In Vitro Bone Differentiation of 3D Microsphere from Dental Pulp-Mesenchymal Stem Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Microsphere Formation and Viability Assay
2.2. Osteogenic Assay of 3D Microspheres
2.3. Microsphere Colonization of PLA Fiber-Spun Membrane
2.4. Statistical Analysis
3. Results
3.1. Microsphere Viability
3.2. Microsphere Morphology
3.3. Osteogenic Evaluation of Microspheres
3.3.1. Microsphere ALP Activity
3.3.2. Microsphere Extracellular Mineralization Assay
3.3.3. qPCR
3.4. Microsphere Colonization of the PLA Membrane
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lopes, D.; Martins-Cruz, C.; Oliveira, M.B.; Mano, J.F. Bone physiology as inspiration for tissue regenerative therapies. Biomaterials 2018, 185, 240–275. [Google Scholar] [CrossRef]
- Zheng, C.; Chen, J.; Liu, S.; Jin, Y. Stem cell-based bone and dental regeneration: A view of microenvironmental modulation. Int. J. Oral Sci. 2019, 11, 23. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Ma, X.-J.; Fei, Y.-Y.; Han, H.-T.; Xu, J.; Cheng, L.; Li, X. Stem cell therapy in liver regeneration: Focus on mesenchymal stem cells and induced pluripotent stem cells. Pharmacol. Ther. 2022, 232, 108004. [Google Scholar] [CrossRef]
- Park, H.-S.; Chugh, R.M.; El Andaloussi, A.; Hobeika, E.; Esfandyari, S.; Elsharoud, A.; Ulin, M.; Garcia, N.; Bilal, M.; Al-Hendy, A. Human BM-MSC secretome enhances human granulosa cell proliferation and steroidogenesis and restores ovarian function in primary ovarian insufficiency mouse model. Sci. Rep. 2021, 11, 4525. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Sohn, J.; Shen, H.; Langhans, M.T.; Tuan, R.S. Bone marrow mesenchymal stem cells: Aging and tissue engineering applications to enhance bone healing. Biomaterials 2019, 203, 96–110. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.; Li, X.; Zhang, Y.; Han, Y.; Chang, F.; Ding, J. Mesenchymal Stem Cells for Regenerative Medicine. Cells 2019, 8, 886. [Google Scholar] [CrossRef] [PubMed]
- Chu, D.-T.; Phuong, T.N.T.; Tien, N.L.B.; Tran, D.K.; Van Thanh, V.; Quang, T.L.; Truong, D.T.; Pham, V.H.; Ngoc, V.T.N.; Chu-Dinh, T.; et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. Int. J. Mol. Sci. 2020, 21, 708. [Google Scholar] [CrossRef]
- Ayoub, S.; Berbéri, A.; Fayyad-Kazan, M. An update on human periapical cyst-mesenchymal stem cells and their potential applications in regenerative medicine. Mol. Biol. Rep. 2020, 47, 2381–2389. [Google Scholar] [CrossRef]
- Soudi, A.; Yazdanian, M.; Ranjbar, R.; Tebyanian, H.; Yazdanian, A.; Tahmasebi, E.; Keshyad, A.; Steifalian, A. Role and application of stem cells in dental regeneration: A compressive overview. EXCLI J. 2021, 20, 454–489. [Google Scholar] [CrossRef]
- Aydin, S.; Şahin, F. Stem Cells Derived from Dental Tissues. Adv. Exp. Med. Biol. 2019, 144, 123–132. [Google Scholar] [CrossRef]
- De la Rosa-Ruiz, M.D.P.; Álvarez-Pérez, M.A.; Cortés-Morales, V.A.; Monroy-García, A.; Mayani, H.; Fragoso-González, G.; Caballero-Chacón, S.; Diaz, D.; Candanedo-González, F.; Montesinos, J.J. Mesenchymal Stem/Stromal Cells Derived from Dental Tissues: A Comparative In Vitro Evaluation of Their Immunoregulatory Properties Against T cells. Cells 2019, 8, 1491. [Google Scholar] [CrossRef] [PubMed]
- Noda, S.; Kawashima, N.; Yamamoto, M.; Hashimoto, K.; Nara, K.; Sekiya, I.; Okiji, T. Effect of cell culture density on dental pulp-derived mesenchymal stem cells with reference to osteogenic differentiation. Sci. Rep. 2019, 9, 5430. [Google Scholar] [CrossRef] [PubMed]
- Stanko, P.; Altanerova, U.; Jakubechova, J.; Repiska, V.; Altaner, C. Dental Mesenchymal Stem/Stromal Cells and Their Exosomes. Stem Cells Int. 2018, 2018, 8973613. [Google Scholar] [CrossRef] [PubMed]
- Yamada, Y.; Nakamura, S.; Ito, K.; Sugito, T.; Yoshimi, R.; Nagasaka, T.; Ueda, M. A Feasibility of Useful Cell-Based Therapy by Bone Regeneration with Deciduous Tooth Stem Cells, Dental Pulp Stem Cells, or Bone-Marrow-Derived Mesenchymal Stem Cells for Clinical Study Using Tissue Engineering Technology. Tissue Eng. Part A 2010, 16, 1891–1900. [Google Scholar] [CrossRef] [PubMed]
- Masuda, K.; Han, X.; Kato, H.; Sato, H.; Zhang, Y.; Sun, X.; Hirofuji, Y.; Yamaza, H.; Yamada, A.; Fukumoto, S. Dental Pulp-Derived Mesenchymal Stem Cells for Modeling Genetic Disorders. Int. J. Mol. Sci. 2021, 22, 2269. [Google Scholar] [CrossRef]
- Lei, Y.; Schaffer, D.V. A fully defined and scalable 3D culture system for human pluripotent stem cell expansion and differentiation. Proc. Natl. Acad. Sci. USA 2013, 110, E5039–E5048. [Google Scholar] [CrossRef]
- Ryu, N.-E.; Lee, S.-H.; Park, H. Spheroid Culture System Methods and Applications for Mesenchymal Stem Cells. Cells 2019, 8, 1620. [Google Scholar] [CrossRef]
- Huang, X.; Huang, Z.; Gao, W.; Gao, W.; He, R.; Li, Y.; Crawford, R.; Zhou, Y.; Xiao, L.; Xiao, Y. Current Advances in 3D Dynamic Cell Culture Systems. Gels 2022, 8, 829. [Google Scholar] [CrossRef]
- Anthon, S.G.; Valente, K.P. Vascularization Strategies in 3D Cell Culture Models: From Scaffold-Free Models to 3D Bioprinting. Int. J. Mol. Sci. 2022, 23, 14582. [Google Scholar] [CrossRef]
- Kim, J.A.; Choi, J.-H.; Kim, M.; Rhee, W.J.; Son, B.; Jung, H.-K.; Park, T.H. High-throughput generation of spheroids using magnetic nanoparticles for three-dimensional cell culture. Biomaterials 2013, 34, 8555–8563. [Google Scholar] [CrossRef]
- Souza, G.R.; Molina, J.R.; Raphael, R.M.; Ozawa, M.G.; Stark, D.J.; Levin, C.S.; Bronk, L.; Ananta, J.S.; Mandelin, J.; Georgescu, M.-M.; et al. Three-dimensional tissue culture based on magnetic cell levitation. Nat. Nanotechnol. 2010, 5, 291–296. [Google Scholar] [CrossRef]
- Haisler, W.L.; Timm, D.M.; Gage, J.A.; Tseng, H.; Killian, T.; Souza, G.R. Three-dimensional cell culturing by magnetic levitation. Nat. Protoc. 2013, 8, 1940–1949. [Google Scholar] [CrossRef] [PubMed]
- Anil-Inevi, M.; Yaman, S.; Yildiz, A.A.; Mese, G.; Yalcin-Ozuysal, O.; Tekin, H.C.; Ozcivici, E. Biofabrication of in situ Self Assembled 3D Cell Cultures in a Weightlessness Environment Generated using Magnetic Levitation. Sci. Rep. 2018, 8, 7239. [Google Scholar] [CrossRef] [PubMed]
- Caleffi, J.T.; Aal, M.C.E.; de Oliveira Manacorda Gallindo, H.; Caxali, G.H.; Crulhas, B.P.; Ribeiro, A.O.; Souza, G.R.; Delella, F.K. Magnetic 3D cell culture: State of the art and current advances. Life Sci. 2021, 286, 120028. [Google Scholar] [CrossRef] [PubMed]
- Gaitán-Salvatella, I.; López-Villegas, E.O.; González-Alva, P.; Susate-Olmos, F.; Álvarez-Pérez, M.A. Case Report: Formation of 3D Osteoblast Spheroid Under Magnetic Levitation for Bone Tissue Engineering. Front. Mol. Biosci. 2021, 8, 672518. [Google Scholar] [CrossRef]
- Chanes-Cuevas, O.A.; Arellano-Sánchez, U.; Álvarez-Gayosso, C.A.; Suaste-Olmos, F.; Villarreal-Ramírez, E.; Álvarez-Fregoso, O.; García-Hipólito, M.; González-Alva, P.; Álvarez-Pérez, M.A. Synthesis of PLA/SBA-15 Composite Scaffolds for Bone Tissue Engineering. Mater. Res. 2020, 23, e20200211. [Google Scholar] [CrossRef]
- Edwards, S.J.; Carannante, V.; Kuhnigk, K.; Ring, H.; Tararuk, T.; Hallböök, F.; Blom, H.; Önfelt, B.; Brismar, H. High-Resolution Imaging of Tumor Spheroids and Organoids Enabled by Expansion Microscopy. Front. Mol. Biosci. 2020, 7, 208. [Google Scholar] [CrossRef]
- Costa, E.C.; Silva, D.N.; Moreira, A.F.; Correia, I.J. Optical clearing methods: An overview of the techniques used for the imaging of 3D spheroids. Biotechnol. Bioeng. 2019, 116, 2742–2763. [Google Scholar] [CrossRef]
- Iijima, K.; Otsuka, H. Cell Scaffolds for Bone Tissue Engineering. Bioengineering 2020, 7, 119. [Google Scholar] [CrossRef]
- Marques, I.A.; Fernandes, C.; Tavares, N.T.; Pires, A.S.; Abrantes, A.M.; Botelho, M.F. Magnetic-Based Human Tissue 3D Cell Culture: A Systematic Review. Int. J. Mol. Sci. 2022, 23, 12681. [Google Scholar] [CrossRef]
- Ezquerra, S.; Zuleta, A.; Arancibia, R.; Estay, J.; Aulestia, F.; Carrion, F. Functional Properties of Human-Derived Mesenchymal Stem Cell Spheroids: A Meta-Analysis and Systematic Review. Stem Cells Int. 2021, 2021, 8825332. [Google Scholar] [CrossRef] [PubMed]
- Chan, Y.-H.; Lee, Y.-C.; Hung, C.-Y.; Yang, P.-J.; Lai, P.-C.; Feng, S.-W. Three-dimensional Spheroid Culture Enhances Multipotent Differentiation and Stemness Capacities of Human Dental Pulp-derived Mesenchymal Stem Cells by Modulating MAPK and NF-kB Signaling Pathways. Stem Cell Rev. Rep. 2021, 17, 1810–1826. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, J.N.; Hasan, R.; Urkasemsin, G.; Ng, K.K.; Adine, C.; Muthumariappan, S.; Souza, G.R. A magnetic three-dimensional levitated primary cell culture system for the development of secretory salivary gland-like organoids. J. Tissue Eng. Regen. Med. 2019, 13, 495–508. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Buttler-Buecher, P.; Denecke, B.; Arana-Chavez, V.E.; Apel, C. A comprehensive analysis of human dental pulp cell spheroids in a three-dimensional pellet culture system. Arch. Oral Biol. 2018, 91, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Tsai, H.-H.; Yang, K.-C.; Wu, M.-H.; Chen, J.-C.; Tseng, C.-L. The Effects of Different Dynamic Culture Systems on Cell Proliferation and Osteogenic Differentiation in Human Mesenchymal Stem Cells. Int. J. Mol. Sci. 2019, 20, 4024. [Google Scholar] [CrossRef]
- Labusca, L.; Herea, D.D.; Minuti, A.E.; Stavila, C.; Danceanu, C.; Grigoras, M.; Ababei, G.; Chiriac, H.; Lupu, N. Magnetic nanoparticle loaded human adipose derived mesenchymal cells spheroids in levitated culture. J. Biomed. Mater. Res. Part B Appl. Biomater. 2021, 109, 630–642. [Google Scholar] [CrossRef] [PubMed]
- Di Caprio, N.; Burdick, J.A. Engineered biomaterials to guide spheroid formation, function, and fabrication into 3D tissue constructs. Acta Biomater. 2022, in press. [Google Scholar] [CrossRef]
- Hazrati, A.; Malekpour, K.; Soudi, S.; Hashemi, S.M. Mesenchymal stromal/stem cells spheroid culture effect on the therapeutic efficacy of these cells and their exosomes: A new strategy to overcome cell therapy limitations. Biomed. Pharmacother. 2022, 152, 113211. [Google Scholar] [CrossRef]
- Decarli, M.C.; de Castro, M.V.; Nogueira, J.A.; Nagahara, M.H.T.; Westin, C.B.; de Oliveira, A.L.R.; da Silva, J.V.L.; Moroni, L.; Mota, C.; Moraes, A.M. Development of a device useful to reproducibly produce large quantities of viable and uniform stem cell spheroids with controlled diameters. Biomater. Adv. 2022, 135, 112685. [Google Scholar] [CrossRef]
- La Noce, M.; Paino, F.; Spina, A.; Naddeo, P.; Montella, R.; Desiderio, V.; De Rosa, A.; Papaccio, G.; Tirino, V.; Laino, L. Dental pulp stem cells: State of the art and suggestions for a true translation of research into therapy. J. Dent. 2014, 42, 761–768. [Google Scholar] [CrossRef]
- Yang, Y.-H.K.; Ogando, C.R.; See, C.W.; Chang, T.-Y.; Barabino, G.A. Changes in phenotype and differentiation potential of human mesenchymal stem cells aging in vitro. Stem Cell Res. Ther. 2018, 9, 131. [Google Scholar] [CrossRef]
- Viti, F.; Landini, M.; Mezzelani, A.; Petecchia, L.; Milanesi, L.; Scaglione, S. Osteogenic Differentiation of MSC through Calcium Signaling Activation: Transcriptomics and Functional Analysis. PLoS ONE 2016, 11, e0148173. [Google Scholar] [CrossRef]
- Komori, T. Functions of Osteocalcin in Bone, Pancreas, Testis, and Muscle. Int. J. Mol. Sci. 2020, 21, 7513. [Google Scholar] [CrossRef]
- Frith, J.E.; Thomson, B.; Genever, P.G. Dynamic Three-Dimensional Culture Methods Enhance Mesenchymal Stem Cell Properties and Increase Therapeutic Potential. Tissue Eng. Part C Methods 2010, 16, 735–749. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Xie, Y.; Xi, Z.; Mi, Z.; Deng, R.; Liu, X.; Kang, R.; Liu, X. Hope for bone regeneration: The versatility of iron oxide nanoparticles. Front. Bioeng. Biotechnol. 2022, 10, 937803. [Google Scholar] [CrossRef]
- Singhvi, M.S.; Zinjarde, S.S.; Gokhale, D.V. Polylactic acid: Synthesis and biomedical applications. J. Appl. Microbiol. 2019, 127, 1612–1626. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.Y.; Jiang, H.B.; Ryu, J.-H.; Kang, H.; Kim, K.-M.; Kwon, J.-S. Comparing Properties of Variable Pore-Sized 3D-Printed PLA Membrane with Conventional PLA Membrane for Guided Bone/Tissue Regeneration. Materials 2019, 12, 1718. [Google Scholar] [CrossRef] [PubMed]
- Tutak, W.; Sarkar, S.; Lin-Gibson, S.; Farooque, T.M.; Jyotsnendu, G.; Wang, D.; Kohn, J.; Bolikal, D.; Simon, C.G. The support of bone marrow stromal cell differentiation by airbrushed nanofiber scaffolds. Biomaterials 2013, 34, 2389–2398. [Google Scholar] [CrossRef] [PubMed]
- François, S.; Sarra-Bournet, C.; Jaffre, A.; Chakfé, N.; Durand, B.; Laroche, G. Characterization of an air-spun poly(L-lactic acid) nanofiber mesh. J. Biomed. Mater. Res. Part B Appl. Biomater. 2010, 93, 531–543. [Google Scholar] [CrossRef]
- Vazquez-Vazquez, F.C.; Chavarria-Bolaños, D.; Ortiz-Magdaleno, M.; Guarino, V.; Alvarez-Perez, M.A. 3D-Printed Tubular Scaffolds Decorated with Air-Jet-Spun Fibers for Bone Tissue Applications. Bioengineering 2022, 9, 189. [Google Scholar] [CrossRef]
- Suarez-Franco, J.L.; Vázquez-Vázquez, F.C.; Pozos-Guillen, A.; Montesinos, J.J.; Alvarez-Fregoso, O.; Alvarez-Perez, M.A. Influence of diameter of fiber membrane scaffolds on the biocompatibility of hPDL mesenchymal stromal cells. Dent. Mater. J. 2018, 37, 465–473. [Google Scholar] [CrossRef]
- Mironov, V.A.; Senatov, F.S.; Koudan, E.V.; Pereira, F.D.A.S.; Kasyanov, V.A.; Granjeiro, J.M.; Baptista, L.S. Design, Fabrication, and Application of Mini-Scaffolds for Cell Components in Tissue Engineering. Polymers 2022, 14, 5068. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Cai, P.; Luo, J.; Zhang, F.; Liu, J.; Chen, Y.; Zhu, Z.; Song, Y.; Yang, B.; Liu, X.; et al. Engineering subcellular-patterned biointerfaces to regulate the surface wetting of multicellular spheroids. Nano Res. 2018, 11, 5704–5715. [Google Scholar] [CrossRef]
- Koudan, E.V.; Bulanova, E.A.; Pereira, F.D.A.S.; Parfenov, V.A.; Kasyanov, V.A.; Hesuani, U.J.; Mironov, V.A. Spreading of Tissue Spheroids on an Electrospun Polyurethane Matrix. Biomed. Eng. 2016, 50, 1–4. [Google Scholar] [CrossRef]
- Song, W.; Kawazoe, N.; Chen, G. Dependence of Spreading and Differentiation of Mesenchymal Stem Cells on Micropatterned Surface Area. J. Nanomater. 2011, 2011, 265251. [Google Scholar] [CrossRef]
- Tenchurin, T.K.; Rodina, A.V.; Saprykin, V.P.; Gorshkova, L.V.; Mikhutkin, A.A.; Kamyshinsky, R.A.; Yakovlev, D.S.; Vasiliev, A.L.; Chvalun, S.N.; Grigoriev, T.E. The Performance of Nonwoven PLLA Scaffolds of Different Thickness for Stem Cells Seeding and Implantation. Polymers 2022, 14, 4352. [Google Scholar] [CrossRef]
Name of Gene | Primers Sequence |
---|---|
Osteocalcin (OCN) | Forward: TGAGAGCCCTCACACTCCTC Reverse: CGCCTGGGTCTCTTCACTAC |
Collagen 1 (Col 1) | Forward: GAGAGCATGACCGATGGATT Reverse: ATGTAGGCCACGCTGTTCTT |
Run-related transcription factor 2 (RUNX 2) | Forward: CTCTGACCGCCTCAGTGATT Reverse: GCCTGGGGTCTGTAATCTGA |
Alkaline phosphatase (ALP) | Forward: CGACCAGACGTGAATGAGAG Reverse: GCTACGAAGCTCTGCCTCCTG |
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) | Forward: GCATCCTGGGCTACACTGAG Reverse: TGCTGTAGCCAAATTCGTTG |
Day of Culture | 3D DP-MSC Microsphere | 3D hFOB Microsphere |
---|---|---|
7 | 310.68 ± 11.83 μm | 321.56 ± 13.08 μm |
14 | 329.99 ± 4.16 μm | 342.67 ± 13.97 μm |
21 | 427.05 ± 11.11 μm | 432.09 ± 11.38 μm |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gaitán-Salvatella, I.; González-Alva, P.; Montesinos, J.J.; Alvarez-Perez, M.A. In Vitro Bone Differentiation of 3D Microsphere from Dental Pulp-Mesenchymal Stem Cells. Bioengineering 2023, 10, 571. https://doi.org/10.3390/bioengineering10050571
Gaitán-Salvatella I, González-Alva P, Montesinos JJ, Alvarez-Perez MA. In Vitro Bone Differentiation of 3D Microsphere from Dental Pulp-Mesenchymal Stem Cells. Bioengineering. 2023; 10(5):571. https://doi.org/10.3390/bioengineering10050571
Chicago/Turabian StyleGaitán-Salvatella, Iñigo, Patricia González-Alva, Juan José Montesinos, and Marco Antonio Alvarez-Perez. 2023. "In Vitro Bone Differentiation of 3D Microsphere from Dental Pulp-Mesenchymal Stem Cells" Bioengineering 10, no. 5: 571. https://doi.org/10.3390/bioengineering10050571
APA StyleGaitán-Salvatella, I., González-Alva, P., Montesinos, J. J., & Alvarez-Perez, M. A. (2023). In Vitro Bone Differentiation of 3D Microsphere from Dental Pulp-Mesenchymal Stem Cells. Bioengineering, 10(5), 571. https://doi.org/10.3390/bioengineering10050571