Investigation of Off-Season Breeding Effects on Egg-Laying Performance, Serum Biochemical Parameters, and Reproductive Hormones in Zhedong White
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Sample Selection
2.3. Experimental Period
2.4. Implementation of Off-Season Breeding Strategy
2.5. Detection of Serum Biochemical Indicators
2.6. Examination of the Content of Serum Hormone E2, P4, FSH, LH, PRL, and T4
2.7. Examination of the Gene Expression of Hypothalamus, Ovary Tissues FSH, LH, PRL, GnRH, and VIP
2.8. Data Statistics and Analysis
3. Results
3.1. Effect of Breeding Season on the Reproductive Performance of Eastern Zhejiang White Geese
3.2. Effect of Breeding Season on Production Performance of Zhedong White Geese
3.3. Effects of Breeding Season on Serum Biochemical Indexes of Zhedong White Geese
3.4. Effects of Breeding Season on Serum Levels of Reproductive Hormones in Zhedong White Geese
3.5. Effects of Breeding Season on the Expression of Hormone-Related Genes in Eastern Zhejiang White Geese
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Yan, X.; Xu, Y.; Zhen, Z.; Li, J.; Zheng, H.; Li, S.; Hu, Q.; Ye, P. Slaughter performance of the main goose breeds raised commercially in China and nutritional value of the meats of the goose breeds: A systematic review. J. Sci. Food Agric. 2023, 103, 3748–3760. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wang, L.; Zhang, Y.; Yao, Y.; Zhao, W.; Xu, Q.; Chen, G. Characterization of ovarian morphology and reproductive hormones in Zhedong white geese (Anser cygnoides domesticus) during the reproductive cycle. J. Anim. Physiol. Anim. Nutr. 2021, 105, 938–945. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Guo, Z.; Zhao, X.; Sun, J.; Yue, S.; Li, M.; Chen, Z.; Ma, Z.; Zhao, H. Whole Genome Resequencing Identifies Single-Nucleotide Polymorphism Markers of Growth and Reproduction Traits in Zhedong and Zi Crossbred Geese. Genes 2023, 14, 487. [Google Scholar] [CrossRef]
- Chen, L.; Liu, K.; Zhao, Z.; Blair, H.T.; Zhang, P.; Li, D.; Ma, R.Z. Identification of sheep ovary genes potentially associated with off-season reproduction. J. Genet. Genom. = Yi Chuan Xue Bao 2012, 39, 181–190. [Google Scholar] [CrossRef]
- Hu, M.; Jin, H.; Wu, J.; Zhou, X.; Yang, S.; Zhao, A.; Wang, H. Identification of the differentially expressed genes in the leg muscles of Zhedong white geese (Anser cygnoides) reared under different photoperiods. Poult. Sci. 2022, 101, 102193. [Google Scholar] [CrossRef]
- Zhu, H.; Shao, X.; Chen, Z.; Wei, C.; Lei, M.; Ying, S.; Yu, J.; Shi, Z. Induction of out-of-season egg laying by artificial photoperiod in Yangzhou geese and the associated endocrine and molecular regulation mechanisms. Anim. Reprod. Sci. 2017, 180, 127–136. [Google Scholar] [CrossRef] [PubMed]
- Bacon, W.L. The effect of heparin injection on laying turkey hen very-low density lipoprotein metabolism in sexually immature and laying turkey hens. Comp. Biochem. Physiol. Part A Physiol. 1994, 109, 391–402. [Google Scholar] [CrossRef]
- Yang, W.; Lang, X.; Song, D.; Xu, H.; Zhang, C.; Guo, L.; Chen, X. Comparative analysis of reproductive hormones, serum biochemical indexes and ovarian metabolites in Muscovy breeder duck at different laying stages. Poult. Sci. 2024, 103, 104370. [Google Scholar] [CrossRef]
- Han, G.P.; Kim, J.H.; Kim, J.M.; Kil, D.Y. Transcriptomic analysis of the liver in aged laying hens with different eggshell strength. Poult. Sci. 2023, 102, 102217. [Google Scholar] [CrossRef] [PubMed]
- Bédécarrats, G.Y.; Baxter, M.; Sparling, B. An updated model to describe the neuroendocrine control of reproduction in chickens. Gen. Comp. Endocrinol. 2016, 227, 58–63. [Google Scholar] [CrossRef] [PubMed]
- Nakane, Y.; Yoshimura, T. Deep brain photoreceptors and a seasonal signal transduction cascade in birds. Cell Tissue Res 2010, 342, 341–344. [Google Scholar] [CrossRef]
- Martinez, E.; Martorell, J.; Riambau, V. Review of serum biomarkers in carotid atherosclerosis. J. Vasc. Surg 2020, 71, 329–341. [Google Scholar] [CrossRef]
- Qi, J.; Liu, H.; Zhou, Z.; Jiang, Y.; Fan, W.; Hu, J.; Li, J.; Guo, Z.; Xie, M.; Huang, W.; et al. Genome-wide association study identifies multiple loci influencing duck serum biochemical indicators in the laying period. Br. Poult. Sci. 2024, 65, 8–18. [Google Scholar] [CrossRef] [PubMed]
- Qu, D.; Zhou, X.; Yang, F.; Tian, S.; Zhang, X.; Ma, L.; Han, J. Development of class model based on blood biochemical parameters as a diagnostic tool of PSE meat. Meat Sci. 2017, 128, 24–29. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.J.; Chen, Z.F.; Zhao, X.H.; Li, M.Y.; Guo, Z.H. Meta-analysis: Supplementary artificial light and goose reproduction. Anim. Reprod. Sci. 2020, 214, 106278. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.M.; Chen, L.R.; Lee, S.R.; Jea, Y.S.; Kao, J.Y. Supplementary artificial light to increase egg production of geese under natural lighting conditions. Anim. Reprod. Sci. 2009, 113, 317–321. [Google Scholar] [CrossRef]
- El-Naggar, K.; El-Kassas, S.; Abdo, S.E.; Kirrella, A.A.K.; Al Wakeel, R.A. Role of gamma-aminobutyric acid in regulating feed intake in commercial broilers reared under normal and heat stress conditions. J. Therm. Biol. 2019, 84, 164–175. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Chen, R.; Wang, T.; Ding, Y.; Zhang, Y.; Huang, G.; Huang, J.; Qu, Q.; Lv, W.; Guo, S. Dietary Chinese herbal mixture supplementation improves production performance by regulating reproductive hormones, antioxidant capacity, immunity, and intestinal health of broiler breeders. Poult. Sci. 2024, 103, 103201. [Google Scholar] [CrossRef] [PubMed]
- Fleming, R.H. Nutritional factors affecting poultry bone health. Proc. Nutr. Soc. 2008, 67, 177–183. [Google Scholar] [CrossRef]
- Sinclair-Black, M.; Garcia, R.A.; Ellestad, L.E. Physiological regulation of calcium and phosphorus utilization in laying hens. Front. Physiol. 2023, 14, 1112499. [Google Scholar] [CrossRef]
- Cardoso, E.F.; Donzele, J.L.; de Oliveira Donzele, R.F.M.; Sufiate, B.L.; Silva, A.D.; Tizziani, T. Non-phytate phosphorus requirement for broilers from 8 to 21 days of age under heat stress conditions. Trop. Anim. Health Prod. 2018, 50, 317–325. [Google Scholar] [CrossRef] [PubMed]
- Alagawany, M.; Ashour, E.A.; El-Kholy, M.S.; Mohamed, L.A.; Abd El-Hack, M.E. Effect of dietary calcium and phosphorus levels on growth, carcass characteristics and liver and kidney functions of growing Egyptian geese. Poult. Sci. 2021, 100, 101244. [Google Scholar] [CrossRef]
- Anton, M. Egg yolk: Structures, functionalities and processes. J. Sci. Food Agric. 2013, 93, 2871–2880. [Google Scholar] [CrossRef]
- Kuzmenko, N.V.; Shchegolev, B.F. Dependence of Seasonal Dynamics in Healthy People’s Circulating Lipids and Carbohydrates on Regional Climate: Meta-Analysis. Indian J. Clin. Biochem. IJCB 2022, 37, 381–398. [Google Scholar] [CrossRef] [PubMed]
- Nematbakhsh, S.; Pei Pei, C.; Selamat, J.; Nordin, N.; Idris, L.H.; Abdull Razis, A.F. Molecular Regulation of Lipogenesis, Adipogenesis and Fat Deposition in Chicken. Genes 2021, 12, 414. [Google Scholar] [CrossRef] [PubMed]
- Mourot, J.; Guy, G.; Lagarrigue, S.; Peiniau, P.; Hermier, D. Role of hepatic lipogenesis in the susceptibility to fatty liver in the goose (Anser anser). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2000, 126, 81–87. [Google Scholar] [CrossRef] [PubMed]
- Tanabe, Y.; Ogawa, T.; Nakamura, T. The effect of short-term starvation on pituitary and plasma LH, plasma estradiol and progesterone, and on pituitary response to LH-RH in the laying hen (Gallus domesticus). Gen. Comp. Endocrinol. 1981, 43, 392–398. [Google Scholar] [CrossRef]
- Enemor, V.H.; Anosike, J.C.; Nwoke, B.E.; Chikezie, P.C. Serum aminotransferases and bilirubin levels in malaria patients. Int. J. Nat. Appl. Sci. 2005, 1, 85–89. [Google Scholar] [CrossRef]
- Tao, J. Comparative Analysis of Nutrient Digestibility and Serum Biochemical Indexes among Different Goose Breeds. Life Sci 2015, 35, 178–186. [Google Scholar]
- Kang, B. Blood biochemical indexes of northeast white goose and seed goose. Chin. Vet. J. 2006, 79, 649–652. [Google Scholar]
- Lin, B.; Zhou, X.; Jiang, D.; Shen, X.; Ouyang, H.; Li, W.; Xu, D.; Fang, L.; Tian, Y.; Li, X.; et al. Comparative transcriptomic analysis reveals candidate genes for seasonal breeding in the male Lion-Head goose. Br. Poult. Sci. 2023, 64, 157–163. [Google Scholar] [CrossRef] [PubMed]
- Mansour, A.H.; Rabie, M.H.; El-Said, E.A.; Abo El-Maaty, H.M. Interactive effects of dietary protein and nano-chitosan on growth performance, immune response, and histological aspects of lymphoid organs in broiler chickens. Trop. Anim. Health Prod. 2024, 56, 62. [Google Scholar] [CrossRef]
- Sharp, P.J. Strategies in avian breeding cycles. Anim. Reprod. Sci. 1996, 42, 505–513. [Google Scholar] [CrossRef]
- Ono, H.; Nakao, N.; Yamamura, T.; Kinoshita, K.; Mizutani, M.; Namikawa, T.; Iigo, M.; Ebihara, S.; Yoshimura, T. Red jungle fowl (Gallus gallus) as a model for studying the molecular mechanism of seasonal reproduction. Anim. Sci. J. = Nihon Chikusan Gakkaiho 2009, 80, 328–332. [Google Scholar] [CrossRef] [PubMed]
- Dunn, I.C.; Beattie, K.K.; Maney, D.; Sang, H.M.; Talbot, R.T.; Wilson, P.W.; Sharp, P.J. Regulation of chicken gonadotropin-releasing hormone-I mRNA in incubating, nest-deprived and laying bantam hens. Neuroendocrinology 1996, 63, 504–513. [Google Scholar] [CrossRef]
- Bédécarrats, G.Y.; McFarlane, H.; Maddineni, S.R.; Ramachandran, R. Gonadotropin-inhibitory hormone receptor signaling and its impact on reproduction in chickens. Gen. Comp. Endocrinol. 2009, 163, 7–11. [Google Scholar] [CrossRef]
- Yang, H.M.; Wang, Y.; Wang, Z.Y.; Wang, X.X. Seasonal and photoperiodic regulation of reproductive hormones and related genes in Yangzhou geese. Poult. Sci. 2017, 96, 486–490. [Google Scholar] [CrossRef] [PubMed]
- Gumułka, M.; Avital-Cohen, N.; Rozenboim, I. Determination of Annual Plasma Hormone Levels Associated with Reproduction in Long-Day Breeding Domestic Geese. Animals 2021, 11, 2363. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Jin, T.; Yang, K.; Liu, X.; Ren, M.; She, D.; Hu, Q.; Li, S. The hematopoietic function, histological characteristics, and transcriptome profiling of Wanxi white geese ovary during nesting and late-laying stages. Poult. Sci. 2025, 104, 104764. [Google Scholar] [CrossRef]
- Pond, W.G.; Yen, J.T.; Mersmann, H.J. Effect of severe dietary protein, nonprotein calories or feed restriction during gestation on postnatal growth of progeny in swine. Growth 1987, 51, 355–371. [Google Scholar] [PubMed]
- Liu, J.; Fu, Y.; Zhou, S.; Zhao, P.; Zhao, J.; Yang, Q.; Wu, H.; Ding, M.; Li, Y. Comparison of the effect of quercetin and daidzein on production performance, anti-oxidation, hormones, and cecal microflora in laying hens during the late laying period. Poult. Sci. 2023, 102, 102674. [Google Scholar] [CrossRef] [PubMed]
- Hull, K.L.; Harvey, S. Growth hormone: Roles in female reproduction. J. Endocrinol. 2001, 168, 1–23. [Google Scholar] [CrossRef] [PubMed]
- Hull, K.L.; Harvey, S. Growth hormone: A reproductive endocrine-paracrine regulator? Rev. Reprod. 2000, 5, 175–182. [Google Scholar] [CrossRef]
- Lien, R.J.; Siopes, T.D. Effects of thyroidectomy on egg production, molt, and plasma thyroid hormone concentrations of turkey hens. Poult. Sci. 1989, 68, 1126–1132. [Google Scholar] [CrossRef]
- Rose, E.M.; Haakenson, C.M.; Ball, G.F. Sex differences in seasonal brain plasticity and the neuroendocrine regulation of vocal behavior in songbirds. Horm. Behav. 2022, 142, 105160. [Google Scholar] [CrossRef]
- Gumułka, M.; Hrabia, A.; Avital-Cohen, N.; Andres, K.; Rozenboim, I. The effect of parachlorophenylalanine treatment on the activity of gonadal and lactotrophic axes in native Polish crested chickens stimulated to broodiness. Poult. Sci. 2020, 99, 2708–2717. [Google Scholar] [CrossRef] [PubMed]
- Avital-Cohen, N.; Heiblum, R.; Argov, N.; Rosenstrauch, A.; Chaiseha, Y.; Mobarkey, N.; Rozenboim, I. The effect of active immunization against vasoactive intestinal peptide (VIP) and inhibin on reproductive performance of aging White Leghorn roosters. Poult. Sci. 2012, 91, 161–174. [Google Scholar] [CrossRef]
Type of Raw Material | Concentrated Feed | Roughage Feed |
---|---|---|
Corn (%) | 48 | 24 |
Barley (%) | 30 | 15 |
Bran (%) | 5 | 8.5 |
Soybean meal (%) | 12 | 6 |
Rice chaff (%) | 2 | 45 |
Premix feed (%) | 3 | 1.5 |
Salt (%) | 0.3 | 0.3 |
Gene Name | Primer Sequence |
---|---|
β-actin | F: TGACGCAGATCATGTTTGAGA R: GCAGAGCGTAGCCCTCATAG |
GnRH | F: CTGGGACCCTTGCTGTTTTG R: AGGGGACTTCCAACCATCAC |
VIP | F: ACCAGTGTCTACAGCCATCTTTTG R: AGGTGGCTCAGCAGTTCATCTACA |
FSH | F: GTGGTGCTCAGGATACTGCTTCA R: GTGCAGTTCAGTGCTATCAGTGTCA |
LH | F: GACCCGGGAACCGGTGTA R: AGCAGCCACCGCTCGTAG |
PRL | F: TGCTCAGGGTCGGGGTTTCA R: GCTTGGAGTCCTCATCGGCAAGTT |
Project Types | Control | Out of Season Breeding Group |
---|---|---|
Egg Production (Pieces) | 31,537 | 30,496 |
Average Egg Production (Pieces) | 31.54 | 30.50 |
Fertilized Egg (Pieces) | 24,942 | 24,600 |
Number of spawn (Number) | 21,788 | 21,473 |
Stillborn Egg (Pieces) | 2065 | 2053 |
Loss of Goose Seeding (Number) | 1089 | 1074 |
Hatching Rate of Eggs (%) | 79.08 | 80.66 |
Hatching Rate of Fertilized Eggs (%) | 69.09 | 70.04 |
Still Birth Rate (%) | 87.35 | 87.28 |
Total Sales Amount of Goose Seeding (%) | 8.28 | 8.35 |
Total Sales Amount of Goose Seeding (RMB) | 491,170 | 526,702 |
The Economic Benefic of The Average Goose (RMB) | 491.17 | 526.70 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, J.; Ma, Y.; Ali, W.; Yu, R.; Zou, H.; Liu, Z. Investigation of Off-Season Breeding Effects on Egg-Laying Performance, Serum Biochemical Parameters, and Reproductive Hormones in Zhedong White. Vet. Sci. 2025, 12, 179. https://doi.org/10.3390/vetsci12020179
Zhu J, Ma Y, Ali W, Yu R, Zou H, Liu Z. Investigation of Off-Season Breeding Effects on Egg-Laying Performance, Serum Biochemical Parameters, and Reproductive Hormones in Zhedong White. Veterinary Sciences. 2025; 12(2):179. https://doi.org/10.3390/vetsci12020179
Chicago/Turabian StyleZhu, Jiaqiao, Yonggang Ma, Waseem Ali, Rui Yu, Hui Zou, and Zongping Liu. 2025. "Investigation of Off-Season Breeding Effects on Egg-Laying Performance, Serum Biochemical Parameters, and Reproductive Hormones in Zhedong White" Veterinary Sciences 12, no. 2: 179. https://doi.org/10.3390/vetsci12020179
APA StyleZhu, J., Ma, Y., Ali, W., Yu, R., Zou, H., & Liu, Z. (2025). Investigation of Off-Season Breeding Effects on Egg-Laying Performance, Serum Biochemical Parameters, and Reproductive Hormones in Zhedong White. Veterinary Sciences, 12(2), 179. https://doi.org/10.3390/vetsci12020179