The Epidemiological Situation of the Managed Honey Bee (Apis mellifera) Colonies in the Italian Region Emilia-Romagna
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Extraction of Nucleic Acids
2.3. Quantitative Real-Time PCR Assays
2.4. Statistical Analysis
3. Results
3.1. Geographical Distribution
3.2. Seasonal Trend
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Boncristiani, H.; Ellis, J.D.; Bustamante, T.; Graham, J.; Jack, C.; Kimmel, C.B.; Mortensen, A.; Schmehl, D.R. World Honey Bee Health: The Global Distribution of Western Honey Bee (Apis mellifera L.) Pests and Pathogens. Bee World 2020, 98, 2–6. [Google Scholar] [CrossRef] [Scilit]
- Porrini, C.; Mutinelli, F.; Bortolotti, L.; Granato, A.; Laurenson, L.; Roberts, K.; Gallina, A.; Silvester, N.; Medrzycki, P.; Renzi, T.; et al. The Status of Honey Bee Health in Italy: Results from the Nationwide Bee Monitoring Network. PLoS ONE 2016, 11, e0155411. [Google Scholar] [CrossRef] [Scilit]
- Hristov, P.; Shumkova, R.; Palova, N.; Neov, B. Factors Associated with Honey Bee Colony Losses: A Mini-Review. Vet. Sci. 2020, 7, 166. [Google Scholar] [CrossRef] [Scilit]
- Steinhauer, N.; Kulhanek, K.; Antúnez, K.; Human, H.; Chantawannakul, P.; Chauzat, M.P.; vanEngelsdorp, D. Drivers of colony losses. Curr. Opin. Insect Sci. 2018, 26, 142–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cornman, R.S.; Tarpy, D.R.; Chen, Y.; Jeffreys, L.; Lopez, D.; Pettis, J.S.; VanEngelsdorp, D.; Evans, J.D. Pathogen Webs in Collapsing Honey Bee Colonies. PLoS ONE 2012, 7, e43562. [Google Scholar] [CrossRef] [Scilit]
- Chen, G.; Wu, Y.; Deng, J.; Wen, Z.; Wang, S.; Chen, Y.; Hu, F.; Zheng, H. Seasonal variation of viral infections between the eastern honey bee (Apis cerana) and the western honey bee (Apis mellifera). Microbiologyopen 2021, 10, e1162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- D’Alvise, P.; Seeburger, V.; Gihring, K.; Kieboom, M.; Hasselmann, M. Seasonal dynamics and co-occurrence patterns of honey bee pathogens revealed by high-throughput RT-qPCR analysis. Ecol. Evol. 2019, 9, 10241–10252. [Google Scholar] [CrossRef] [Scilit]
- Calovi, M.; Grozinger, C.M.; Miller, D.A.; Goslee, S.C. Summer weather conditions influence winter survival of honey bees (Apis mellifera) in the northeastern United States. Sci. Rep. 2021, 11, 1553. [Google Scholar] [CrossRef] [Scilit]
- van Dooremalen, C.; Gerritsen, L.; Cornelissen, B.; van der Steen, J.J.M.; van Langevelde, F.; Blacquière, T. Winter survival of individual honey bees and honey bee colonies depends on level of varroa destructor infestation. PLoS ONE 2012, 7, e36285. [Google Scholar] [CrossRef] [Scilit]
- Beaurepaire, A.; Piot, N.; Doublet, V.; Antunez, K.; Campbell, E.; Chantawannakul, P.; Chejanovsky, N.; Gajda, A.; Heerman, M.; Panziera, D.; et al. Diversity and Global Distribution of Viruses of the Western Honey Bee, Apis mellifera. Insects 2020, 11, 239. [Google Scholar] [CrossRef] [Scilit]
- Ellis, J.D.; Munn, P.A. The worldwide health status of honey bees. Bee World 2015, 86, 88–101. [Google Scholar] [CrossRef] [Scilit]
- Shen, M.; Cui, L.; Ostiguy, N.; Cox-Foster, D. Intricate transmission routes and interactions between picorna-like viruses (Kashmir bee virus and sacbrood virus) with the honeybee host and the parasitic varroa mite. J. Gen. Virol. 2005, 86, 2281–2289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bromenshenk, J.J.; Henderson, C.B.; Wick, C.H.; Stanford, M.F.; Zulich, A.W.; Jabbour, R.E.; Deshpande, S.V.; McCubbin, P.E.; Seccomb, R.A.; Welch, P.M.; et al. Iridovirus and Microsporidian Linked to Honey Bee Colony Decline. PLoS ONE 2010, 5, e13181. [Google Scholar] [CrossRef] [Scilit]
- Martín-Hernández, R.; Botías, C.; Bailón, E.G.; Martínez-Salvador, A.; Prieto, L.; Meana, A.; Higes, M. Microsporidia infecting Apis mellifera: Coexistence or competition. Is Nosema ceranae replacing Nosema apis? Environ. Microbiol. 2012, 14, 2127–2138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cox-Foster, D.L.; Conlan, S.; Holmes, E.C.; Palacios, G.; Evans, J.D.; Moran, N.A.; Quan, P.-L.L.; Briese, T.; Hornig, M.; Geiser, D.M.; et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science 2007, 318, 283–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pettis, J.; Van Engelsdorp, D.; Cox-Foster, D. Colony collapse disorder working group pathogen sub-group progress report. Am. Bee J. 2007, 103, 595–597. [Google Scholar]
- Fries, I.; Feng, F.; Da Silva, A.; Slemenda, S.B.; Pieniazek, N.J. Nosema ceranae n. sp. (Microspora, Nosematidae), morphological and molecular characterization of a microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera, Apidae). Eur. J. Protistol. 1996, 32, 356–365. [Google Scholar] [CrossRef] [Scilit]
- Paxton, R.J.; Klee, J.; Korpela, S.; Fries, I. Nosema ceranae has infected Apis mellifera in Europe since at least 1998 and may be more virulent than Nosema apis. Apidologie 2007, 38, 558–565. [Google Scholar] [CrossRef] [Scilit]
- Nanetti, A.; Ugolini, L.; Cilia, G.; Pagnotta, E.; Malaguti, L.; Cardaio, I.; Matteo, R.; Lazzeri, L. Seed Meals from Brassica nigra and Eruca sativa Control Artificial Nosema ceranae Infections in Apis mellifera. Microorganisms 2021, 9, 949. [Google Scholar] [CrossRef] [Scilit]
- Higes, M.; García-Palencia, P.; Urbieta, A.; Nanetti, A.; Martín-Hernández, R. Nosema apis and Nosema ceranae Tissue Tropism in Worker Honey Bees (Apis mellifera). Vet. Pathol. 2020, 57, 132–138. [Google Scholar] [CrossRef] [Scilit]
- Fries, I.; Martín, R.; Meana, A.; García-Palencia, P.; Higes, M. Natural infections of Nosema ceranae in European honey bees. J. Apic. Res. 2006, 45, 230–233. [Google Scholar] [CrossRef] [Scilit]
- Ugolini, L.; Cilia, G.; Pagnotta, E.; Malaguti, L.; Capano, V.; Guerra, I.; Zavatta, L.; Albertazzi, S.; Matteo, R.; Lazzeri, L.; et al. Glucosinolate Bioactivation by Apis mellifera Workers and Its Impact on Nosema ceranae Infection at the Colony Level. Biomolecules 2021, 11, 1657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Michalczyk, M.; Sokół, R. Estimation of the influence of selected products on co-infection with N. apis / N. ceranae in Apis mellifera using real-time PCR. Invertebr. Reprod. Dev. 2018, 62, 92–97. [Google Scholar] [CrossRef] [Scilit]
- Botías, C.; Martín-Hernández, R.; Meana, A.; Higes, M. Screening alternative therapies to control Nosemosis type C in honey bee (Apis mellifera iberiensis) colonies. Res. Vet. Sci. 2013, 95, 1041–1045. [Google Scholar] [CrossRef] [Scilit]
- Cilia, G.; Sagona, S.; Giusti, M.; Jarmela dos Santos, P.E.; Nanetti, A.; Felicioli, A. Nosema ceranae infection in honeybee samples from Tuscanian Archipelago (Central Italy) investigated by two qPCR methods. Saudi J. Biol. Sci. 2019, 26, 1553–1556. [Google Scholar] [CrossRef] [Scilit]
- de Miranda, J.R.; Genersch, E. Deformed wing virus. J. Invertebr. Pathol. 2010, 103, S48–S61. [Google Scholar] [CrossRef] [Scilit]
- Martin, S.J.; Brettell, L.E. Deformed Wing Virus in Honeybees and Other Insects. Annu. Rev. Virol. 2019, 6, 49–69. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.P.; Pettis, J.S.; Collins, A.; Feldlaufer, M.F. Prevalence and Transmission of Honeybee Viruses. Appl. Environ. Microbiol. 2006, 72, 606–611. [Google Scholar] [CrossRef] [Scilit]
- Mockel, N.; Gisder, S.; Genersch, E. Horizontal transmission of deformed wing virus: Pathological consequences in adult bees (Apis mellifera) depend on the transmission route. J. Gen. Virol. 2011, 92, 370–377. [Google Scholar] [CrossRef] [Scilit]
- Gisder, S.; Aumeier, P.; Genersch, E. Deformed wing virus: Replication and viral load in mites (Varroa destructor). J. Gen. Virol. 2009, 90, 463–467. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.P.; Siede, R. Honey bee viruses. Adv. Virus. Res. 2007, 70, 33–80. [Google Scholar] [PubMed]
- Yue, C.; Schroder, M.; Gisder, S.; Genersch, E. Vertical-transmission routes for deformed wing virus of honeybees (Apis mellifera). J. Gen. Virol. 2007, 88, 2329–2336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Miranda, J.R.; Drebot, M.; Tyler, S.; Shen, M.; Cameron, C.E.; Stoltz, D.B.; Camazine, S.M. Complete nucleotide sequence of Kashmir bee virus and comparison with acute bee paralysis virus. J. Gen. Virol. 2004, 85, 2263–2270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benjeddou, M.; Leat, N.; Allsopp, M.; Davison, S. Detection of Acute Bee Paralysis Virus and Black Queen Cell Virus from Honeybees by Reverse Transcriptase PCR. Appl. Environ. Microbiol. 2001, 67, 2384–2387. [Google Scholar] [CrossRef] [Scilit]
- de Miranda, J.R.; Cordoni, G.; Budge, G. The Acute bee paralysis virus–Kashmir bee virus–Israeli acute paralysis virus complex. J. Invertebr. Pathol. 2010, 103, S30–S47. [Google Scholar] [CrossRef] [Scilit]
- Evans, J.D. Genetic Evidence for Coinfection of Honey Bees by Acute Bee Paralysis and Kashmir Bee Viruses. J. Invertebr. Pathol. 2001, 78, 189–193. [Google Scholar] [CrossRef] [Scilit]
- Gisder, S.; Genersch, E. Viruses of commercialized insect pollinators. J. Invertebr. Pathol. 2017, 147, 51–59. [Google Scholar] [CrossRef] [Scilit]
- Ribière, M.; Olivier, V.; Blanchard, P. Chronic bee paralysis: A disease and a virus like no other? J. Invertebr. Pathol. 2010, 103, S120–S131. [Google Scholar] [CrossRef] [Scilit]
- Celle, O.; Blanchard, P.; Olivier, V.; Schurr, F.; Cougoule, N.; Faucon, J.P.; Ribière, M. Detection of Chronic bee paralysis virus (CBPV) genome and its replicative RNA form in various hosts and possible ways of spread. Virus Res. 2008, 133, 280–284. [Google Scholar] [CrossRef] [Scilit]
- Olivier, V.; Massou, I.; Celle, O.; Blanchard, P.; Schurr, F.; Ribière, M.; Gauthier, M. In situ hybridization assays for localization of the chronic bee paralysis virus in the honey bee (Apis mellifera) brain. J. Virol. Methods 2008, 153, 232–237. [Google Scholar] [CrossRef] [Scilit]
- Ribiere, M.; Triboulot, C.; Mathieu, L.; Aurieres, C.; Faucon, J.-P.; Pepin, M. Molecular diagnosis of chronic bee paralysis virus infection. Apidologie 2002, 33, 339–351. [Google Scholar] [CrossRef] [Scilit]
- Budge, G.E.; Simcock, N.K.; Holder, P.J.; Shirley, M.D.F.; Brown, M.A.; Van Weymers, P.S.M.; Evans, D.J.; Rushton, S.P. Chronic bee paralysis as a serious emerging threat to honey bees. Nat. Commun. 2020, 11, 2164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arismendi, N.; Bruna, A.; Zapata, N.; Vargas, M. PCR-specific detection of recently described Lotmaria passim (Trypanosomatidae) in Chilean apiaries. J. Invertebr. Pathol. 2016, 134, 1–5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schwarz, R.S.; Bauchan, G.R.; Murphy, C.A.; Ravoet, J.; de Graaf, D.C.; Evans, J.D. Characterization of Two Species of Trypanosomatidae from the Honey Bee Apis mellifera: Crithidia mellificae Langridge and McGhee, and Lotmaria passim n. gen., n. sp. J. Eukaryot. Microbiol. 2015, 62, 567–583. [Google Scholar] [CrossRef] [Scilit]
- Bartolomé, C.; Buendía, M.; Benito, M.; De la Rúa, P.; Ornosa, C.; Martín-Hernández, R.; Higes, M.; Maside, X. A new multiplex PCR protocol to detect mixed trypanosomatid infections in species of Apis and Bombus. J. Invertebr. Pathol. 2018, 154, 37–41. [Google Scholar] [CrossRef] [Scilit]
- Strobl, V.; Yañez, O.; Straub, L.; Albrecht, M.; Neumann, P. Trypanosomatid parasites infecting managed honeybees and wild solitary bees. Int. J. Parasitol. 2019, 49, 605–613. [Google Scholar] [CrossRef] [Scilit]
- Pinilla-Gallego, M.S.; Williams, E.E.; Davis, A.; Fitzgerald, J.L.; McArt, S.H.; Irwin, R.E. Within-Colony Transmission of Microsporidian and Trypanosomatid Parasites in Honey Bee and Bumble Bee Colonies. Environ. Entomol. 2020, 49, 1393–1401. [Google Scholar] [CrossRef] [Scilit]
- Ruiz-González, M.X.; Brown, M.J.F. Honey bee and bumblebee trypanosomatids: Specificity and potential for transmission. Ecol. Entomol. 2006, 31, 616–622. [Google Scholar] [CrossRef] [Scilit]
- Gómez-Moracho, T.; Buendía-Abad, M.; Benito, M.; García-Palencia, P.; Barrios, L.; Bartolomé, C.; Maside, X.; Meana, A.; Jiménez-Antón, M.D.; Olías-Molero, A.I.; et al. Experimental evidence of harmful effects of Crithidia mellificae and Lotmaria passim on honey bees. Int. J. Parasitol. 2020, 50, 1117–1124. [Google Scholar] [CrossRef] [Scilit]
- Buendía-Abad, M.; Higes, M.; Martín-Hernández, R.; Barrios, L.; Meana, A.; Fernández Fernández, A.; Osuna, A.; De Pablos, L.M. Workflow of Lotmaria passim isolation: Experimental infection with a low-passage strain causes higher honeybee mortality rates than the PRA-403 reference strain. Int. J. Parasitol. Parasites Wildl. 2021, 14, 68–74. [Google Scholar] [CrossRef] [Scilit]
- Otterstatter, M.C.; Gegear, R.J.; Colla, S.R.; Thomson, J.D. Effects of parasitic mites and protozoa on the flower constancy and foraging rate of bumble bees. Behav. Ecol. Sociobiol. 2005, 58, 383–389. [Google Scholar] [CrossRef] [Scilit]
- Gegear, R.J.; Otterstatter, M.C.; Thomson, J.D. Bumble-bee foragers infected by a gut parasite have an impaired ability to utilize floral information. Proc. R. Soc. B Biol. Sci. 2006, 273, 1073–1078. [Google Scholar] [CrossRef] [Scilit]
- Liu, Q.; Lei, J.; Darby, A.C.; Kadowaki, T. Trypanosomatid parasite dynamically changes the transcriptome during infection and modifies honey bee physiology. Commun. Biol. 2020, 3, 51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cersini, A.; Bellucci, V.; Lucci, S.; Mutinelli, F.; Granato, A.; Porrini, C.; Felicioli, A.; Formato, G. First isolation of Kashmir bee virus (KBV) in Italy. J. Apic. Res. 2013, 52, 54–55. [Google Scholar] [CrossRef] [Scilit]
- Mazzei, M.; Cilia, G.; Forzan, M.; Lavazza, A.; Mutinelli, F.; Felicioli, A. Detection of replicative Kashmir Bee Virus and Black Queen Cell Virus in Asian hornet Vespa velutina (Lepelieter 1836) in Italy. Sci. Rep. 2019, 9, 10091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bordin, F.; Zulian, L.; Granato, A.; Caldon, M.; Colamonico, R.; Toson, M.; Trevisan, L.; Biasion, L.; Mutinelli, F. Presence of Known and Emerging Honey Bee Pathogens in Apiaries of Veneto Region (Northeast of Italy) during Spring 2020 and 2021. Appl. Sci. 2022, 12, 2134. [Google Scholar] [CrossRef] [Scilit]
- Cilia, G.; Garrido, C.; Bonetto, M.; Tesoriero, D.; Nanetti, A. Effect of Api-Bioxal ® and ApiHerb ® Treatments against Nosema ceranae Infection in Apis mellifera Investigated by Two qPCR Methods. Vet. Sci. 2020, 7, 125. [Google Scholar] [CrossRef] [Scilit]
- Winston, M.L. The Biology of the Honey Bee; Harvard University Press: Cambridge, MA, USA, 1991; ISBN 978-0-67-407409-5. [Google Scholar]
- Botías, C.; Martín-Hernández, R.; Días, J.; García-Palencia, P.; Matabuena, M.; Juarranz, Á.; Barrios, L.; Meana, A.; Nanetti, A.; Higes, M. The effect of induced queen replacement on Nosema spp. infection in honey bee (Apis mellifera iberiensis) colonies. Environ. Microbiol. 2012, 14, 845–859. [Google Scholar] [CrossRef] [Scilit]
- Nanetti, A.; Ellis, J.D.; Cardaio, I.; Cilia, G. Detection of Lotmaria passim, Crithidia mellificae and Replicative Forms of Deformed Wing Virus and Kashmir Bee Virus in the Small Hive Beetle (Aethina tumida). Pathogens 2021, 10, 372. [Google Scholar] [CrossRef] [Scilit]
- Cilia, G.; Luchetti, G.; Nanetti, A. Polymorphism of 16s rRNA Gene: Any Effect on the Biomolecular Quantitation of the Honey Bee (Apis mellifera L., 1758) Pathogen Nosema ceranae? Appl. Sci. 2022, 12, 422. [Google Scholar] [CrossRef] [Scilit]
- Cilia, G.; Zavatta, L.; Ranalli, R.; Nanetti, A.; Bortolotti, L. Replicative Deformed Wing Virus found in the head of adults from symptomatic commercial bumblebee (Bombus terrestris) colonies. Vet. Sci. 2021, 8, 117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cilia, G.; Cabbri, R.; Maiorana, G.; Cardaio, I.; Dall’Olio, R.; Nanetti, A. A novel TaqMan ® assay for Nosema ceranae quantification in honey bee, based on the protein coding gene Hsp70. Eur. J. Protistol. 2018, 63, 44–50. [Google Scholar] [CrossRef] [Scilit]
- Xu, G.; Palmer-Young, E.; Skyrm, K.; Daly, T.; Sylvia, M.; Averill, A.; Rich, S. Triplex real-time PCR for detection of Crithidia mellificae and Lotmaria passim in honey bees. Parasitol. Res. 2018, 117, 623–628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, W.F.; Skyrm, K.; Ruiter, R.; Solter, L. Disease management in commercial bumble bee mass rearing, using production methods, multiplex PCR detection techniques, and regulatory assessment. J. Apic. Res. 2015, 54, 516–524. [Google Scholar] [CrossRef] [Scilit]
- Chantawannakul, P.; Ward, L.; Boonham, N.; Brown, M. A scientific note on the detection of honeybee viruses using real-time PCR (TaqMan) in Varroa mites collected from a Thai honeybee (Apis mellifera) apiary. J. Invertebr. Pathol. 2006, 91, 69–73. [Google Scholar] [CrossRef] [Scilit]
- Mazzei, M.; Forzan, M.; Cilia, G.; Sagona, S.; Bortolotti, L.; Felicioli, A. First detection of replicative deformed wing virus (DWV) in Vespa velutina nigrithorax. Bull. Insectol. 2018, 71, 211–216. [Google Scholar]
- Genersch, E. Honey bee pathology: Current threats to honey bees and beekeeping. Appl. Microbiol. Biotechnol. 2010, 87, 87–97. [Google Scholar] [CrossRef] [Scilit]
- Traynor, K.S.; Rennich, K.; Forsgren, E.; Rose, R.; Pettis, J.; Kunkel, G.; Madella, S.; Evans, J.; Lopez, D.; vanEngelsdorp, D. Multiyear survey targeting disease incidence in US honey bees. Apidologie 2016, 47, 325–347. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Deng, S.; Yang, D.; Hou, C.; Diao, Q. Complete sequences of the RNA 1 and RNA 2 segments of chronic bee paralysis virus strain CBPV-BJ detected in China. Arch. Virol. 2017, 162, 2451–2456. [Google Scholar] [CrossRef] [Scilit]
- Allen, M.; Ball, B. The incidence and world distribution of honey bee viruses. Bee World 1996, 77, 141–162. [Google Scholar] [CrossRef] [Scilit]
- Ravoet, J.; Maharramov, J.; Meeus, I.; De Smet, L.; Wenseleers, T.; Smagghe, G.; de Graaf, D.C. Comprehensive Bee Pathogen Screening in Belgium Reveals Crithidia mellificae as a New Contributory Factor to Winter Mortality. PLoS ONE 2013, 8, e72443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stevanovic, J.; Stanimirovic, Z.; Genersch, E.; Kovacevic, S.R.; Ljubenkovic, J.; Radakovic, M.; Aleksic, N. Dominance of Nosema ceranae in honey bees in the Balkan countries in the absence of symptoms of colony collapse disorder. Apidologie 2011, 42, 49–58. [Google Scholar] [CrossRef] [Scilit]
- Higes, M.; Martín-Hernández, R.; Martínez-Salvador, A.; Garrido-Bailón, E.; González-Porto, A.V.; Meana, A.; Bernal, J.L.; del Nozal, M.J.; Bernal, J. A preliminary study of the epidemiological factors related to honey bee colony loss in Spain. Environ. Microbiol. Rep. 2010, 2, 243–250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stevanovic, J.; Schwarz, R.S.; Vejnovic, B.; Evans, J.D.; Irwin, R.E.; Glavinic, U.; Stanimirovic, Z. Species-specific diagnostics of Apis mellifera trypanosomatids: A nine-year survey (2007–2015) for trypanosomatids and microsporidians in Serbian honey bees. J. Invertebr. Pathol. 2016, 139, 6–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ribani, A.; Utzeri, V.J.; Taurisano, V.; Galuppi, R.; Fontanesi, L. Analysis of honey environmental DNA indicates that the honey bee (Apis mellifera L.) trypanosome parasite Lotmaria passim is widespread in the apiaries of the North of Italy. J. Invertebr. Pathol. 2021, 184, 107628. [Google Scholar] [CrossRef] [Scilit]
- Cersini, A.; Antognetti, V.; Conti, R.; Velletrani, F.; Formato, G. First PCR isolation of Crithidia mellificae (Euglenozoa: Trypanosomatidae) in Apis mellifera (Hymenoptera: Apidae) in Italy. Fragm. Entomol. 2015, 47, 45–49. [Google Scholar] [CrossRef] [Scilit]
- Tritschler, M.; Retschnig, G.; Yañez, O.; Williams, G.R.; Neumann, P. Host sharing by the honey bee parasites Lotmaria passim and Nosema ceranae. Ecol. Evol. 2017, 7, 1850. [Google Scholar] [CrossRef] [Scilit]
- Blanchard, P.; Ribière, M.; Celle, O.; Lallemand, P.; Schurr, F.; Olivier, V.; Iscache, A.L.; Faucon, J.P. Evaluation of a real-time two-step RT-PCR assay for quantitation of Chronic bee paralysis virus (CBPV) genome in experimentally-infected bee tissues and in life stages of a symptomatic colony. J. Virol. Methods 2007, 141, 7–13. [Google Scholar] [CrossRef] [Scilit]
- Genersch, E.; Aubert, M. Emerging and re-emerging viruses of the honey bee (Apis mellifera L.). Vet. Res. 2010, 41, 54. [Google Scholar] [CrossRef] [Scilit]
- Martin, S.J.; Ball, B.V.; Carreck, N.L. Prevalence and persistence of deformed wing virus (DWV) in untreated or acaricide-treated Varroa destructor infested honey bee (Apis mellifera) colonies. J. Apic. Res. 2015, 49, 72–79. [Google Scholar] [CrossRef] [Scilit]
- Rosenkranz, P.; Aumeier, P.; Ziegelmann, B. Biology and control of Varroa destructor. J. Invertebr. Pathol. 2010, 103, S96–S119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martín-Hernández, R.; Meana, A.; García-Palencia, P.; Marín, P.; Botías, C.; Garrido-Bailón, E.; Barrios, L.; Higes, M. Effect of temperature on the biotic potential of honeybee microsporidia. Appl. Environ. Microbiol. 2009, 75, 2554–2557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez Collado, J.G.; Higes, M.; Barrio, L.; Martín-Hernández, R. Flow cytometry analysis of Nosema species to assess spore viability and longevity. Parasitol. Res. 2014, 113, 1695–1701. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fries, I. Nosema ceranae in European honey bees (Apis mellifera). J. Invertebr. Pathol. 2010, 103, S73–S79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muli, E.; Patch, H.; Frazier, M.; Frazier, J.; Torto, B.; Baumgarten, T.; Kilonzo, J.; Kimani, J.N.; Mumoki, F.; Masiga, D.; et al. Evaluation of the distribution and impacts of parasites, pathogens, and pesticides on honey bee (Apis mellifera) populations in east Africa. PLoS ONE 2014, 9, 94459. [Google Scholar] [CrossRef] [Scilit]
- Giliba, R.A.; Mpinga, I.H.; Ndimuligo, S.A.; Mpanda, M.M. Changing climate patterns risk the spread of Varroa destructor infestation of African honey bees in Tanzania. Ecol. Process. 2020, 9, 48. [Google Scholar] [CrossRef] [Scilit]
- Cornelissen, B.; Neumann, P.; Schweiger, O. Global warming promotes biological invasion of a honey bee pest. Glob. Chang. Biol. 2019, 25, 3642–3655. [Google Scholar] [CrossRef] [Scilit]
- Piot, N.; Schweiger, O.; Meeus, I.; Yañez, O.; Straub, L.; Villamar-Bouza, L.; De la Rúa, P.; Jara, L.; Ruiz, C.; Malmstrøm, M.; et al. Honey bees and climate explain viral prevalence in wild bee communities on a continental scale. Sci. Rep. 2022, 12, 1904. [Google Scholar] [CrossRef] [Scilit]
- Loeza-Concha, H.; Salgado-Moreno, S.; Avila-Ramos, F.; Escalera-Valente, F.; Lemus-Flores, C.; Domínguez-Rebolledo, Á.; Carmona-Gasca, C.A. Seasonal variation in the prevalence of Varroa, Nosema and Acarapis in hives from which queen bee mating nuclei are produced. J. Apic. Res. 2020, 59, 558–563. [Google Scholar] [CrossRef] [Scilit]
- Tentcheva, D.; Gauthier, L.; Zappulla, N.; Dainat, B.; Cousserans, F.; Colin, M.E.; Bergoin, M. Prevalence and seasonal variations of six bee viruses in Apis mellifera L. and Varroa destructor mite populations in France. Appl. Environ. Microbiol. 2004, 70, 7185–7191. [Google Scholar] [CrossRef] [Scilit]
- Nordström, S. Distribution of deformed wing virus within honey bee (Apis mellifera) brood cells infested with the ectoparasitic mite Varroa destructor. Exp. Appl. Acarol. 2003, 29, 293–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beaurepaire, A.L.; Krieger, K.J.; Moritz, R.F.A. Seasonal cycle of inbreeding and recombination of the parasitic mite Varroa destructor in honeybee colonies and its implications for the selection of acaricide resistance. Infect. Genet. Evol. 2017, 50, 49–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Natsopoulou, M.E.; McMahon, D.P.; Doublet, V.; Frey, E.; Rosenkranz, P.; Paxton, R.J. The virulent, emerging genotype B of Deformed wing virus is closely linked to overwinter honeybee worker loss. Sci. Rep. 2017, 7, 5242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dainat, B.; Evans, J.D.; Chen, Y.P.; Gauthier, L.; Neumanna, P. Dead or alive: Deformed wing virus and varroa destructor reduce the life span of winter honeybees. Appl. Environ. Microbiol. 2012, 78, 981–987. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Francis, R.M.; Nielsen, S.L.; Kryger, P. Varroa-Virus Interaction in Collapsing Honey Bee Colonies. PLoS ONE 2013, 8, e57540. [Google Scholar] [CrossRef] [Scilit]
- Fearon, M.L.; Tibbetts, E.A. Pollinator community species richness dilutes prevalence of multiple viruses within multiple host species. Ecology 2021, 102, e03305. [Google Scholar] [CrossRef] [Scilit]
- Blanchard, P.; Schurr, F.; Olivier, V.; Celle, O.; Antùnez, K.; Bakonyi, T.; Berthoud, H.; Haubruge, E.; Higes, M.; Kasprzak, S.; et al. Phylogenetic analysis of the RNA-dependent RNA polymerase (RdRp) and a predicted structural protein (pSP) of the Chronic bee paralysis virus (CBPV) isolated from various geographic regions. Virus Res. 2009, 144, 334–338. [Google Scholar] [CrossRef] [Scilit]
- Faucon, J.P.; Mathieu, L.; Ribiere, M.; Martel, A.C.; Drajnudel, P.; Zeggane, S.; Aurieres, C.; Aubert, M.F.A. Honey bee winter mortality in France in 1999 and 2000. Bee World 2015, 83, 14–23. [Google Scholar] [CrossRef] [Scilit]
- Martín-Hernández, R.; Bartolomé, C.; Chejanovsky, N.; Le Conte, Y.; Dalmon, A.; Dussaubat, C.; García-Palencia, P.; Meana, A.; Pinto, M.A.; Soroker, V.; et al. Nosema ceranae in Apis mellifera: A 12 years postdetection perspective. Environ. Microbiol. 2018, 20, 1302–1329. [Google Scholar] [CrossRef] [Scilit]
- Meixner, M.D.; Francis, R.M.; Gajda, A.; Kryger, P.; Andonov, S.; Uzunov, A.; Topolska, G.; Costa, C.; Amiri, E.; Berg, S.; et al. Occurrence of parasites and pathogens in honey bee colonies used in a European genotype-environment interactions experiment. J. Apic. Res. 2015, 53, 215–229. [Google Scholar] [CrossRef] [Scilit]
- Martín-Hernández, R.; Botías, C.; Barrios, L.; Martínez-Salvador, A.; Meana, A.; Mayack, C.; Higes, M. Comparison of the energetic stress associated with experimental Nosema ceranae and Nosema apis infection of honeybees (Apis mellifera). Parasitol. Res. 2011, 109, 605–612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Higes, M.; Martín-Hernández, R.; Meana, A. Nosema ceranae in Europe: An emergent type C nosemosis. Apidologie 2010, 41, 375–392. [Google Scholar] [CrossRef] [Scilit]
- Higes, M.; Martín, R.; Meana, A. Nosema ceranae, a new microsporidian parasite in honeybees in Europe. J. Invertebr. Pathol. 2006, 92, 93–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Traver, B.E.; Williams, M.R.; Fell, R.D. Comparison of within hive sampling and seasonal activity of Nosema ceranae in honey bee colonies. J. Invertebr. Pathol. 2012, 109, 187–193. [Google Scholar] [CrossRef] [Scilit]
- Martín-Hernández, R.; Meana, A.; Prieto, L.; Salvador, A.M.; Garrido-Bailón, E.; Higes, M. Outcome of colonization of Apis mellifera by Nosema ceranae. Appl. Environ. Microbiol. 2007, 73, 6331–6338. [Google Scholar] [CrossRef] [Scilit]
- Emsen, B.; De la Mora, A.; Lacey, B.; Eccles, L.; Kelly, P.G.; Medina-Flores, C.A.; Petukhova, T.; Morfin, N.; Guzman-Novoa, E. Seasonality of Nosema ceranae Infections and Their Relationship with Honey Bee Populations, Food Stores, and Survivorship in a North American Region. Vet. Sci. 2020, 7, 131. [Google Scholar] [CrossRef] [Scilit]
- Copley, T.R.; Jabaji, S.H. Honeybee glands as possible infection reservoirs of Nosema ceranae and Nosema apis in naturally infected forager bees. J. Appl. Microbiol. 2012, 112, 15–24. [Google Scholar] [CrossRef] [Scilit]
- Gisder, S.; Hedtke, K.; Möckel, N.; Frielitz, M.C.; Linde, A.; Genersch, E. Five-year cohort study of nosema spp. in Germany: Does climate shape virulence and assertiveness of nosema ceranae? Appl. Environ. Microbiol. 2010, 76, 3032–3038. [Google Scholar] [CrossRef] [Scilit]
- Nanetti, A.; Bortolotti, L.; Cilia, G. Pathogens Spillover from Honey Bees to Other Arthropods. Pathogens 2021, 10, 1044. [Google Scholar] [CrossRef] [Scilit]
- de Jongh, E.J.; Harper, S.L.; Yamamoto, S.S.; Wright, C.J.; Wilkinson, C.W.; Ghosh, S.; Otto, S.J.G. One Health, One Hive: A scoping review of honey bees, climate change, pollutants, and antimicrobial resistance. PLoS ONE 2022, 17, e0242393. [Google Scholar] [CrossRef] [Scilit]
- Donkersley, P.; Elsner-Adams, E.; Maderson, S. A One-Health Model for Reversing Honeybee (Apis mellifera L.) Decline. Vet. Sci. 2020, 7, 119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilfert, L.; Brown, M.J.F.; Doublet, V. OneHealth implications of infectious diseases of wild and managed bees. J. Invertebr. Pathol. 2021, 186, 107506. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Apiary Code | Province | Municipality | a.s.l. |
|---|---|---|---|
| BOA | Bologna | Valsamoggia | 60 m |
| BOB | Bologna | Valsamoggia | 114 m |
| BOC | Bologna | Sala Bolognese | 13 m |
| BOD | Bologna | Dozza | 89 m |
| BOE | Bologna | Monghidoro | 582 m |
| BOG | Bologna | Sasso Marconi | 155 m |
| FCB | Forlì-Cesena | Cesena | 9 m |
| FCC | Forlì-Cesena | Forlì | 8 m |
| FCD | Forlì-Cesena | Bagno di Romagna | 679 m |
| FCE | Forlì-Cesena | Borghi | 63 m |
| FEA | Ferrara | Ferrara | 7 m |
| FEB | Ferrara | Ferrara | 8 m |
| FEC | Ferrara | Argenta | 8 m |
| MOA | Modena | Formigine | 81 m |
| MOB | Modena | Campogalliano | 26 m |
| PCA | Piacenza | Ziano Piacentino | 298 m |
| PCB | Piacenza | Pontenure | 78 m |
| PCC | Piacenza | Gragnano Trebbiense | 88 m |
| PCD | Piacenza | San Giorgio Piacentino | 323 m |
| PRA | Parma | Parma | 50 m |
| PRB | Parma | Montechiarugolo | 79 m |
| PRC | Parma | Langhirano | 298 m |
| RAA | Ravenna | Casola Valsenio | 204 m |
| RAB | Ravenna | Ravenna | 7 m |
| RAC | Ravenna | Ravenna | 8 m |
| RAD | Ravenna | Lugo | 8 m |
| REA | Reggio Emilia | Novellara | 16 m |
| REB | Reggio Emilia | Campagnola Emilia | 19 m |
| REC | Reggio Emilia | Viano | 433 m |
| RNA | Rimini | Montescudo | 209 m |
| RNB | Rimini | Rimini | 46 m |
| Target | Primer Name | Sequence (3′-5′) | Reference |
|---|---|---|---|
| N. ceranae | Hsp70_F | GGGATTACAAGTGCTTAGAGTGATT | [63] |
| Hsp70_R | TGTCAAGCCCATAAGCAAGTG | ||
| C. mellificae | Cmel_Cyt_b_F | TAAATTCACTACCTCAAATTCAATAACATAATCAT | [64] |
| Cmel_Cyt_b_R | ATTTATTGTTGTAATCGGTTTTATTGGATATGT | ||
| L. passim | Lp_Cyt_b_F | CGAGCTCATAAAATAATGTAAGCAAAATAAG | [64] |
| Lp_Cyt_b_R | TTTTAGCAATATTTTAGCAACAGTACCAG | ||
| C. bombi | Cbom_119Fw | CCAACGGTGAGCCGCATTCAGT | [65] |
| Cbom_119Rv | CGCGTGTCGCCCAGAACATTGA | ||
| KBV | KBV 83F | ACCAGGAAGTATTCCCATGGTAAG | [66] |
| KBV 161R | TGGAGCTATGGTTCCGTTCAG | ||
| DWV | DWV Fw 8450 | TGGCATGCCTTGTTCACCGT | [67] |
| DWV Rev 8953 | CGTGCAGCTCGATAGGATGCCA | ||
| ABPV | APV 95F | TCCTATATCGACGACGAAAGACAA | [66] |
| APV 159R | GCGCTTTAATTCCATCCAATTGA | ||
| CBPV | CPV 304F 79 | TCTGGCTCTGTCTTCGCAAA | [66] |
| CPV 371R | GATACCGTCGTCACCCTCATG |
| Pathogen | PC1 | PC2 |
|---|---|---|
| DWV | 0.152 | 0.653 |
| KBV | −0.181 | −0.2716 |
| ABPV | −0.676 | 0.178 |
| CBPV | −0.673 | 0.219 |
| N. ceranae | 0.184 | 0.649 |
| Eigenvalues | 1.971 | 1.178 |
| Variance explained | 39.43% | 23.55% |
| Pathogen | Test Value | df | p-Value |
|---|---|---|---|
| DWV | 186.16 | 3 | 0.000 |
| KBV | 4.2262 | 3 | 0.238 |
| ABPV | 63.556 | 3 | 0.000 |
| CBPV | 31.852 | 3 | 0.000 |
| N. ceranae | 21.312 | 3 | 0.000 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cilia, G.; Tafi, E.; Zavatta, L.; Caringi, V.; Nanetti, A. The Epidemiological Situation of the Managed Honey Bee (Apis mellifera) Colonies in the Italian Region Emilia-Romagna. Vet. Sci. 2022, 9, 437. https://doi.org/10.3390/vetsci9080437
Cilia G, Tafi E, Zavatta L, Caringi V, Nanetti A. The Epidemiological Situation of the Managed Honey Bee (Apis mellifera) Colonies in the Italian Region Emilia-Romagna. Veterinary Sciences. 2022; 9(8):437. https://doi.org/10.3390/vetsci9080437
Chicago/Turabian StyleCilia, Giovanni, Elena Tafi, Laura Zavatta, Valeria Caringi, and Antonio Nanetti. 2022. "The Epidemiological Situation of the Managed Honey Bee (Apis mellifera) Colonies in the Italian Region Emilia-Romagna" Veterinary Sciences 9, no. 8: 437. https://doi.org/10.3390/vetsci9080437
APA StyleCilia, G., Tafi, E., Zavatta, L., Caringi, V., & Nanetti, A. (2022). The Epidemiological Situation of the Managed Honey Bee (Apis mellifera) Colonies in the Italian Region Emilia-Romagna. Veterinary Sciences, 9(8), 437. https://doi.org/10.3390/vetsci9080437

