Titanium Dioxide (TiO2) Nanoparticle Toxicity in a Caenorhabditis elegans Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Raw Materials
2.2. Sample Collection and Preparation
2.3. Maintenance of C. elegans
2.4. Acute Exposure
2.5. Lethality Assay
2.6. Lifespan Assay
2.7. Reproductive Assay (Brood Size Calculation)
2.8. Locomotion Assay (Head Thrashing and Body Bending)
2.9. Growth Measurement Assay
2.10. Gene Expression Assays (Quantitative Real-Time PCR Assays)
2.11. Statistical Analysis
3. Results
3.1. Lethality and Growth Measurements
3.2. Reproduction and Locomotion
3.3. Lifespan
3.4. Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Şana, S. Titanium Dioxide Nanoparticles. In Handbook of Nanomaterials and Nanocomposites for Energy and Environmental Applications; Springer: Berlin/Heidelberg, Germany, 2020; pp. 1–18. [Google Scholar]
- Tanemura, S.; Miao, L.; Wunderlich, W.; Tanemura, M.; Mori, Y.; Toh, S.; Kaneko, K. Fabrication and Characterization of Anatase/Rutile–TiO2 Thin Films by Magnetron Sputtering: A Review. Sci. Technol. Adv. Mater. 2004, 6, 11–17. Available online: http://www.tandfonline.com/action/journalInformation?show=aimsScope&journalCode=tsta20#.VmBmuzZFCUk (accessed on 30 October 2023). [CrossRef]
- Coatings, E. Recent and Current Developments in the Titanium Dioxide Market. Available online: https://www.european-coatings.com/news/markets-companies/recent-and-current-developments-in-the-titanium-dioxide-market/ (accessed on 30 October 2023).
- Titanium Dioxide Market Size & Share Report, 2021–2028. Available online: https://www.fnfresearch.com/titanium-dioxide-market (accessed on 26 November 2023).
- Code of Federal, Regulations. Part 73—Listing of Color Additives Exempt from Certification. In Food and Drugs; United States Office of the Federal Register (Ofr) and the United States Government Publishing Office: Washington, DC, USA, 2023.
- Proquin, H.A.A. Beyond the White: Effects of the Titanium Dioxide Food Additive E171 on the Development of Colorectal Cancer. Ph.D. Thesis, Maastricht University, Maastricht, The Netherlands, 2018. [Google Scholar]
- Bucher, G.; El Hadri, H.; Asensio, O.; Auger, F.; Barrero, J.; Rosec, J.P. Large-scale screening of E171 food additive (Ti Large-Scale Screening of E171 Food Additive (TiO2) on the French Market from 2018 to 2022: Occurrence and Particle Size Distribution in Various Food Categories. Food Control 2023, 155, 110102. [Google Scholar] [CrossRef]
- Sha, B.; Gao, W.; Cui, X.; Wang, L.; Xu, F. The Potential Health Challenges of TiO2 Nanomaterials. J. Appl. Toxicol. 2015, 35, 1086–1101. [Google Scholar] [CrossRef] [PubMed]
- Baranowska-Wójcik, E.; Szwajgier, D.; Oleszczuk, P.; Winiarska-Mieczan, A. Effects of Titanium Dioxide Nanoparticles Exposure on Human Health—A Review. Biol. Trace Elem. Res. 2020, 193, 118–129. [Google Scholar] [CrossRef] [PubMed]
- Kose, O.; Tomatis, M.; Leclerc, L.; Belblidia, N.B.; Hochepied, J.F.; Turci, F.; Pourchez, J.; Forest, V. Impact of the Physicochemical Features of TiO2 nanoparticles on Their in Vitro Toxicity. Chem. Res. Toxicol. 2020, 33, 2324–2337. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Jeon, D.; Oh, S.; Nam, K.; Son, S.; Gye, M.C.; Shin, I. Titanium Dioxide Nanoparticles Induce Apoptosis by Interfering with Egfr Signaling in Human Breast Cancer Cells. Environ. Res. 2019, 175, 117–123. [Google Scholar] [CrossRef] [PubMed]
- Altun, Z.F.; Hall, D.H.; Herndon, L.A. Wormatas Hermaphrodite Handbook—Introduction. WormAtlas 2006. [Google Scholar] [CrossRef]
- Chung, M.C.; Tsai, M.H.; Que, D.E.; Bongo, S.J.; Hsu, W.L.; Tayo, L.L.; Lin, Y.H.; Lin, S.L.; Gou, Y.Y.; Hsu, Y.C.; et al. Fine Particulate Matter-Induced Toxic Effects in an Animal Model of Caenorhabditis elegans. Aerosol Air Qual. Res. 2019, 19, 1068–1078. [Google Scholar] [CrossRef]
- Chung, M.C.; Huang, K.L.; Avelino, J.L.; Tayo, L.L.; Lin, C.C.; Tsai, M.H.; Lin, S.L.; Mansor, W.N.W.; Su, C.K.; Huang, S.T. Toxic Assessment of Heavily Traffic-Related Fine Particulate Matter Using an in-Vivo Wild-Type Caenorhabditis elegans Model. Aerosol Air Qual. Res. 2020, 20, 1974–1986. [Google Scholar] [CrossRef]
- Lu, J.H.; Tsai, M.H.; Huang, S.T.; Lee, J.D.; Hsiao, T.C.; Mansor, W.N.W.; Chao, H.R. Traffic-Related-Air-Pollutant PM2.5 Caused Toxicity on Caenorhabditis elegans with Cotreatment of High-Dose Glucose and Tempeh. Aerosol Air Qual. Res. 2023, 23, 220340. [Google Scholar] [CrossRef]
- Tsai, M.H.; Chao, H.R.; Jiang, J.J.; Su, Y.H.; Mariene-syne, P.C.; Tayo, L.L.; Lu, I.C.; Hsieh, H.; Lin, C.C.; Lin, S.L.; et al. Toxicity of Low-Dose Graphene Oxide Nanoparticles in an in-Vivo Wild Type of Caenorhabditis elegans Model. Aerosol Air Qual. Res. 2021, 21, 200559. [Google Scholar] [CrossRef]
- Que, D.E.; Hou, W.C.; Ang, M.B.M.Y.; Lin, C.C. Toxic Effects of Hydroxyl-and Amine-Functionalized Silica Nanoparticles (SiO2 and NH2-SiO2 Nps) on Caenorhabditis elegans. Aerosol Air Qual. Res. 2020, 20, 1987–2020. [Google Scholar] [CrossRef]
- Lu, J.H.; Hou, W.C.; Tsai, M.H.; Chang, Y.T.; Chao, H.R. The Impact of Background-Level Carboxylated Single-Walled Carbon Nanotubes (Swcnts−Cooh) on Induced Toxicity in Caenorhabditis elegans and Human Cells. Int. J. Environ. Res. Public Health 2022, 19, 1218. [Google Scholar] [CrossRef] [PubMed]
- Sitia, G.; Fiordaliso, F.; Violatto, M.B.; Alarcon, J.F.; Talamini, L.; Corbelli, A.; Ferreira, L.M.; Tran, N.L.; Chakraborty, I.; Salmona, M.; et al. Food-Grade Titanium Dioxide Induces Toxicity in the Nematode Caenorhabditis elegans and Acute Hepatic and Pulmonary Responses in Mice. Nanomaterials 2022, 12, 1669. [Google Scholar] [CrossRef] [PubMed]
- Ratnasekhar, C.; Sonane, M.; Satish, A.; Mudiam, M.K.R. Metabolomics Reveals the Perturbations in the Metabolome of Caenorhabditis elegans Exposed to Titanium Dioxide Nanoparticles. Nanotoxicology 2015, 9, 994–1004. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Zhao, Y.; Li, Y.; Wang, D. Susceptible Genes Regulate the Adverse Effects of TiO2-Nps at Predicted Environmental Relevant Concentrations on Nematode Caenorhabditis elegans. Nanomed. Nanotechnol. Biol. Med. 2014, 10, 1263–1271. [Google Scholar] [CrossRef] [PubMed]
- Dong, S.; Qu, M.; Rui, Q.; Wang, D. Combinational Effect of Titanium Dioxide Nanoparticles and Nanopolystyrene Particles at Environmentally Relevant Concentrations on Nematode Caenorhabditis elegans. Ecotoxicol. Environ. Saf. 2018, 161, 444–450. [Google Scholar] [CrossRef]
- Kim, H.; Jeong, J.; Chatterjee, N.; Roca, C.P.; Yoon, D.; Kim, S.; Kim, Y.; Choi, J. JAK/STAT and TGF-ß activation as potential adverse outcome pathway of TiO2NPs phototoxicity in Caenorhabditis elegans. Sci. Rep. 2017, 7, 17833. [Google Scholar] [CrossRef]
- Ma, H.; Lenz, K.A.; Gao, X.; Li, S.; Wallis, L.K. Comparative Toxicity of a Food Additive TiO2, a Bulk TiO2, and a Nano-Sized P25 to a Model Organism the Nematode C. elegans. Environ. Sci. Pollut. Res. 2019, 26, 3556–3568. [Google Scholar] [CrossRef]
- Wang, J.; Dai, H.; Nie, Y.; Wang, M.; Yang, Z.; Cheng, L.; Liu, Y.; Chen, S.; Zhao, G.; Wu, L.; et al. TiO2 Nanoparticles Enhance Bioaccumulation and Toxicity of Heavy Metals in Caenorhabditis elegans via Modification of Local Concentrations During the Sedimentation Process. Ecotoxicol. Environ. Saf. 2018, 162, 160–169. [Google Scholar] [CrossRef]
- Hou, J.; Hu, C.; Li, P.; Lin, D. Multidimensional Bioresponses in Nematodes Contribute to the Antagonistic Toxic Interaction between Pentachlorophenol and TiO2 Nanoparticles in Soil. J. Hazard. Mater. 2022, 424, 127587. [Google Scholar] [CrossRef] [PubMed]
- Rui, Q.; Zhao, Y.; Wu, Q.; Tang, M.; Wang, D. Biosafety Assessment of Titanium Dioxide Nanoparticles in Acutely Exposed Nematode Caenorhabditis elegans with Mutations of Genes Required for Oxidative Stress or Stress Response. Chemosphere 2013, 93, 2289–2296. [Google Scholar] [CrossRef] [PubMed]
- Rocheleau, S.; Arbour, M.; Elias, M.; Sunahara, G.I.; Masson, L. Toxicogenomic Effects of Nano- and Bulk-TiO2 Particles in the Soil Nematode Caenorhabditis elegans. Nanotoxicology 2015, 9, 502–512. [Google Scholar] [CrossRef] [PubMed]
- Angelstorf, J.S.; Ahlf, W.; von der Kammer, F.; Heise, S. Impact of Particle Size and Light Exposure on the Effects of TiO2 Nanoparticles on Caenorhabditis elegans. Environ. Toxicol. Chem. 2014, 33, 2288–2296. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Wu, Q.; Tang, M.; Wang, D. The in Vivo Underlying Mechanism for Recovery Response Formation in Nano-Titanium Dioxide Exposed Caenorhabditis elegans after Transfer to the Normal Condition. Nanomed. Nanotechnol. Biol. Med. 2014, 10, 89–98. [Google Scholar] [CrossRef] [PubMed]
- Hu, C.; Hou, J.; Zhu, Y.; Lin, D. Multigenerational Exposure to TiO2 Nanoparticles in Soil Stimulates Stress Resistance and Longevity of Survived C. elegans via Activating Insulin/Igf-Like Signaling. Environ. Pollut. 2020, 263, 114376. [Google Scholar] [CrossRef]
- Hu, C.C.; Wu, G.H.; Hua, T.E.; Wagner, O.I.; Yen, T.J. Uptake of TiO2 Nanoparticles into C. elegans Neurons Negatively Affects Axonal Growth and Worm Locomotion Behavior. ACS Appl. Mater. Interfaces 2018, 10, 8485–8495. [Google Scholar] [CrossRef]
- Stiernagle, T. Maintenance of C. elegans. In WormBook: The Online Review of C. elegans Biology; Online; 1999. [Google Scholar]
- Brenner, S. The Genetics of Caenorhabditis elegans. Genetics 1974, 77, 71–94. [Google Scholar] [CrossRef]
- Yang, W.; Li, J.; Hekimi, S. A Measurable Increase in Oxidative Damage Due to Reduction in Superoxide Detoxification Fails to Shorten the Life Span of Long-Lived Mitochondrial Mutants of Caenorhabditis elegans. Genetics 2007, 177, 2063–2074. [Google Scholar] [CrossRef]
- Swain, S.C.; Keusekotten, K.; Baumeister, R.; Stürzenbaum, S.R. C. elegans Metallothioneins: New Insights into the Phenotypic Effects of Cadmium Toxicosis. J. Mol. Biol. 2004, 341, 951–959. [Google Scholar] [CrossRef]
- Imanikia, S.; Hylands, P.; Stürzenbaum, S.R. The Double Mutation of Cytochrome P450’s and Fatty Acid Desaturases Affect Lipid Regulation and Longevity in C. elegans. Biochem. Biophys. Rep. 2015, 2, 172–178. [Google Scholar] [CrossRef] [PubMed]
- Additives, JECFA (Joint FAO/WHO Expert Committee on Food). Thirteenth Report of the Joint Fao/Who Expert Committee on Food Additives. In Specifcations for the Identity and Purity of Food Additives and Their Toxicological Evaluation; World Health Organization: Geneva, Switzerland, 1970; Volume 445. [Google Scholar]
- Hwang, J.S.; Yu, J.; Kim, H.M.; Oh, J.M.; Choi, S.J. Food Additive Titanium Dioxide and Its Fate in Commercial Foods. Nanomaterials 2019, 9, 1175. [Google Scholar] [CrossRef] [PubMed]
- Winkler, H.C.; Notter, T.; Meyer, U.; Naegeli, H. Critical Review of the Safety Assessment of Titanium Dioxide Additives in Food. J. Nanobiotechnol. 2018, 16, 51. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Nouara, A.; Li, Y.; Zhang, M.; Wang, W.; Tang, M.; Ye, B.; Ding, J.; Wang, D. Comparison of Toxicities from Three Metal Oxide Nanoparticles at Environmental Relevant Concentrations in Nematode Caenorhabditis elegans. Chemosphere 2013, 90, 1123–1131. [Google Scholar] [CrossRef]
- Wu, Q.; Wang, W.; Li, Y.; Li, Y.; Ye, B.; Tang, M.; Wang, D. Small Sizes of TiO2-Nps Exhibit Adverse Effects at Predicted Environmental Relevant Concentrations on Nematodes in a Modified Chronic Toxicity Assay System. J. Hazard. Mater. 2012, 243, 161–168. [Google Scholar] [CrossRef]
- Jorgensen, E.M. Gaba. In WormBook: The Online Review of C. elegans Biology; Online; 2005. [Google Scholar]
- Sonane, M.; Moin, N.; Satish, A. The Role of Antioxidants in Attenuation of Caenorhabditis elegans Lethality on Exposure to TiO2 and ZnO Nanoparticles. Chemosphere 2017, 187, 240–247. [Google Scholar] [CrossRef]







| Sample | BET Surface Area (m2/g) | Pore Volume (cm3/g) | Pore Size (nm) | Crystallite Size (nm) |
|---|---|---|---|---|
| C-TiO2 | 49.3 | 0.09 | 8.3 | 19.2 |
| S-TiO2 | 244.1 | 0.25 | 4.8 | 9.5 |
| Toxicological Test | C-TiO2 or S-TiO2 Concentration (mg/L) | Exposure Period (h) | Number of the Exposed or Untreated Nematodes for Each Dose (n) | Observed Effect on Caenorhabditis elegans |
|---|---|---|---|---|
| Physical characteristics Lethality assay | Control 0.01, 0.1, 1.0, and 10 mg/L | 24 h | 50 | Alive or dead |
| Growth measurement | Control 0.01, 0.1, 1.0, and 10 mg/L | 24 h | 30 | Body length |
| Reproductive assay | Control 0.01, 0.1, 1.0, and 10 mg/L | 24 h | 30 | Brood size |
| Locomotion assay | Control 0.01, 0.1, 1.0, and 10 mg/L | 24 h | 30 | Head thrashing Body bending |
| Lifespan assay | Control 0.01, 0.1, 1.0, and 10 mg/L | 24 h | 30 | Longevity |
| Gene expression sod-1, sod-3, ctl-1, and ctl-2 | Control 0.01, 0.1, 1.0, and 10 mg/L | 24 h | 500–1000 | Oxidative stress |
| mlt-1 and mlt-2 | Control 0.01, 0.1, 1.0, and 10 mg/L | 24 h | 500–1000 | Stress response or detoxification of heavy metals |
| cyp35a2 | Control 0.01, 0.1, 1.0, and 10 mg/L | 24 h | 500–1000 | Xenobiotic activity and oxidation |
| Gene Code | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
|---|---|---|
| Caenorhabditis elegans (C. elegans) | ||
| sod-1 | TCAGGTCTCCAACGCGATTT | ACCGGGAGTAAGTCCCTTGA |
| sod-3 | CTCCAAGCACACTCTCCCAG | TCCCTTTCGAAACAGCCTCG |
| ctl-1 | GTGTCGTTCATGCCAAGGGAG | TGGATTGCGTCACGAATGAAG |
| ctl-2 | TCCCAGATGGGTACCGTCAT | GGTCCGAAGAGGCAAGTTGA |
| cyp-35A2 | TCGATTTGTGGATGACTGG | AATGGATGCATGACGTTGAA |
| mtl-1 | AGTGCGGAGACAAATGTGAATGC | AGCAGTTCCCTGGTGTTGATGG |
| mtl-2 | TTGTTCCTGCAACACCGGAA | GTTGGCACACTTGCATCCTC |
| actin-1 a | AGAAGAGCACCCAGTCCTCC | GAAGCGTAGAGGGAGAGGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, S.-T.; Lu, J.-H.; Jualo, S.M.; Tayo, L.L.; Mansor, W.-N.-W.; Lai, Y.-C.; Wang, C.-L.; Chao, H.-R. Titanium Dioxide (TiO2) Nanoparticle Toxicity in a Caenorhabditis elegans Model. Toxics 2023, 11, 989. https://doi.org/10.3390/toxics11120989
Huang S-T, Lu J-H, Jualo SM, Tayo LL, Mansor W-N-W, Lai Y-C, Wang C-L, Chao H-R. Titanium Dioxide (TiO2) Nanoparticle Toxicity in a Caenorhabditis elegans Model. Toxics. 2023; 11(12):989. https://doi.org/10.3390/toxics11120989
Chicago/Turabian StyleHuang, Sen-Ting, Jian-He Lu, Sherwin M. Jualo, Lemmuel L. Tayo, Wan-Nurdiyana-Wan Mansor, Yi-Chieh Lai, Chih-Lung Wang, and How-Ran Chao. 2023. "Titanium Dioxide (TiO2) Nanoparticle Toxicity in a Caenorhabditis elegans Model" Toxics 11, no. 12: 989. https://doi.org/10.3390/toxics11120989
APA StyleHuang, S.-T., Lu, J.-H., Jualo, S. M., Tayo, L. L., Mansor, W.-N.-W., Lai, Y.-C., Wang, C.-L., & Chao, H.-R. (2023). Titanium Dioxide (TiO2) Nanoparticle Toxicity in a Caenorhabditis elegans Model. Toxics, 11(12), 989. https://doi.org/10.3390/toxics11120989

