Epigenetic Factor MicroRNAs Likely Mediate Vaccine Protection Efficacy against Lymphomas in Response to Tumor Virus Infection in Chickens through Target Gene Involved Signaling Pathways
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and a Vaccination-Challenge Trial
2.2. Extraction of Total RNA Samples
2.3. Small RNA Sequencing
2.4. Data Analyses of Small RNA_Seq Reads
2.5. Validation of the Small RNA Sequence Reads Data by Droplet Digital PCR
2.6. Identification of Differentially Expressed miRNAs and GO Terms Enrichment
3. Results
3.1. Small RNA Sequence Reads, Reads Quality, and Deposition to NCBI
3.2. Validation of the Small RNA Sequence Reads Data by ddPCR
3.3. MicroRNA Profiles of the Chicken Line by Vaccine Treatment Groups
3.4. Differentially Expressed miRNAs between Treatment Groups
3.4.1. Differentially Expressed miRNAs in Response to HVT Vaccination Followed by vv+MDV Challenge in the Line 63 and 72 Chickens
3.4.2. Differentially Expressed miRNAs in Response to CVI988/Rispens Vaccination Followed by vv+MDV Challenge in the Line 63 and 72 Chickens
3.4.3. Differentially Expressed miRNAs between CVI988/Rispens and HVT Vaccination Groups Followed by vv+MDV Challenge within Each Line of Chickens
3.4.4. Differentially Expressed miRNAs between Line 63 and Line 72 Chickens within HVT or CVI988/Rispens Vaccination Followed by vv+MDV Challenge
3.5. Gene Ontology (GO) Terms Enrichment of Predicted Target Genes of the Differentially Expressed miRNAs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lockwood, L.; Miller, B.; Youssef, N.A. Epigenetics and first-episode psychosis: A systematic review. Psychiatry Res. 2022, 307, 114325. [Google Scholar] [CrossRef] [Scilit]
- Schmitz, R.J.; Mittelsten Scheid, O. Editorial overview: COPB issue 2022 on “epigenetics and gene regulation”. Curr. Opin. Plant Biol. 2022, 70, 102305. [Google Scholar] [CrossRef] [Scilit]
- Fol, M.; Wlodarczyk, M.; Druszczynska, M. Host Epigenetics in Intracellular Pathogen Infections. Int. J. Mol. Sci. 2020, 21, 4573. [Google Scholar] [CrossRef] [Scilit]
- Youngblood, B.; Hale, J.S.; Akondy, R. Using epigenetics to define vaccine-induced memory T cells. Curr. Opin. Virol. 2013, 3, 371–376. [Google Scholar] [CrossRef] [Scilit]
- Ochando, J.; Mulder, W.J.M.; Madsen, J.C.; Netea, M.G.; Duivenvoorden, R. Trained immunity—Basic concepts and contributions to immunopathology. Nat. Rev. Nephrol. 2023, 19, 23–37. [Google Scholar] [CrossRef] [Scilit]
- Zhu, X.; Xu, Z.; Li, B. Editorial: Epigenetics in cancer: Mechanisms and drug development-volume II. Front. Genet. 2023, 14, 1242960. [Google Scholar] [CrossRef] [Scilit]
- Martino, E.; D’Onofrio, N.; Anastasio, C.; Abate, M.; Zappavigna, S.; Caraglia, M.; Balestrieri, M.L. MicroRNA-nanoparticles against cancer: Opportunities and challenges for personalized medicine. Mol. Ther. Nucleic Acids 2023, 32, 371–384. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Lian, L.; Zhang, D.; Qu, L.; Yang, N. gga-miR-26a targets NEK6 and suppresses Marek’s disease lymphoma cell proliferation. Poult. Sci. 2014, 93, 1097–1105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, H.; Yao, Y.; Smith, L.P.; Nair, V. MicroRNA-26a-mediated regulation of interleukin-2 expression in transformed avian lymphocyte lines. Cancer Cell Int. 2010, 10, 15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ben-Nathan, D.; Lustig, S. Production of Marek’s disease vaccine. Adv. Biotechnol. Process. 1990, 14, 347–365. [Google Scholar]
- Biggs, P.M.; Nair, V. The long view: 40 years of Marek’s disease research and Avian Pathology. Avian Pathol. 2012, 41, 3–9. [Google Scholar] [CrossRef] [Scilit]
- Davison, F.; Nair, V. Use of Marek’s disease vaccines: Could they be driving the virus to increasing virulence? Expert. Rev. Vaccines 2005, 4, 77–88. [Google Scholar] [CrossRef] [Scilit]
- Parvizi, P.; Abdul-Careem, M.F.; Haq, K.; Thanthrige-Don, N.; Schat, K.A.; Sharif, S. Immune responses against Marek’s disease virus. Anim. Health Res. Rev. 2010, 11, 123–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, J.; Sadeyen, J.R.; Paton, I.R.; Hocking, P.M.; Salmon, N.; Fife, M.; Nair, V.; Burt, D.W.; Kaiser, P. Systems analysis of immune responses in Marek’s disease virus-infected chickens identifies a gene involved in susceptibility and highlights a possible novel pathogenicity mechanism. J. Virol. 2011, 85, 11146–11158. [Google Scholar] [CrossRef] [Scilit]
- Gimeno, I.M. Marek’s disease vaccines: A solution for today but a worry for tomorrow? Vaccine 2008, 26 (Suppl. S3), C31–C41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, L.F.; Zhang, H.; Heidari, M.; Lupiani, B.; Reddy, S.M. Evaluation of factors affecting vaccine efficacy of recombinant Marek’s disease virus lacking the Meq oncogene in chickens. Avian Dis. 2011, 55, 172–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, S.; Dunn, J.R.; Heidari, M.; Lee, L.F.; Song, J.; Ernst, C.W.; Ding, Z.; Bacon, L.D.; Zhang, H. Genetics and vaccine efficacy: Host genetic variation affecting Marek’s disease vaccine efficacy in White Leghorn chickens. Poult. Sci. 2010, 89, 2083–2091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bacon, L.D.; Crittenden, L.B.; Witter, R.L.; Fadly, A.; Motta, J. B5 and B15 associated with progressive Marek’s disease, Rous sarcoma, and avian leukosis virus-induced tumors in inbred 15I4 chickens. Poult. Sci. 1983, 62, 573–578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bacon, L.D.; Hunt, H.D.; Cheng, H.H. Genetic resistance to Marek’s disease. Curr. Top. Microbiol. Immunol. 2001, 255, 121–141. [Google Scholar] [CrossRef] [Scilit]
- Bacon, L.D.; Witter, R.L.; Crittenden, L.B.; Fadly, A.; Motta, J. B-haplotype influence on Marek’s disease, Rous sarcoma, and lymphoid leukosis virus-induced tumors in chickens. Poult. Sci. 1981, 60, 1132–1139. [Google Scholar] [CrossRef] [Scilit]
- Briles, W.E.; Briles, R.W.; Pollock, D.L.; Pattison, M. Marek’s disease resistance of B (MHC) heterozygotes in a cross of purebred Leghorn lines. Poult. Sci. 1982, 61, 205–211. [Google Scholar] [CrossRef] [Scilit]
- Gao, C.; Han, L.; Han, J.; Liu, J.; Jiang, Q.; Guo, D.; Qu, L. Establishment of six homozygous MHC-B haplotype populations associated with susceptibility to Marek’s disease in Chinese specific pathogen-free BWEL chickens. Infect. Genet. Evol. 2015, 29, 15–25. [Google Scholar] [CrossRef] [Scilit]
- Kaufman, J.; Wallny, H.J. Chicken MHC molecules, disease resistance and the evolutionary origin of birds. Curr. Top. Microbiol. Immunol. 1996, 212, 129–141. [Google Scholar] [CrossRef] [Scilit]
- Vallejo, R.L.; Bacon, L.D.; Liu, H.C.; Witter, R.L.; Groenen, M.A.; Hillel, J.; Cheng, H.H. Genetic mapping of quantitative trait loci affecting susceptibility to Marek’s disease virus induced tumors in F2 intercross chickens. Genetics 1998, 148, 349–360. [Google Scholar] [CrossRef] [Scilit]
- Yonash, N.; Bacon, L.D.; Witter, R.L.; Cheng, H.H. High resolution mapping and identification of new quantitative trait loci (QTL) affecting susceptibility to Marek’s disease. Anim. Genet. 1999, 30, 126–135. [Google Scholar] [CrossRef] [Scilit]
- Heifetz, E.M.; Fulton, J.E.; O’Sullivan, N.P.; Arthur, J.A.; Cheng, H.; Wang, J.; Soller, M.; Dekkers, J. Mapping QTL affecting resistance to Marek’s disease in an F6 advanced intercross population of commercial layer chickens. BMC Genom. 2009, 10, 20. [Google Scholar] [CrossRef] [Scilit]
- Luo, J.; Yu, Y.; Mitra, A.; Chang, S.; Zhang, H.; Liu, G.; Yang, N.; Song, J. Genome-wide copy number variant analysis in inbred chickens lines with different susceptibility to Marek’s disease. G3 (Bethesda) 2013, 3, 217–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, Y.; Yang, N.; Cheng, H.H.; Song, J.; Qu, L. Genome-wide identification of copy number variations between two chicken lines that differ in genetic resistance to Marek’s disease. BMC Genom. 2015, 16, 843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.; He, Y.; Ding, Y.; Sun, G.; Carrillo, J.A.; Li, Y.; Ghaly, M.M.; Ma, L.; Zhang, H.; Liu, G.E.; et al. Characterization of Copy Number Variation’s Potential Role in Marek’s Disease. Int. J. Mol. Sci. 2017, 18, 1020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Emara, M.G.; Kim, H. Genetic markers and their application in poultry breeding. Poult. Sci. 2003, 82, 952–957. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, D.F.; Lian, L.; Qu, L.J.; Chen, Y.M.; Liu, W.B.; Chen, S.R.; Zheng, J.X.; Xu, G.Y.; Yang, N. A genome-wide SNP scan reveals two loci associated with the chicken resistance to Marek’s disease. Anim. Genet. 2013, 44, 217–222. [Google Scholar] [CrossRef] [Scilit]
- Wolc, A.; Arango, J.; Jankowski, T.; Settar, P.; Fulton, J.E.; O’Sullivan, N.P.; Fernando, R.; Garrick, D.J.; Dekkers, J.C. Genome-wide association study for Marek’s disease mortality in layer chickens. Avian Dis. 2013, 57, 395–400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fulton, J.E.; Arango, J.; Ali, R.A.; Bohorquez, E.B.; Lund, A.R.; Ashwell, C.M.; Settar, P.; O’Sullivan, N.P.; Koci, M.D. Genetic variation within the Mx gene of commercially selected chicken lines reveals multiple haplotypes, recombination and a protein under selection pressure. PLoS ONE 2014, 9, e108054. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perumbakkam, S.; Muir, W.M.; Black-Pyrkosz, A.; Okimoto, R.; Cheng, H.H. Comparison and contrast of genes and biological pathways responding to Marek’s disease virus infection using allele-specific expression and differential expression in broiler and layer chickens. BMC Genom. 2013, 14, 64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, Y.H.; Dinh, H.; Lillehoj, H.S.; Song, K.D.; Oh, J.D. Differential regulation of microRNA transcriptome in chicken lines resistant and susceptible to necrotic enteritis disease. Poult. Sci. 2014, 93, 1383–1395. [Google Scholar] [CrossRef] [Scilit]
- Truong, A.D.; Rengaraj, D.; Hong, Y.; Hoang, C.T.; Hong, Y.H.; Lillehoj, H.S. Differentially expressed JAK-STAT signaling pathway genes and target microRNAs in the spleen of necrotic enteritis-afflicted chicken lines. Res. Vet. Sci. 2017, 115, 235–243. [Google Scholar] [CrossRef] [Scilit]
- Andersen, G.B.; Tost, J. Circulating miRNAs as Biomarker in Cancer. Recent Results Cancer Res. 2020, 215, 277–298. [Google Scholar] [CrossRef] [Scilit]
- Baharudin, R.; Tieng, F.Y.F.; Lee, L.H.; Ab Mutalib, N.S. Epigenetics of SFRP1: The Dual Roles in Human Cancers. Cancers (Basel) 2020, 12, 445. [Google Scholar] [CrossRef] [Scilit]
- Citron, F.; Fabris, L. Targeting Epigenetic Dependencies in Solid Tumors: Evolutionary Landscape Beyond Germ Layers Origin. Cancers 2020, 12, 682. [Google Scholar] [CrossRef] [Scilit]
- Hu, Y.; Wang, S.; Liu, J.; Huang, Y.; Gong, C.; Liu, J.; Xiao, Y.; Yang, S. New sights in cancer: Component and function of N6-methyladenosine modification. Biomed. Pharmacother. 2020, 122, 109694. [Google Scholar] [CrossRef] [Scilit]
- Xu, R.; Li, S.; Guo, S.; Zhao, Q.; Abramson, M.J.; Li, S.; Guo, Y. Environmental temperature and human epigenetic modifications: A systematic review. Environ. Pollut. 2020, 259, 113840. [Google Scholar] [CrossRef] [Scilit]
- Luo, J.; Yu, Y.; Zhang, H.; Tian, F.; Chang, S.; Cheng, H.H.; Song, J. Down-regulation of promoter methylation level of CD4 gene after MDV infection in MD-susceptible chicken line. BMC Proc. 2011, 5 (Suppl. S4), S7. [Google Scholar] [CrossRef] [Scilit]
- Luo, J.; Yu, Y.; Chang, S.; Tian, F.; Zhang, H.; Song, J. DNA Methylation Fluctuation Induced by Virus Infection Differs between MD-resistant and -susceptible Chickens. Front. Genet. 2012, 3, 20. [Google Scholar] [CrossRef] [Scilit]
- Mitra, A.; Luo, J.; Zhang, H.; Cui, K.; Zhao, K.; Song, J. Marek’s disease virus infection induces widespread differential chromatin marks in inbred chicken lines. BMC Genom. 2012, 13, 557. [Google Scholar] [CrossRef] [Scilit]
- Luo, J.; Chang, S.; Zhang, H.; Li, B.; Song, J. DNA methylation down-regulates EGFR expression in chickens. Avian Dis. 2013, 57, 366–371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, K.; Lian, L.; Yang, N.; Qu, L. Temporal expression and DNA hypomethylation profile of CD30 in Marek’s disease virus-infected chicken spleens. Poult. Sci. 2015, 94, 1165–1169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, C.; Li, X.; Han, B.; Qu, L.; Liu, C.; Song, J.; Lian, L.; Yang, N. Gga-miR-130b-3p inhibits MSB1 cell proliferation, migration, invasion, and its downregulation in MD tumor is attributed to hypermethylation. Oncotarget 2018, 9, 24187–24198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- You, Z.; Zhang, Q.; Liu, C.; Song, J.; Yang, N.; Lian, L. Integrated analysis of lncRNA and mRNA repertoires in Marek’s disease infected spleens identifies genes relevant to resistance. BMC Genom. 2019, 20, 245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marcho, C.; Oluwayiose, O.A.; Pilsner, J.R. The preconception environment and sperm epigenetics. Andrology 2020, 8, 924–942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, J.; Mitra, A.; Tian, F.; Chang, S.; Zhang, H.; Cui, K.; Yu, Y.; Zhao, K.; Song, J. Histone methylation analysis and pathway predictions in chickens after MDV infection. PLoS ONE 2012, 7, e41849. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mitra, A.; Luo, J.; He, Y.; Gu, Y.; Zhang, H.; Zhao, K.; Cui, K.; Song, J. Histone modifications induced by MDV infection at early cytolytic and latency phases. BMC Genom. 2015, 16, 311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mirzaei, H.; Ghorbani, S.; Khanizadeh, S.; Namdari, H.; Faghihloo, E.; Akbari, A. Histone deacetylases in virus-associated cancers. Rev. Med. Virol. 2020, 30, e2085. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, L.H.; Goel, A.; Chung, D.C. Pathways of Colorectal Carcinogenesis. Gastroenterology 2020, 158, 291–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.; Qu, L.; Xu, G.; Lian, L.; Zheng, J.; Yang, N. Hypomethylation upregulates the expression of CD30 in lymphoma induced by Marek’s disease virus. Poult. Sci. 2012, 91, 1610–1618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, S.; Shi, J.; Sun, D.; Lyu, L. Current insight into the roles of microRNA in vitiligo. Mol. Biol. Rep. 2020, 47, 3211–3219. [Google Scholar] [CrossRef] [Scilit]
- Allen, L.; Dwivedi, Y. MicroRNA mediators of early life stress vulnerability to depression and suicidal behavior. Mol. Psychiatry 2020, 25, 308–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Meter, E.N.; Onyango, J.A.; Teske, K.A. A review of currently identified small molecule modulators of microRNA function. Eur. J. Med. Chem. 2020, 188, 112008. [Google Scholar] [CrossRef] [Scilit]
- Stik, G.; Dambrine, G.; Pfeffer, S.; Rasschaert, D. The oncogenic microRNA OncomiR-21 overexpressed during Marek’s disease lymphomagenesis is transactivated by the viral oncoprotein Meq. J. Virol. 2013, 87, 80–93. [Google Scholar] [CrossRef] [Scilit]
- Bacon, L.D.; Hunt, H.D.; Cheng, H.H. A review of the development of chicken lines to resolve genes determining resistance to diseases. Poult. Sci. 2000, 79, 1082–1093. [Google Scholar] [CrossRef] [Scilit]
- Heidari, M.; Zhang, L.; Zhang, H. MicroRNA profiling in the bursae of Marek’s disease virus-infected resistant and susceptible chicken lines. Genomics 2020, 112, 2564–2571. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Zhu, C.; Heidari, M.; Dong, K.; Chang, S.; Xie, Q.; Zhang, H. Marek’s disease vaccines-induced differential expression of known and novel microRNAs in primary lymphoid organ bursae of White Leghorn. Vet. Res. 2020, 51, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- An, J.; Lai, J.; Lehman, M.L.; Nelson, C.C. miRDeep*: An integrated application tool for miRNA identification from RNA sequencing data. Nucleic Acids Res. 2013, 41, 727–737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balcells, I.; Cirera, S.; Busk, P.K. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers. BMC Biotechnol 2011, 11, 70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reimand, J.; Kull, M.; Peterson, H.; Hansen, J.; Vilo, J. g:Profiler—A web-based toolset for functional profiling of gene lists from large-scale experiments. Nucleic Acids Res. 2007, 35, W193–W200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia, M. Current and future vaccines and vaccination strategies against infectious laryngotracheitis (ILT) respiratory disease of poultry. Vet. Microbiol. 2017, 206, 157–162. [Google Scholar] [CrossRef] [Scilit]
- Reddy, S.M.; Izumiya, Y.; Lupiani, B. Marek’s disease vaccines: Current status, and strategies for improvement and development of vector vaccines. Vet. Microbiol. 2017, 206, 113–120. [Google Scholar] [CrossRef] [Scilit]
- Boodhoo, N.; Gurung, A.; Sharif, S.; Behboudi, S. Marek’s disease in chickens: A review with focus on immunology. Vet. Res. 2016, 47, 119. [Google Scholar] [CrossRef] [Scilit]
- Malagon, T.; Drolet, M.; Boily, M.C.; Franco, E.L.; Jit, M.; Brisson, J.; Brisson, M. Cross-protective efficacy of two human papillomavirus vaccines: A systematic review and meta-analysis. Lancet Infect. Dis. 2012, 12, 781–789. [Google Scholar] [CrossRef] [Scilit]
- Whitworth, H.S.; Gallagher, K.E.; Howard, N.; Mounier-Jack, S.; Mbwanji, G.; Kreimer, A.R.; Basu, P.; Kelly, H.; Drolet, M.; Brisson, M.; et al. Efficacy and immunogenicity of a single dose of human papillomavirus vaccine compared to no vaccination or standard three and two-dose vaccination regimens: A systematic review of evidence from clinical trials. Vaccine 2020, 38, 1302–1314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, L.F.; Bacon, L.D.; Yoshida, S.; Yanagida, N.; Zhang, H.M.; Witter, R.L. The efficacy of recombinant fowlpox vaccine protection against Marek’s disease: Its dependence on chicken line and B haplotype. Avian Dis. 2004, 48, 129–137. [Google Scholar] [CrossRef] [Scilit]
- Chang, S.; Xie, Q.; Dunn, J.R.; Ernst, C.W.; Song, J.; Zhang, H.M. Host genetic resistance to Marek’s disease sustains protective efficacy of herpesvirus of turkey in both experimental and commercial lines of chickens. Vaccine 2014, 32, 1820–1827. [Google Scholar] [CrossRef] [Scilit]
- Chang, S.; Dunn, J.R.; Heidari, M.; Lee, L.F.; Ernst, C.; Song, J.; Zhang, H.M. Vaccine by chicken line interaction alters the protective efficacy against challenge with a very virulent plus strain of Marek’s disease virus in White Leghorn chickens. World J. Vaccines 2012, 2, 1–11. [Google Scholar] [CrossRef]
- Haq, K.; Schat, K.A.; Sharif, S. Immunity to Marek’s disease: Where are we now? Dev. Comp. Immunol. 2013, 41, 439–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ji, Y.; Hocker, J.D.; Gattinoni, L. Enhancing adoptive T cell immunotherapy with microRNA therapeutics. Semin. Immunol. 2016, 28, 45–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mirza, S.; Shah, K.; Patel, S.; Jain, N.; Rawal, R. Natural Compounds as Epigenetic Regulators of Human Dendritic Cell-mediated Immune Function. J. Immunother. 2018, 41, 169–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baumjohann, D. Diverse functions of miR-17-92 cluster microRNAs in T helper cells. Cancer Lett. 2018, 423, 147–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Acuna, S.M.; Floeter-Winter, L.M.; Muxel, S.M. MicroRNAs: Biological Regulators in Pathogen-Host Interactions. Cells 2020, 9, 113. [Google Scholar] [CrossRef] [Scilit]
- Jia, Y.; Wei, Y. Modulators of MicroRNA Function in the Immune System. Int. J. Mol. Sci. 2020, 21, 2357. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Ali Abdalla, B.; Li, Z.; Nie, Q. Epigenetic Regulation by Non-Coding RNAs in the Avian Immune System. Life 2020, 10, 148. [Google Scholar] [CrossRef] [Scilit]
- Santos, J.M.O.; Gil da Costa, R.M.; Medeiros, R. Dysregulation of cellular microRNAs by human oncogenic viruses—Implications for tumorigenesis. Biochim. Biophys. Acta Gene Regul. Mech. 2018, 1861, 95–105. [Google Scholar] [CrossRef] [Scilit]
- Wen, W.; Mai, S.J.; Lin, H.X.; Zhang, M.Y.; Huang, J.L.; Hua, X.; Lin, C.; Long, Z.Q.; Lu, Z.J.; Sun, X.Q.; et al. Identification of two microRNA signatures in whole blood as novel biomarkers for diagnosis of nasopharyngeal carcinoma. J. Transl. Med. 2019, 17, 186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, T.; Yang, M.; Huang, D.; Wang, X.; Xue, B.; Tian, N.; Xu, X.; Bao, L.; Hu, H.; Lv, T.; et al. MicroRNA-7 as a potential therapeutic target for aberrant NF-kappaB-driven distant metastasis of gastric cancer. J. Exp. Clin. Cancer Res. 2019, 38, 55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dundar, H.Z.; Aksoy, F.; Aksoy, S.A.; Tasar, P.; Ugras, N.; Tunca, B.; Egeli, U.; Cecener, G.; Yerci, O.; Kaya, E. Overexpression of miR-21 Is Associated with Recurrence in Patients with Hepatitis B Virus-Mediated Hepatocellular Carcinoma Undergoing Liver Transplantation. Transplant. Proc. 2019, 51, 1157–1161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, L.; Zhu, J.; Zhou, H.; Zhao, Z.; Zou, Z.; Liu, X.; Lin, X.; Zhang, X.; Deng, X.; Wang, R.; et al. Identification of cellular microRNA-136 as a dual regulator of RIG-I-mediated innate immunity that antagonizes H5N1 IAV replication in A549 cells. Sci. Rep. 2015, 5, 14991. [Google Scholar] [CrossRef] [Scilit]
- Hendrikse, C.S.E.; Theelen, P.M.M.; van der Ploeg, P.; Westgeest, H.M.; Boere, I.A.; Thijs, A.M.J.; Ottevanger, P.B.; van de Stolpe, A.; Lambrechts, S.; Bekkers, R.L.M.; et al. The potential of RAS/RAF/MEK/ERK (MAPK) signaling pathway inhibitors in ovarian cancer: A systematic review and meta-analysis. Gynecol. Oncol. 2023, 171, 83–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, S.; Rehman, M.U.; Yatoo, A.M.; Arafah, A.; Khan, A.; Rashid, S.; Majid, S.; Ali, A.; Ali, M.N. TGF-beta signaling pathway: Therapeutic targeting and potential for anti-cancer immunity. Eur. J. Pharmacol. 2023, 947, 175678. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoque, M.O.; Brait, M.; Rosenbaum, E.; Poeta, M.L.; Pal, P.; Begum, S.; Dasgupta, S.; Carvalho, A.L.; Ahrendt, S.A.; Westra, W.H.; et al. Genetic and epigenetic analysis of erbB signaling pathway genes in lung cancer. J. Thorac. Oncol. 2010, 5, 1887–1893. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hashemi, S.; Yari, N.; Rahimi Jamnani, F.; Mahdian, R.; Karimi, M.; Zeinali, S.; Rafiee, M.H.; Azizi, M. The role of miRNA-377 as a tumor suppressor in lung cancer by negative regulation of genes belonging to ErbB signaling pathway. Mol. Biol. Rep. 2022, 49, 85–95. [Google Scholar] [CrossRef] [Scilit]
- Zhu, X.F.; Wang, J.S.; Cai, L.L.; Zeng, Y.X.; Yang, D. SUCI02 inhibits the erbB-2 tyrosine kinase receptor signaling pathway and arrests the cell cycle in G1 phase in breast cancer cells. Cancer Sci. 2006, 97, 84–89. [Google Scholar] [CrossRef] [Scilit]
- Cheng, Y.X.; Xu, W.B.; Dong, W.R.; Zhang, Y.M.; Li, B.W.; Chen, D.Y.; Xiao, Y.; Guo, X.L.; Shu, M.A. Identification and functional analysis of epidermal growth factor receptor (EGFR) from Scylla paramamosain: The first evidence of two EGFR genes in animal and their involvement in immune defense against pathogen infection. Mol. Immunol. 2022, 151, 143–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| miRNA | Sequence | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
|---|---|---|---|
| gga-mir-30a* | TGTAAACATCCTCGACTGGA | GCGCAGTGTAAACATCCTCGA | CAGGTCCAGTTTTTTTTTTTTTTTCCAGT |
| gga-mir-31 | AGGCAAGATGTTGGCATAGCTG | GCAGAGGCAAGATGTTGGCAT | CAGGTCCAGTTTTTTTTTTTTTTTCAGCTA |
| ga-mir-193b | AACTGGCCCACAAAGTCCCGCT | CGCAGAACTGGCCCACAAAG | GTCCAGTTTTTTTTTTTTTTTAGCGGGACT |
| gga-mir-499 | TTAAGACTTGTAGTGATGTTT | AGCGCAGTTAAGACTTGTAGTGAT | AGCAGGTCCAGTTTTTTTTTTTTTTTAAACAT |
| Chicken Line | Treatment 1 | Sample No. | Pass-Filter (PF) Reads | PF Reads% ≥ Phred Quality Score 30 |
|---|---|---|---|---|
| Line 63 | HVT & MDV | 1 | 49,634,171 | 96.7% |
| HVT & MDV | 2 | 38,184,563 | 97.1% | |
| HVT & MDV | 3 | 44,927,209 | 97.3% | |
| Risp. & MDV | 1 | 23,024,936 | 96.2% | |
| Risp. & MDV | 2 | 26,589,212 | 96.6% | |
| Risp. & MDV | 3 | 50,802,611 | 95.9% | |
| Line 72 | HVT & MDV | 1 | 28,507,647 | 97.3% |
| HVT & MDV | 2 | 31,645,519 | 96.5% | |
| HVT & MDV | 3 | 37,376,612 | 96.9% | |
| Risp. & MDV | 1 | 33,373,070 | 96.9% | |
| Risp. & MDV | 2 | 33,949,611 | 96.7% | |
| Risp. & MDV | 3 | 30,867,386 | 96.8% |
| Chicken Line | Treatment 1 | Number of Identified miRNAs | ||
|---|---|---|---|---|
| Known | Novel | Sub-Total | ||
| Line 63 | HVT & MDV | 187 | 294 | 481 |
| Risp. & MDV | 190 | 334 | 524 | |
| Line 72 | HVT & MDV | 182 | 275 | 457 |
| Risp. & MDV | 186 | 324 | 510 | |
| Treatment 2 | Chicken Line | miRNA-ID | Log2 Fold Change | p Value | FDR 3 |
|---|---|---|---|---|---|
| HVT then MDV | Line 63 | gga-mir-19b* | 12.76 | 1.34 × 10−17 | 1.92 × 10−15 |
| gga-mir-205b | 6.17 | 7.14 × 10−6 | 6.86 × 10−4 | ||
| gga-mir-425-5p | 3.04 | 5.70 × 10−25 | 1.64 × 10−22 | ||
| novelMiR_530 | 5.87 | 6.50 × 10−5 | 4.68 × 10−3 | ||
| novelMiR_547 | 12.76 | 1.34 × 10−17 | 1.92 × 10−15 | ||
| novelMiR_91 | −8.07 | 3.09 × 10−5 | 2.54 × 10−3 | ||
| novelMiR_215 | −6.96 | 5.00 × 10−10 | 5.76 × 10−8 | ||
| Line 72 | gga-mir-19b* | 12.47 | 6.73 × 10−6 | 9.19 × 10−4 | |
| gga-mir-30a* | 10.81 | 6.43 × 10−6 | 9.19 × 10−4 | ||
| gga-mir-205b | 5.87 | 2.48 × 10−4 | 2.26 × 10−2 | ||
| gga-mir-425-5p | 12.70 | 1.50 × 10−6 | 8.19 × 10−4 | ||
| novelMiR_547 | 12.47 | 6.73 × 10−6 | 9.19 × 10−4 | ||
| novelMiR_692 | −11.61 | 2.25 × 10−4 | 2.26 × 10−2 | ||
| Risp then MDV | Line 63 | gga-mir-19b* | 10.84 | 2.28 × 10−6 | 1.70 × 10−4 |
| gga-mir-133a-1 | 1.49 | 4.94 × 10−4 | 2.10 × 10−2 | ||
| gga-mir-133a-2 | 1.49 | 4.94 × 10−4 | 2.10 × 10−2 | ||
| gga-mir-425-5p | 3.37 | 2.81 × 10−22 | 8.36 × 10−20 | ||
| novelMiR_459 | 5.86 | 2.18 × 10−4 | 1.18 × 10−2 | ||
| novelMiR_488 | 2.54 | 1.89 × 10−6 | 1.70 × 10−4 | ||
| novelMiR_530 | 5.59 | 3.70 × 10−4 | 1.84 × 10−2 | ||
| novelMiR_547 | 10.84 | 2.28 × 10−6 | 1.70 × 10−4 | ||
| novelMiR_621-1 | 5.33 | 8.87 × 10−4 | 3.52 × 10−2 | ||
| novelMiR_660-1 | 7.78 | 3.16 × 10−11 | 4.70 × 10−9 | ||
| novelMiR_660-2 | 7.78 | 3.16 × 10−11 | 4.70 × 10−9 | ||
| novelMiR_663-2 | 5.72 | 1.57 × 10−4 | 9.34 × 10−3 | ||
| novelMiR_692 | 13.94 | 3.46 × 10−10 | 4.12 × 10−8 | ||
| novelMiR_91 | −8.00 | 7.64 × 10−5 | 5.05 × 10−3 | ||
| Line 72 | gga-mir-19b* | 12.30 | 1.51 × 10−150 | 2.17 × 10−148 | |
| gga-mir-425-5p | 13.64 | 5.18 × 10−27 | 2.98 × 10−24 | ||
| novelMiR_268 | 2.89 | 1.94 × 10−14 | 1.86 × 10−12 | ||
| novelMiR_547 | 12.30 | 1.51 × 10−150 | 2.17 × 10−148 | ||
| gga-mir-30c-1 | −1.33 | 3.86 × 10−9 | 3.17 × 10−7 | ||
| novelMiR_91 | −9.49 | 1.50 × 10−25 | 1.73 × 10−23 | ||
| novelMiR_215 | −6.88 | 2.29 × 10−4 | 1.36 × 10−2 | ||
| novelMiR_294 | −2.97 | 6.17 × 10−4 | 2.96 × 10−2 | ||
| novelMiR_692 | −11.98 | 4.95 × 10−5 | 3.56 × 10−3 |
| Contrast 1 | Chicken Line | miRNA-ID | Log2 Fold Change | p Value | FDR 2 |
|---|---|---|---|---|---|
| Risp/HVT | Line 63 | novelMiR_508-1 | 6.32 | 1.20 × 10−4 | 2.28 × 10−2 |
| novelMiR_508-2 | 6.32 | 1.20 × 10−4 | 2.28 × 10−2 | ||
| novelMiR_508-3 | 6.32 | 1.20 × 10−4 | 2.28 × 10−2 | ||
| Line 72 | gga-mir-30a | −11.10 | 5.79 × 10−7 | 3.30 × 10−4 | |
| gga-mir-205b | −6.15 | 2.53 × 10−6 | 4.80 × 10−4 | ||
| novelMiR_215 | −7.46 | 2.46 × 10−6 | 4.80 × 10−4 |
| Treatment 1 | miRNA-ID | Log2 Fold Change | p Value | FDR 2 |
|---|---|---|---|---|
| HVT then MDV | novelMiR_18 | 7.23 | 4.24 × 10−8 | 1.17 × 10−5 |
| novelMiR_97-2 | 2.46 | 1.42 × 10−4 | 1.63 × 10−2 | |
| gga-mir-1684a | −5.85 | 1.48 × 10−4 | 1.63 × 10−2 | |
| novelMiR_215 | −7.37 | 6.26 × 10−6 | 1.15 × 10−3 | |
| novelMiR_1062 | −7.97 | 2.24 × 10−13 | 1.23 × 10−10 | |
| Risp. then MDV | gga-mir-30a | 13.51 | 2.64 × 10−126 | 1.60 × 10−123 |
| novelMiR_203-1 | 1.16 | 1.02 × 10−3 | 3.52 × 10−2 | |
| novelMiR_203-2 | 1.15 | 1.05 × 10−3 | 3.52 × 10−2 | |
| novelMiR_508-1 | 6.43 | 4.38 × 10−5 | 2.65 × 10−3 | |
| novelMiR_508-2 | 6.43 | 4.38 × 10−5 | 2.65 × 10−3 | |
| novelMiR_508-3 | 6.43 | 4.38 × 10−5 | 2.65 × 10−3 | |
| novelMiR_660-1 | 7.90 | 4.02 × 10−13 | 6.08 × 10−11 | |
| novelMiR_660-2 | 7.90 | 4.02 × 10−13 | 6.08 × 10−11 | |
| novelMiR_663-2 | 5.84 | 1.85 × 10−4 | 7.00 × 10−3 | |
| novelMiR_692 | 14.06 | 6.02 × 10−12 | 7.29 × 10−10 | |
| gga-mir-9-1 | −1.28 | 9.47 × 10−5 | 3.84 × 10−3 | |
| gga-mir-9-1* | −1.28 | 9.47 × 10−5 | 3.84 × 10−3 | |
| gga-mir-9-2 | −1.28 | 9.50 × 10−5 | 3.84 × 10−3 | |
| gga-mir-19b | −1.50 | 1.39 × 10−3 | 4.01 × 10−2 | |
| gga-mir-499 | −1.11 | 1.64 × 10−3 | 4.51 × 10−2 | |
| gga-mir-1684a | −6.22 | 3.69 × 10−5 | 2.65 × 10−3 | |
| novelMiR_129-1 | −1.28 | 9.50 × 10−5 | 3.84 × 10−3 | |
| novelMiR_129-2 | −1.28 | 9.50 × 10−5 | 3.84 × 10−3 | |
| novelMiR_547 | −1.50 | 1.39 × 10−3 | 4.01 × 10−2 | |
| novelMiR_600 | −8.90 | 3.47 × 10−5 | 2.65 × 10−3 | |
| novelMiR_1062 | −8.20 | 1.34 × 10−16 | 4.05 × 10−14 | |
| novelMiR_1108 | −5.62 | 1.19 × 10−3 | 3.79 × 10−2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.; Xie, Q.; Chang, S.; Ai, Y.; Dong, K.; Zhang, H. Epigenetic Factor MicroRNAs Likely Mediate Vaccine Protection Efficacy against Lymphomas in Response to Tumor Virus Infection in Chickens through Target Gene Involved Signaling Pathways. Vet. Sci. 2024, 11, 139. https://doi.org/10.3390/vetsci11040139
Zhang L, Xie Q, Chang S, Ai Y, Dong K, Zhang H. Epigenetic Factor MicroRNAs Likely Mediate Vaccine Protection Efficacy against Lymphomas in Response to Tumor Virus Infection in Chickens through Target Gene Involved Signaling Pathways. Veterinary Sciences. 2024; 11(4):139. https://doi.org/10.3390/vetsci11040139
Chicago/Turabian StyleZhang, Lei, Qingmei Xie, Shuang Chang, Yongxing Ai, Kunzhe Dong, and Huanmin Zhang. 2024. "Epigenetic Factor MicroRNAs Likely Mediate Vaccine Protection Efficacy against Lymphomas in Response to Tumor Virus Infection in Chickens through Target Gene Involved Signaling Pathways" Veterinary Sciences 11, no. 4: 139. https://doi.org/10.3390/vetsci11040139
APA StyleZhang, L., Xie, Q., Chang, S., Ai, Y., Dong, K., & Zhang, H. (2024). Epigenetic Factor MicroRNAs Likely Mediate Vaccine Protection Efficacy against Lymphomas in Response to Tumor Virus Infection in Chickens through Target Gene Involved Signaling Pathways. Veterinary Sciences, 11(4), 139. https://doi.org/10.3390/vetsci11040139

