, especially the Cavendish variety, in India. FocTR4, initially recorded in Bihar and Uttar Pradesh, has now spread to other major banana-growing states such as West Bengal, Gujarat, Maharashtra, and Madhya Pradesh. A total of 13 different vegetative compatibility groups (VCGs) were recorded, with VCGs 0125, 0124, 01220, and 01213/16 being dominant and infecting all banana varieties, including Cavendish. Interestingly, the Nendran and Red Banana varieties were not infected by any Foc race 1 strains, suggesting that these two varieties could be promoted in Foc race 1-infested areas. Phylogenetic diversity analysis using TEF1-α gene sequences and SIX gene analyses on representative Foc isolates clearly distinguished the races as Foc R1, STR4, and TR4. The findings from this study will be instrumental in the design, development, and timely deployment of integrated disease management (IDM) practices, including the use of resistant varieties.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof10120887/s1, Supplementary Figure S1: Graphical representation of pairwise nucleotide identity (with percentage identity scale) for Fusarium isolates (46 Indian Fusarium oxysporum f. sp. cubense isolates, 1 isolate each of Foc TR4 from Malaysia and China, Foc R1 from China, and Central Africa, and 2 isolates of F. equiseti).

Author Contributions

R.T. conceived the project, planned experiments, overseas the experiments, compiled data and wrote the manuscript; H.A., P.G.D. and M.G. performed the experiments, and were involved in the survey; M.L. was involved in the survey, and writing and correction of the manuscript; C.A. and B.N.—data analyses and manuscript writing; A.T. and K.B.P. were involved in survey work; G.B.—writing and editing manuscript; and R.S.—survey and correction of manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by ICAR-NRC for Banana, Tiruchirapalli, TN and this research and APC were funded by One CGIAR Initiative on Plant Health and Rapid Response to Protect Food Security and Livelihoods, through Bioversity International.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The TEF 1 α sequences of Foc isolates used for genome BLAST and phylogenetic analysis have been deposited in the NCBI data base. All the data generated or analysed during this study are included in this published article.

Acknowledgments

The financial support provided for this study through the Network and extramural project by ICAR, New Delhi is gratefully acknowledged, along with the facilities provided by the ICAR-NRCB. We extend our sincere thanks to Altus Viljoen of Stellenbosch University, South Africa, for his meticulous review and valuable suggestions for improving the manuscript. Additionally, we acknowledge the financial contribution of the One CGIAR Initiative on Plant Health and Rapid Response to Protect Food Security and Livelihoods, through Bioversity International.

Conflicts of Interest

Author K. B. Patil was employed by the company Jain Irrigation System Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. FAOSTAT. World Food and Agriculture-Statistical Yearbook 2023. Rome. Available online: https://openknowledge.fao.org/handle/20.500.14283/cc8166en (accessed on 5 December 2024).
  2. Lassois, L.; Jijakli, M.H.; Chillet, M.; De Lapeyre de Bellaire, L. Crown Rot of Bananas: Preharvest Factors Involved in Postharvest Disease Development and Integrated Control Methods. Plant Dis. 2010, 94, 648–659. [Google Scholar] [CrossRef] [PubMed]
  3. APAARI. Banana Tissue Culture in India—A Success Story; Asia Pacific Association of Agricultural Research Institutions: Bangkok, Thailand, 2019; Available online: https://www.apaari.org/web/wp-content/uploads/downloads/2019/Banana_Tissue_Culture-Success_Story_29-11-2019_For_Circulation.pdf (accessed on 4 October 2024).
  4. Stover, R.H. Fusarial Wilt (Panama Disease) of Bananas and Other Musa Species; Commonwealth Mycological Institute: Egham, UK, 1962. [Google Scholar]
  5. Ploetz, R.C. Fusarium wilt of banana. Phytopathology 2015, 105, 1512–1521. [Google Scholar] [CrossRef] [PubMed]
  6. Thangavelu, R.; Loganathan, M.; Arthee, R.; Prabakaran, M.; Uma, S. Fusarium wilt: A threat to banana cultivation and its management. CABI Rev. 2020, 1–24. [Google Scholar] [CrossRef]
  7. Ploetz, R.C.; Pegg, K.G. Fusarium Wilt Diseases of Banana, Abaca and Enset; CABI Publication: Wallingford, UK, 2000. [Google Scholar]
  8. Thangavelu, R.; Edwin Raj, E.; Pushpakanth, P.; Muthukathan, G.; Murugan, L.; Uma, S. Draft genome resource of a novel virulent Fusarium oxysporum f. sp. cubense race 1 strain (VCG 0124) infecting Cavendish (AAA) group of banana in India. Plant Dis. 2021, 105, 2708–2710. [Google Scholar] [CrossRef]
  9. Thangavelu, R.; Gopi, M.; Pushpakanth, P.; Loganathan, M.; Edwin Raj, E.; Marimuthu, N.; Prabakaran, M.; Uma, S. First Report of Fusarium oxysporum f. sp. cubense VCG 0125 and VCG 01220 of Race 1 Infecting Cavendish Bananas (Musa sp. AAA) in India. Plant Dis. 2021, 105, 1215. [Google Scholar] [CrossRef]
  10. Thangavelu, R.; Mostert, D.; Gopi, M.; Devi, P.G.; Padmanaban, B.; Molina, A.B.; Viljoen, A. First detection of Fusarium oxysporum f. sp. cubense tropical race 4 (TR4) on Cavendish banana in India. Eur. J. Plant Pathol. 2019, 154, 777–786. [Google Scholar] [CrossRef]
  11. Joao, L.N.; de Maurício, A. A basic procedure for single spore isolation of Fusarium verticillioides and Fusarium subglutinans. Int. J. Env. Bio. Res. 2016, 3, 45–148. [Google Scholar]
  12. Nelson, P.E.; Toussoun, T.A.; Marasas, W.F.O. Fusarium Species: An Illustrated Manual for Identification; Pennsylvania State University Press: University Park, PA, USA, 1983. [Google Scholar]
  13. Thangavelu, R.; Gopi, M. Combined application of native Trichoderma isolates possessing multiple functions for the control of Fusarium wilt disease in banana cv. Grand Naine. Biocontrol Sci. Technol. 2015, 25, 1147–1164. [Google Scholar] [CrossRef]
  14. Zuo, C.; Deng, G.; Li, B.; Huo, H.; Li, C.; Hu, C.; Kuang, R.; Yang, Q.; Dong, T.; Sheng, O.; et al. Germplasm screening of Musa spp. For resistance to Fusarium oxysporum f. sp. cubense tropical race 4 (Foc TR4). Eur. J. Plant Pathol 2018, 151, 723–734. [Google Scholar]
  15. Thangavelu, R.; Edwinraj, E.; Gopi, M.; Pushpakanth, P.; Sharmila, K.; Prabaharan, M.; Loganathan, M.; Uma, S. Development of PCR-based race-specific markers for differentiation of Indian Fusarium oxysporum f. sp. cubense, the causal agent of Fusarium wilt in banana. J. Fungi 2022, 8, 53. [Google Scholar] [CrossRef]
  16. Correll, J.C.; Klittich, C.J.R.; Leslie, J.F. Nitrate non utilizing mutants of Fusarium oxysporum and their use in vegetative compatibility tests. Phytopathology 1987, 77, 1640–1646. [Google Scholar] [CrossRef]
  17. Thangavelu, R.; Suganya Devi, P.; Chrismala, P.M.; Mustaffa, M.M. Cross infection and genetic diversity of Fusarium oxysporum f. sp. cubense, the causal agent of Fusarium wilt in Banana. Acta Hort. 2011, 897, 353–362. [Google Scholar] [CrossRef]
  18. Johanson, A.; Crowhurst, R.N.; Rikkerink, E.H.A.; Fullerton, R.A.; Templeton, M.D. The use of species-specific DNA probes for the identification of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka disease of banana. Plant Pathol. 1994, 43, 701–707. [Google Scholar] [CrossRef]
  19. Raeder, U.; Broda, P. Rapid preparation of DNA from filamentous fungi. Lett. Appl. Microbiol. 1985, 1, 17–20. [Google Scholar] [CrossRef]
  20. Raman, T.; Edwin Raj, E.; Muthukathan, G.; Loganathan, M.; Periyasamy, P.; Natesh, M.; Manivasakan, P.; Kotteeswaran, S.; Rajendran, S.; Subbaraya, U. Comparative whole-genome sequence analyses of Fusarium wilt pathogen (Foc R1, STR4 and TR4) infecting Cavendish (AAA) bananas in India, with a special emphasis on pathogenicity mechanisms. J. Fungi 2021, 7, 717. [Google Scholar] [CrossRef]
  21. ICAR National Research Centre for Banana. Anonymous. Annual Report 2018–19; ICAR-National Research Centre for Banana: Tiruchirappalli, India, 2019; Available online: http://nrcb.res.in (accessed on 11 May 2020).
  22. Chittarath, K. Situation of Distribution and Management of Foc TR4 in Laos; Plant Protection Center, DOA, MAF: Vientiane, Laos, 2020; pp. 2–4. [Google Scholar]
  23. Chittarath, K.; Nguyen, C.H.; Bailey, W.C.; Zheng, S.J.; Mostert, D.; Viljoen, A.; Tazuba, A.F.; Ocimati, W.; Kearsley, E.; Chi, T.Y.; et al. Geographical distribution and genetic diversity of the banana Fusarium wilt fungus in Laos and Vietnam. J. Fungi 2022, 8, 46. [Google Scholar] [CrossRef]
  24. Hermanto, C.; Jumjunidang; Sutanto, A.; Edison, H.S.; Danniels, J.; O’Neil, W.; Sinohin, V.G.; Molina, A.B. Pests and Diseases Remain the Main Complain of Banana Farmers in Indonesia. In Proceedings of the 4th Asian Conference for Plant Pathology, and 18th Australasian Plant Pathology Society (APPS) Conference, Darwin, Australia, 26–29 April 2011. [Google Scholar]
  25. Dita, M.; Barquero, M.; Heck, D.; Mizubuti, E.S.; Staver, C.P. Fusarium wilt of banana: Current knowledge on epidemiology and research needs toward sustainable disease management. Front. Plant Sci. 2018, 9, 1468. [Google Scholar] [CrossRef]
  26. Xu, L.B.; Huang, B.Z.; Wei, Y.R. Production and banana R&D in China. In Proceedings of the Advancing Banana and Plantain R&D in Asia and the Pacific, First BAPNET Steering Committee Meeting, Los Banos, Philippines, 7–10 October 2002. [Google Scholar]
  27. Thangavelu, R.; Mustaffa, M.M. First report on the occurrence of a virulent strain of Fusarium wilt pathogen (Race-1) infecting Cavendish (AAA) group of bananas in India. Plant Dis. 2010, 94, 1379. [Google Scholar] [CrossRef]
  28. Moore, N.Y.; Pegg, K.G.; Allen, R.N.; Irwin, J.A.G. Vegetative compatibility and distribution of Fusarium oxysporum f. sp. cubense in Australia. Aust. J. Exp. Agric. 1993, 33, 797–802. [Google Scholar] [CrossRef]
  29. Li, C.Y.; Mostert, G.; Zuo, C.W.; Beukes, I.; Yang, Q.S.; Sheng, O.; Kuang, R.B.; Wei, Y.R.; Hu, C.H.; Rose, L.; et al. Diversity and distribution of the banana wilt pathogen Fusarium oxysporum f. sp. cubense in China. Fungal Genom. Biol. 2013, 3, 1000111. [Google Scholar] [CrossRef]
  30. Koenig, R.L.; Ploetz, R.C.; Kistler, H.C. Fusarium oxysporum f. sp. cubense consists of a small number of divergent and globally distributed clonal lineages. Phytopathology 1997, 87, 915–923. [Google Scholar] [CrossRef]
  31. Bentley, S.B.; Pegg, K.G.; Moore, N.Y.; Davis, R.D.; Buddenhagen, I.W. Genetic variation among vegetative compatibility groups of Fusarium oxysporum f. sp. cubense analyzed by DNA fingerprinting. Phytopathology 1998, 88, 1283–1293. [Google Scholar] [CrossRef] [PubMed]
  32. Leong, S.K.; Latiffah, Z.; Baharuddin, S. Genetic diversity of Fusarium oxysporum f. sp. cubense isolates from Malaysia. Afr. J. Microbiol. Res. 2010, 4, 1026–1037. [Google Scholar]
  33. Ujat, A.H.; Vadamalai, G.; Hattori, Y.; Nakashima, C.; Wong, C.K.F.; Zulperi, D. Current classification and diversity of Fusarium species complex, the causal pathogen of Fusarium wilt disease of banana in Malaysia. Agronomy 2021, 11, 1955. [Google Scholar] [CrossRef]
  34. Fraser-Smith, S.; Czislowski, E.; Meldrum, R.A.; Zander, M.; O’Neill, W.; Balali, G.R.; Aitken, E.A.B. Sequence variation in the putative effector gene SIX 8 facilitates molecular differentiation of Fusarium oxysporum f. sp. cubense. Plant Pathol. 2014, 63, 1044–1052. [Google Scholar] [CrossRef]
  35. Czislowski, E.; Fraser-Smith, S.; Zander, M.; O’Neill, W.T.; Meldrum, R.A.; Tran-Nguyen, L.T.; Batley, J.; Aitken, E.A. Investigation of the diversity of effector genes in the banana pathogen, Fusarium oxysporum f. sp. cubense, reveals evidence of horizontal gene transfer. Mol. Plant Pathol. 2018, 19, 1155–1171. [Google Scholar] [CrossRef]
  36. An, B.; Hou, X.; Guo, Y.; Zhao, S.; Luo, H.; He, C.; Wang, Q. The effector SIX8 is required for virulence of Fusarium oxysporum f. sp. cubense tropical race 4 to Cavendish banana. Fungal Biol. 2019, 123, 423–430. [Google Scholar] [CrossRef]
  37. Guo, L.; Han, L.; Yang, L.; Zeng, H.; Fan, D.; Zhu, Y.; Feng, Y.; Wang, G.; Peng, C.; Jiang, X.; et al. Genome and transcriptome analysis of the fungal pathogen Fusarium oxysporum f. sp. cubense causing banana vascular wilt disease. PLoS ONE 2014, 9, 95543. [Google Scholar] [CrossRef]
Figure 1. VCG’s of Fusarium oxysporum f. sp. cubense race 1 causing infection of Cavendish cv. Grand Nain plantlets in a glass house. (A) Cross-section of rhizome infected by VCG0124; (B) VCG 01220; (C) VCG0125 and (D) VCG0124/5.
Figure 1. VCG’s of Fusarium oxysporum f. sp. cubense race 1 causing infection of Cavendish cv. Grand Nain plantlets in a glass house. (A) Cross-section of rhizome infected by VCG0124; (B) VCG 01220; (C) VCG0125 and (D) VCG0124/5.
Jof 10 00887 g001
Figure 2. Number of Fusarium oxysporum f. sp. cubense VCGs associated with major commercial bananas grown in India.
Figure 2. Number of Fusarium oxysporum f. sp. cubense VCGs associated with major commercial bananas grown in India.
Jof 10 00887 g002
Figure 3. Geographical distribution of Fusarium oxysporum f. sp. cubense races in different banana-growing states of India.
Figure 3. Geographical distribution of Fusarium oxysporum f. sp. cubense races in different banana-growing states of India.
Jof 10 00887 g003
Figure 4. Phylogenetic tree constructed using the maximum likelihood method based on the TEF-1α gene sequences data of 46 representative Fusarium oxysporum f. sp. cubense (Foc) isolates associated with banana grown in India. The analysis was carried out with the TEF-1α sequences of Indian Foc isolates combined with sequences from F. equiseti (MZ669768.1 and KX463032), Foc TR4 of China (OR865337) and Malaysia (MH 484989), and Foc R1 of Central Africa (KX365413) and China (JX294964). Bootstrap values greater than 60% are indicated for maximum likelihood internodes where relevant. The scale bar corresponds to 0.10 nucleotide substitutions per site. The tree is rooted with two isolates of Fusarium equiseti.
Figure 4. Phylogenetic tree constructed using the maximum likelihood method based on the TEF-1α gene sequences data of 46 representative Fusarium oxysporum f. sp. cubense (Foc) isolates associated with banana grown in India. The analysis was carried out with the TEF-1α sequences of Indian Foc isolates combined with sequences from F. equiseti (MZ669768.1 and KX463032), Foc TR4 of China (OR865337) and Malaysia (MH 484989), and Foc R1 of Central Africa (KX365413) and China (JX294964). Bootstrap values greater than 60% are indicated for maximum likelihood internodes where relevant. The scale bar corresponds to 0.10 nucleotide substitutions per site. The tree is rooted with two isolates of Fusarium equiseti.
Jof 10 00887 g004
Figure 5. Distribution of effector-based SIX genes in different strains of Fusarium oxysporum f. sp. cubense (Foc) in India: (A) amplicons of SIX1F/SIX1R primer set for Foc R1, Foc TR4, and Foc STR4; (B) amplicons of SIX2F/SIX2R primer set for Foc R1, Foc TR4, and Foc STR4; (C) amplicons of SIX4F/SIX4R primer set for Foc R1, Foc TR4, and Foc STR4; (D) amplicons of SIX6F/SIX6R primer set for Foc R1, Foc TR4, and Foc STR4; (E) amplicons of SIX7F/SIX7R primer set for Foc R1, Foc TR4, and Foc STR4; (F) amplicons of SIX8F/SIX8R primer set for Foc R1, Foc TR4, and Foc STR4; (G) amplicons of SIX9F/SIX9R primer set for Foc R1, Foc TR4, and Foc STR4; (H) amplicons of SIX13F/SIX13R primer set for Foc R1, Foc TR4, and Foc STR4. Lane M: Ladder; Lane 1–6: Foc R1(VCG 01220, 0124/5, 0124, 0125); Lane 7–11: Foc TR4(VCG 01213/16); Lane 12: Foc STR4(VCG 0120).
Figure 5. Distribution of effector-based SIX genes in different strains of Fusarium oxysporum f. sp. cubense (Foc) in India: (A) amplicons of SIX1F/SIX1R primer set for Foc R1, Foc TR4, and Foc STR4; (B) amplicons of SIX2F/SIX2R primer set for Foc R1, Foc TR4, and Foc STR4; (C) amplicons of SIX4F/SIX4R primer set for Foc R1, Foc TR4, and Foc STR4; (D) amplicons of SIX6F/SIX6R primer set for Foc R1, Foc TR4, and Foc STR4; (E) amplicons of SIX7F/SIX7R primer set for Foc R1, Foc TR4, and Foc STR4; (F) amplicons of SIX8F/SIX8R primer set for Foc R1, Foc TR4, and Foc STR4; (G) amplicons of SIX9F/SIX9R primer set for Foc R1, Foc TR4, and Foc STR4; (H) amplicons of SIX13F/SIX13R primer set for Foc R1, Foc TR4, and Foc STR4. Lane M: Ladder; Lane 1–6: Foc R1(VCG 01220, 0124/5, 0124, 0125); Lane 7–11: Foc TR4(VCG 01213/16); Lane 12: Foc STR4(VCG 0120).
Jof 10 00887 g005
Table 1. Geographical distribution of different VCGS and races of the Fusarium wilt pathogen, and disease incidence according to banana variety.
Table 1. Geographical distribution of different VCGS and races of the Fusarium wilt pathogen, and disease incidence according to banana variety.
StateDistrictNumber of Plantations
Visited
Varieties
(Genomic Group)
Disease Incidence Range (%)VCGs IdentifiedRaces Identified
Tropical regions
Tamil NaduTuticorin10Monthan (ABB)5–230125, 01220, 0128, 0124, 0124/5, 01220/01212R1, R2
Tirunelveli4Monthan (ABB)7–2501220R1
3Rasthali (AAB)3–400125R1
3NeyPoovan (AB)1–150125, 0124/5, 0124, 01220R1
Madurai5Monthan (ABB)3 to 2001220, 0125R1
2Rasthali (AAB) 0125, 0124/5R1
Kanyakumari8NeyPoovan (AB)8–130125, 0124R1
Namakkal11Rasthali (AAB)230124, 0125, 01214R1
Theni10Grand Nain (AAA)8 to 950125, 0124, 01220R1
Coimbatore3Karpuravalli (ABB)0.5 to 130124, 0125, 0128R1
Karur1Karpuravalli (ABB)50125, 01220R1
2Rasthali (AAB)5–150125R1
Thanjavur1Karpuravalli (ABB)60124/5R1
Pondicherry (UT)Pondicherry2Karpuravalli (ABB)5–90124R1
KeralaThrissur6Rasthali (AAB)11–250124/5, 01212R1
Palakad1NeyPoovan240125R1
Trivandrun2Karpuravalli (ABB)2–90128, 0124R1
KarnatakaMandya2Grand Nain (AAA)20124R1
1Rasthali (AAB)250125R1
Chikkeballapura3NeyPoovan (AB)300125, 0124/5, 01212R1
Mysuru3Nanjangud Rasabale (AAB)0.4 to 300125R1
2NeyPoovan (AB)20–3001220, 0125, 01211R1, STR4
Andhra PradeshWest Godavari4Mortaman/ Amritapani (AAB)5–450124, 0125, 0129
01217
R1, STR4
Guntur1Karpuravalli (ABB)80124R1
OdishaCuttak1Rasthali (AAB)200125R1
Khordha1Rasthali (AAB)150125R1
Ranapur1Rasthali (AAB)220125R1
Dhenkanal1Monthan (ABB)1701220, 0124R1
Kendrapara1Monthan (ABB)90124R1
Jaipur1Monthan (ABB)140124R1
MaharashtraJalgaon6Grand Nain (AAA)2–300125, 01213/16R1, TR4
Sub-Tropical regions
GujaratSurat10Grand Nain (AAA)30–6001220, 0120, 01213/16R1, TR4, STR4
Gandevi1Grand Nain (AAA)50124, 0125R1
Bharuch10Grand Nain (AAA)10–5001213/16TR4
Vadodara5Grand Nain (AAA)5–2501220R1
Uttar PradeshSantKabir Nagar2Monthan (ABB)25 to 3001220R1
Maharajganj10Grand Nain (AAA)15 to 7501216, 0125TR4, R1
Kushinagar2Grand Nain (AAA)201220, 01213/16TR4, R1
Shravasti6Grand Nain (AAA)2.5 to 6001213/16TR4
Ayodhya3Grand Nain (AAA)5 to 450125, 01220TR4, R1
Lakhimpur Kheri10Grand Nain (AAA)7–9001213/16TR4
Barabanki2Grand Nain (AAA)1–2001213/16TR4
Madhya PradeshBurhanpur6Grand Nain (AAA)10–500120, 01213/16STR4, TR4
BiharVaishali8Alpon (AAB)10125R1
2Chinia (Awak-ABB)0.5–80124R1
1Kothia (ABB)0.501220R1
1Malbhog (AAB)10125R1
1Muthia (ABB0.501220R1
7Grand Nain (AAA)--
Khagaria Chinia (ABB)0.50124R1
Bhagalpur Chinia (ABB)0.10124R1
Robusta (AAA)201213/16TR4
Katihar7Robusta (AAA)2–2701213/16TR4
9Grand Nain (AAA)6–6501216TR4
Purnia10Chinia (ABB)0.501213/16TR4
Robusta (AAA)2–501213/16TR4
Grand Nain (AAA)2 to 22.701213/16TR4
West BengalNadia13Grand Nain0.5 to 500125, 01213/16TR4, R1
1Kanthali (ABB)400124, 01213/16TR4, R1
2Mortaman (AAB)30125R1
11Singapuri (AAA)6 to 5001213/16TR4
1Chinia (ABB)100124R1
2Cheni Champa (AAB)3–3301213/16TR4
Murshidabad5Singapuri (AAA)12–2601213/16TR4
1Cheni Champa (AAB)5001213/16TR4
Hooghly5Kanthali (ABB)0–200124R1
SJalpaiguri1Chinia (ABB)10124R1
AssamJorhat6Malbhog (AAB)15–450125, 124, 0128, 0124/5, 01218, 01220, 01212, 0129R1, STR4
2Monthan (ABB)20–280125, 0124/5R1
Goalpara4Malbhog (AAB)15–450125R1
Guwahati1Karpuravalli (ABB)1701211, 0124, 01220, 0125STR4, R1
2Athiakol (BB)0.10124/5, 0125R1
Arunachal PradeshWest Kameng1Karpuravalli (ABB)0.50124R1
1Athiakol (BB)0.10124/5R1
3Manohar (ABB)0.10125, 0124R1
MeghalayaEast Kashi Hills2Manohar (ABB)20125, 0124R1
TripuraWest Tripura5Sabri (Rasthali)5–230125R1
NagalandDimapur2Manohar (ABB)0.50125R1
Pisang Awak (ABB)—Syn-Karpuravalli, Chinia, Manohar, Kanthali; Rasthali (Silk-AAB) Syn-Malbhog, Sabri, Amritapani, Nanjangud Rasabale, Mortaman; Cavendish (AAA)-Grand Nain, Robusta, Singapuri; Monthan (Cooking banana-ABB) Syn-Kothia, Muthia; Poovan-Mysore (AAB) Syn-Cheni champa, Alpon.
Table 2. List of Fusarium oxysporum f. sp. cubense race-specific primers and SIX Primers used.
Table 2. List of Fusarium oxysporum f. sp. cubense race-specific primers and SIX Primers used.
Primer NamePrimer Sequence (5′ to 3′)Length (bp)Annealing ConditionsReference
FocR1F
FocR1R
TACCTCCTTGGTCGACAGGT
CAGACTTCCAACGTCTCGGT
32062 °CThangavelu et al., 2022 [15]
FocR4F
FocR4R
CGCACTCTTACGTTGAGGAT
TCCACGCAACACTAGCTACT
40066 °C
FocTR4F FocTR4RTGATTTGCCGTGGAATGACA
TGGTCTTGACACGACCCA
25065 °C
FocSTR4F FocSTR4RGCGCAAGTAGTCTTGCTTCC
ATTAAGCGGTTGGCGTATTG
25058 °C
SIX1a F
SIX1a R
GGCAAATCACTCGTCTGGGA
CATAGCGGTAAAAGCCGCAC
57360 °CRaman et al., 2021 [20]
SIX2a F
SIX2a R
TTTAGCACCGCGAGGAACTT
AAACCAGCCACCATAACCGT
21460 °C
SIX4a F
SIX4a R
GGCGTTGCGGGTTTTTAACT
ATGCATTACGGAGTAGGCCC
71760 °C
SIX6a F
SIX6a R
CTACGTCGACATCACTCCCA
TACCATCATCTGCATCGCCA
41259 °C
SIX7a F
SIX7a R
CCTCCTTTTCCATTTCGCCC
CATTGGGCCTAAAGACGTCG
36559 °C
SIX8a F
SIX8a R
CTTCCTCCTAGCCGTCTCTG
TAAGCTCTTCACCTCACCCG
45059 °C
SIX9a F
SIX9a R
ACATTCTGTCCGTCGATCGTT
GCCACCTTCCATATCGCTGAA
27559 °C
SIX13a F
SIX13a R
AACTCAAAGCCTCCTAGGCAC
AATCCCTGGCGCTGACTTAG
33260 °C
Table 3. Number of Fusarium oxysporum isolates collected from bananas in India.
Table 3. Number of Fusarium oxysporum isolates collected from bananas in India.
StateBanana CultivarsNumber of Isolates
CavendishRasthaliPoovanMonthanKarpuravalliNeyPoovanOthers
Tamil Nadu1018019511063
Pondicherry00002002
Kerala06002109
Karnataka240005011
Andhra Pradesh04001005
Odisha03030006
Maharashtra 60000006
Gujarat2600000026
Uttar Pradesh3300200035
Madhya Pradesh60000006
Bihar3818250054
West Bengal2922080041
Assam-10021-215
Arunachal Pradesh00004015
Meghalaya00002002
Tripura05000005
Nagaland00002002
Total 150 (51.2)53 (18.08)10 (3.4)28 (9.52)32 (10.88)17 (5.78)3 (1.02)293
Table 4. The Foc VCGS/races affecting different banana varieties in tropical and subtropical regions of India.
Table 4. The Foc VCGS/races affecting different banana varieties in tropical and subtropical regions of India.
StatesSubgroup (Genome)VarietiesIncidenceVCGsRaces
TropicalCavendish (AAA)Grand Nain2–950125, 0124, 01220R1
Silk (AAB)Rasthali0.4 to 450125, 0124/5, 0124, 0129, 01214, 01212, 01217R1, STR4
Cooking type (ABB)Monthan3–300125, 01220, 0128, 0124, 0124/5, 01212R1
Pisang Awak (ABB)Karpuravalli0.5 to 130124, 0125, 0128, 01220, 0124/5R1
NeyPoovan (AB)NeyPoovan1–300125, 0124/5, 0124, 01220, 01212, 01211R1, STR4
SubtropicalCavendish (AAA)Grand Nain0.5 to 9501213/16, 01216, 0125, 01220, 0120R1, STR4, TR4
Mysuru (AAB)Poovan1–500125, 01213/16,R1, TR4
Pisang Awak (ABB)Karpuravalli0–200124, 01211, 01220, 0125, 01213/16R1, STR4, TR4
Cooking type (ABB)Monthan0.5 to 2801220, 0125, 0124/5R1
Silk (AAB)Rasthali1–450125, 0124, 0128, 0124/5, 01218, 01220, 01212, 0129R1, STR4 TR4
Cavendish (AAA)Robusta6–5001213/16TR4
Athiakol Type (BB)Athiakol0.10124/5, 0125R1
Table 5. Fusarium oxysporum f. sp. cubense isolates analysed for vegetative compatibility group (VCG) identity, pathogenicity to Cavendish cv. Grand Nain, and race.
Table 5. Fusarium oxysporum f. sp. cubense isolates analysed for vegetative compatibility group (VCG) identity, pathogenicity to Cavendish cv. Grand Nain, and race.
S. No.IsolateCultivarGeographical LocationRaceVCGPathogenicPCR Diagnosis for
TR4STR4R4R1
1.BR3MonthanKatihar, Bihar101220++
2.BR5MonthanKatihar, Bihar101220++
3.BR12Grand NainKatihar, Bihar401216+++
4.BR13Grand NainKatihar, Bihar401213/16+++
5.BR14Grand NainKatihar, Bihar401213/16+++
6.BR19Grand NainKatihar, Bihar10124++
7.GU2Grand NainSurat, Gujarat101220++
8.GU3Grand NainSurat, Gujarat40120+++
9.GU4Grand NainBharuch, Gujarat401213/16+++
10.GU5Grand NainBharuch, Gujarat401213/16+++
11.GU6Grand NainBharuch, Gujarat401213/16+++
12.GU14Grand NainVadodara, Gujarat101220++
13.GU15Grand NainVadodara, Gujarat101220++
14.GU21Grand NainSurat, Gujarat401213/16+++
15.KA1Grand NainMandya, Karnataka10124++
16.KA2MonthanMandya, Karnataka10124++
17.KA4Nanjangudu RasbaleMysore, Karnataka10125++
18.KA6Grand NainMysore, Karnataka101220++
19.KA8Grand NainMysore, Karnataka101220++
20.KE1RasthaliThrissur, Kerala10124++
21.KE2RasthaliThrissur, Kerala10125++
22.KE4Big ebangaThrissur, Kerala10124/5++
23.MP1Grand NainBurhanpur, MP10125++
24.MP2Grand NainBurhanpur, MP10125++
25.MP3Grand NainBurhanpur, MP101220++
26.MP4Grand NainBurhanpur, MP40120+++
27.MA1Grand NainJalgaon, Maharashtra10125++
28.TN1Grand NainTheni, TN10125++
29.TN2Grand NainTheni, TN10125++
30.TN3Grand NainTheni, TN10125++
31.UP8MonthanSantKabir Nagar, UP101220++
32.UP11Grand NainMaharajganj, UP10125++
33.UP17Grand NainAyodhya, UP401213/16+++
34.UP20Grand NainMaharajganj, UP401213/16+++
35.UP22Grand NainMaharajganj, UP401213/16+++
36.UP40Grand NainShravasti, UP401213/16+++
37.UP41Grand NainBarabanki, UP401213/16+++
38.WB2Grand NainNadia, WB401213/16+++
39.WB3Grand NainNadia, WB10124++
40.WB7KanthaliNadia, WB401213/16+++
41.WB8SingapuriNadia, WB401213/16+++
42.WB9ChiniaNadia, WB401213/16+++
43.WB24SingapuriMurshidabad, WB401213/16+++
44.WB28KanthaliNadia, WB10125++
45.WB31KanthaliHoogly, WB401213/16+++
46.WB32ChiniaHoogly, WB401213/16+++
+ denotes present, − denotes absent.
Table 6. Distribution of effector-based SIX genes in different strains of Fusarium oxysporum f. sp. cubense in India.
Table 6. Distribution of effector-based SIX genes in different strains of Fusarium oxysporum f. sp. cubense in India.
S. No.IsolatesCultivarVCGRacesSIX1SIX2SIX4SIX6SIX7SIX8SIX9SIX13
1.BR3Monthan01220R1+++++
2.BR5Monthan01220R1+++++
3.BR12Grand Nain01216TR4+++++
4.BR13Grand Nain01213/16TR4+++++
5.BR14Grand Nain01213/16TR4+++++
6.BR19Grand Nain0124R1+++++
7.GU2Grand Nain01220R1+++++
8.GU3Grand Nain0120STR4++++++
9.GU4Grand Nain01213/16TR4+++++
10.GU5Grand Nain01213/16TR4+++++
11.GU6Grand Nain01213/16TR4+++++
12.GU14Grand Nain01220R1+++++
13.GU15Grand Nain01220R1+++++
14.GU21Grand Nain01213/16TR4+++++
15.KA1Grand Nain0124R1+++++
16.KA2Monthan0124R1+++++
17.KA4Nanjangudu Rasbale0125R1+++++
18.KA6Grand Nain01220R1+++++
19.KA8Grand Nain01220R1+++++
20.KE1Rasthali0124R1+++++
21.KE2Rasthali0125R1+++++
22.KE4Big ebanga0124/5R1+++++
23.MP1Grand Nain0125R1+++++
24.MP2Grand Nain0125R1+++++
25.MP3Grand Nain01220R1+++++
26.MP4Grand Nain0120STR4++++++
27.MA1Grand Nain0125R1+++++
28.TN1Grand Nain0125R1+++++
29.TN2Grand Nain0125R1+++++
30.TN3Grand Nain0125R1+++++
31.UP8Monthan01220R1+++++
32.UP11Grand Nain0125R1+++++
33.UP17Grand Nain01213/16TR4+++++
34.UP20Grand Nain01213/16TR4+++++
35.UP22Grand Nain01213/16TR4+++++
36.UP40Grand Nain01213/16TR4+++++
37.UP41Grand Nain01213/16TR4+++++
38.WB2Grand Nain01213/16TR4+++++
39.WB3Grand Nain0124R1+++++
40.WB7Kanthali01213/16TR4+++++
41.WB8Singapuri01213/16TR4+++++
42.WB9Chinia01213/16TR4+++++
43.WB24Singapuri01213/16TR4+++++
44.WB28Kanthali0125R1+++++
45.WB31Kanthali01213/16TR4+++++
46.WB32Chinia01213/16TR4+++++
+ denotes present, − denotes absent.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Thangavelu, R.; Amaresh, H.; Gopi, M.; Loganathan, M.; Nithya, B.; Ganga Devi, P.; Anuradha, C.; Thirugnanavel, A.; Patil, K.B.; Blomme, G.; et al. Geographical Distribution, Host Range and Genetic Diversity of Fusarium oxysporum f. sp. cubense Causing Fusarium Wilt of Banana in India. J. Fungi 2024, 10, 887. https://doi.org/10.3390/jof10120887

AMA Style

Thangavelu R, Amaresh H, Gopi M, Loganathan M, Nithya B, Ganga Devi P, Anuradha C, Thirugnanavel A, Patil KB, Blomme G, et al. Geographical Distribution, Host Range and Genetic Diversity of Fusarium oxysporum f. sp. cubense Causing Fusarium Wilt of Banana in India. Journal of Fungi. 2024; 10(12):887. https://doi.org/10.3390/jof10120887

Chicago/Turabian Style

Thangavelu, Raman, Hadimani Amaresh, Muthukathan Gopi, Murugan Loganathan, Boopathy Nithya, Perumal Ganga Devi, Chelliah Anuradha, Anbazhagan Thirugnanavel, Kalyansing Baburao Patil, Guy Blomme, and et al. 2024. "Geographical Distribution, Host Range and Genetic Diversity of Fusarium oxysporum f. sp. cubense Causing Fusarium Wilt of Banana in India" Journal of Fungi 10, no. 12: 887. https://doi.org/10.3390/jof10120887

APA Style

Thangavelu, R., Amaresh, H., Gopi, M., Loganathan, M., Nithya, B., Ganga Devi, P., Anuradha, C., Thirugnanavel, A., Patil, K. B., Blomme, G., & Selvarajan, R. (2024). Geographical Distribution, Host Range and Genetic Diversity of Fusarium oxysporum f. sp. cubense Causing Fusarium Wilt of Banana in India. Journal of Fungi, 10(12), 887. https://doi.org/10.3390/jof10120887

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop