Acacia Polyphenol Ameliorates Atopic Dermatitis in Trimellitic Anhydride-Induced Model Mice via Changes in the Gut Microbiota
Abstract
:1. Introduction
2. Materials and Methods
2.1. The Preparation of AP
2.2. Animals
2.3. TMA-Induced Atopic Dermatitis
2.4. Treatments
2.5. Scratching Behavior
2.6. Hematoxylin-Eosin (HE) Staining
2.7. Real-Time RT-PCR
2.8. Quantification of Bacteria from Fecal Samples
2.9. Statistical Analysis
3. Results
3.1. Scratching Behavior
3.2. Skin Inflammation
3.3. The Phyla Firmicutes, Bacteroidetes, Proteobacteria, and Actinobacteria
3.4. Bifidobacterium spp., Lactobacillus spp., Bacteroides fragilis, and Clostridium coccoides
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Saavedra, J.M. Use of probiotics in pediatrics: Rationale, mechanisms of action, and practical aspects. Nutr. Clin. Pract. 2007, 22, 351–365. [Google Scholar]
- Kalliomaki, M.; Kirjavainen, P.; Eerola, E.; Kero, P.; Salminen, S.; Isolauri, E. Distinct patterns of neonatal gut microflora in infants in whom atopy was and was not developing. J. Allergy Clin. Immunol. 2001, 107, 129–134. [Google Scholar]
- Di Pierro, F.; Basile, I.; Danza, M.L.; Venturelli, L.; Contini, R.; Risso, P.; Colombo, M. Use of a probiotic mixture containing Bifidobacterium animalis subsp. lactis BB12 and Enterococcus faecium L3 in atopic children. Minerva Pediatr. 2018, 70, 418–424. [Google Scholar]
- Lee, S.H.; Yoon, J.M.; Kim, Y.H.; Jeong, D.G.; Park, S.; Kang, D.J. Therapeutic effect of tyndallized Lactobacillus rhamnosus IDCC 3201 on atopic dermatitis mediated by down-regulation of immunoglobulin E in NC/Nga mice. Microbiol. Immunol. 2016, 60, 468–476. [Google Scholar]
- Matsumoto, M.; Aranami, A.; Ishige, A.; Watanabe, K.; Benno, Y. LKM512 yogurt consumption improves the intestinal environment and induces the T-helper type 1 cytokine in adult patients with intractable atopic dermatitis. Clin. Exp. Allergy 2007, 37, 358–370. [Google Scholar]
- Yeom, M.; Sur, B.J.; Park, J.; Cho, S.G.; Lee, B.; Kim, S.T.; Kim, K.S.; Lee, H.; Hahm, D.H. Oral administration of Lactobacillus casei variety rhamnosus partially alleviates TMA-induced atopic dermatitis in mice through improving intestinal microbiota. J. Appl. Microbiol. 2015, 119, 560–570. [Google Scholar]
- Ikarashi, N.; Ogawa, S.; Hirobe, R.; Kon, R.; Kusunoki, Y.; Yamashita, M.; Mizukami, N.; Kaneko, M.; Wakui, N.; Machida, Y.; et al. Epigallocatechin gallate induces a hepatospecific decrease in the CYP3A expression level by altering intestinal flora. Eur. J. Pharm. Sci. 2017, 100, 211–218. [Google Scholar]
- Ikarashi, N.; Ogawa, S.; Hirobe, R.; Kusunoki, Y.; Kon, R.; Ochiai, W.; Sugiyama, K. High-dose green tea polyphenol intake decreases CYP3A expression in a liver-specific manner with increases in blood substrate drug concentrations. Eur. J. Pharm. Sci. 2016, 89, 137–145. [Google Scholar]
- Ikarashi, N.; Takeda, R.; Ito, K.; Ochiai, W.; Sugiyama, K. The inhibition of lipase and glucosidase activities by acacia polyphenol. Evid. Based Complement. Altern. Med. 2011, 2011, 272075. [Google Scholar]
- Ikarashi, N.; Toda, T.; Hatakeyama, Y.; Kusunoki, Y.; Kon, R.; Mizukami, N.; Kaneko, M.; Ogawa, S.; Sugiyama, K. Anti-hypertensive effects of acacia polyphenol in spontaneously hypertensive rats. Int. J. Mol. Sci. 2018, 19, 700. [Google Scholar]
- Ikarashi, N.; Toda, T.; Okaniwa, T.; Ito, K.; Ochiai, W.; Sugiyama, K. Anti-obesity and anti-diabetic effects of acacia polyphenol in obese diabetic KKAy mice fed high-fat diet. Evid. Based Complement. Altern. Med. 2011, 2011, 952031. [Google Scholar]
- Ikarashi, N.; Sato, W.; Toda, T.; Ishii, M.; Ochiai, W.; Sugiyama, K. Inhibitory effect of polyphenol-rich fraction from the bark of acacia mearnsii on itching associated with allergic dermatitis. Evid. Based Complement. Altern. Med. 2012, 2012, 120389. [Google Scholar]
- Schneider, C.; Docke, W.D.; Zollner, T.M.; Rose, L. Chronic mouse model of TMA-induced contact hypersensitivity. J. Invest. Derm. 2009, 129, 899–907. [Google Scholar]
- Cutting, N.J. The development and application of speciality wattle extracts. J. Soc. Leather Tech. Chem. 1997, 81, 89–93. [Google Scholar]
- Kusano, R.; Ogawa, S.; Matsuo, Y.; Tanaka, T.; Yazaki, Y.; Kouno, I. alpha-Amylase and lipase inhibitory activity and structural characterization of acacia bark proanthocyanidins. J. Nat. Prod. 2011, 74, 119–128. [Google Scholar]
- Matsuo, Y.; Kusano, R.; Ogawa, S.; Yazaki, Y.; Tanaka, T. Characterization of the alpha-Amylase Inhibitory Activity of Oligomeric Proanthocyanidins from Acacia mearnsii Bark Extract. Nat. Prod. Commun. 2016, 11, 1851–1854. [Google Scholar]
- Ogawa, S.; Matsuo, Y.; Tanaka, T.; Yazaki, Y. Utilization of Flavonoid compounds from bark and wood. III. application in health foods. Molecules 2018, 23, 1860. [Google Scholar]
- Bacchetti De Gregoris, T.; Aldred, N.; Clare, A.S.; Burgess, J.G. Improvement of phylum- and class-specific primers for real-time PCR quantification of bacterial taxa. J. Microbiol. Methods 2011, 86, 351–356. [Google Scholar]
- Siefring, S.; Varma, M.; Atikovic, E.; Wymer, L.; Haugland, R.A. Improved real-time PCR assays for the detection of fecal indicator bacteria in surface waters with different instrument and reagent systems. J. Water Health 2008, 6, 225–237. [Google Scholar]
- Queipo-Ortuno, M.I.; Seoane, L.M.; Murri, M.; Pardo, M.; Gomez-Zumaquero, J.M.; Cardona, F.; Casanueva, F.; Tinahones, F.J. Gut microbiota composition in male rat models under different nutritional status and physical activity and its association with serum leptin and ghrelin levels. PLoS ONE 2013, 8, e65465. [Google Scholar]
- Matsuki, T.; Watanabe, K.; Fujimoto, J.; Takada, T.; Tanaka, R. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl. Environ. Microbiol. 2004, 70, 7220–7228. [Google Scholar]
- Byun, R.; Nadkarni, M.A.; Chhour, K.L.; Martin, F.E.; Jacques, N.A.; Hunter, N. Quantitative analysis of diverse Lactobacillus species present in advanced dental caries. J. Clin. Microbiol. 2004, 42, 3128–3136. [Google Scholar]
- Matsuki, T.; Watanabe, K.; Fujimoto, J.; Miyamoto, Y.; Takada, T.; Matsumoto, K.; Oyaizu, H.; Tanaka, R. Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces. Appl. Environ. Microbiol. 2002, 68, 5445–5451. [Google Scholar]
- Verma, A.K.; Verma, R.; Ahuja, V.; Paul, J. Real-time analysis of gut flora in Entamoeba histolytica infected patients of Northern India. BMC Microbiol. 2012, 12, 183. [Google Scholar]
- Nadkarni, M.A.; Martin, F.E.; Jacques, N.A.; Hunter, N. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 2002, 148, 257–266. [Google Scholar]
- Lee, Y.; Choi, H.K.; N’Deh, K.P.U.; Choi, Y.J.; Fan, M.; Kim, E.K.; Chung, K.H.; An, A.J.H. Inhibitory Effect of Centella asiatica Extract on DNCB-Induced Atopic Dermatitis in HaCaT Cells and BALB/c Mice. Nutrients 2020, 12, 411. [Google Scholar]
- Sur, B.; Lee, B.; Yoon, Y.S.; Lim, P.; Hong, R.; Yeom, M.; Lee, H.S.; Park, H.; Shim, I.; Lee, H.; et al. Extract of polygala tenuifolia alleviates stress-exacerbated atopy-like skin dermatitis through the modulation of protein kinase a and p38 mitogen-activated protein kinase signaling pathway. Int. J. Mol. Sci. 2017, 18, 190. [Google Scholar]
- Frank, D.N.; St Amand, A.L.; Feldman, R.A.; Boedeker, E.C.; Harpaz, N.; Pace, N.R. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc. Natl. Acad. Sci. USA 2007, 104, 13780–13785. [Google Scholar]
- Sartor, R.B. Microbial influences in inflammatory bowel diseases. Gastroenterology 2008, 134, 577–594. [Google Scholar]
- Mazmanian, S.K.; Round, J.L.; Kasper, D.L. A microbial symbiosis factor prevents intestinal inflammatory disease. Nature 2008, 453, 620–625. [Google Scholar]
- Sokol, H.; Seksik, P.; Rigottier-Gois, L.; Lay, C.; Lepage, P.; Podglajen, I.; Marteau, P.; Dore, J. Specificities of the fecal microbiota in inflammatory bowel disease. Inflamm. Bowel Dis. 2006, 12, 106–111. [Google Scholar]
- Zheng, H.; Liang, H.; Wang, Y.; Miao, M.; Shi, T.; Yang, F.; Liu, E.; Yuan, W.; Ji, Z.S.; Li, D.K. Altered gut microbiota composition associated with eczema in infants. PLoS ONE 2016, 11, e0166026. [Google Scholar]
- Sakai, H.; Ishida, T.; Sato, K.; Mandokoro, K.; Yabe, S.; Sato, F.; Chiba, Y.; Kon, R.; Ikarashi, N.; Kamei, J. Interference of skin scratching attenuates accumulation of neutrophils in murine allergic contact dermatitis model. Inflammation 2019, 42, 2226–2235. [Google Scholar]
- Ley, R.E.; Turnbaugh, P.J.; Klein, S.; Gordon, J.I. Microbial ecology: Human gut microbes associated with obesity. Nature 2006, 444, 1022–1023. [Google Scholar]
- Turnbaugh, P.J.; Ley, R.E.; Mahowald, M.A.; Magrini, V.; Mardis, E.R.; Gordon, J.I. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 2006, 444, 1027–1031. [Google Scholar]
- Remely, M.; Hippe, B.; Zanner, J.; Aumueller, E.; Brath, H.; Haslberger, A.G. Gut Microbiota of Obese, Type 2 Diabetic Individuals is Enriched in Faecalibacterium prausnitzii, Akkermansia muciniphila and Peptostreptococcus anaerobius after Weight Loss. Endocr. Metab. Immune Disord. Drug Targets 2016, 16, 99–106. [Google Scholar]
- Emoto, T.; Yamashita, T.; Sasaki, N.; Hirota, Y.; Hayashi, T.; So, A.; Kasahara, K.; Yodoi, K.; Matsumoto, T.; Mizoguchi, T.; et al. Analysis of gut microbiota in coronary artery disease patients: A possible link between gut microbiota and coronary artery disease. J. Atheroscler. Thromb. 2016, 23, 908–921. [Google Scholar]
- Mushtaq, N.; Hussain, S.; Zhang, S.; Yuan, L.; Li, H.; Ullah, S.; Wang, Y.; Xu, J. Molecular characterization of alterations in the intestinal microbiota of patients with grade 3 hypertension. Int. J. Mol. Med. 2019, 44, 513–522. [Google Scholar]






| Gene | Forward Primer (5’ to 3’) | Reverse Primer (5’ to 3’) |
|---|---|---|
| TNF-α | ATGGACACCAAACATTTCCTGC | CCAGTGGAGAGCCGATTCC |
| IL-6 | CCCTGACAGACCCGGACTTA | GCCGAGACTGTTGTTCCATAAT |
| iNOS | GGCAGCCTGTGAGACCTTTG | GCATTGGAAGTGAAGCGTTTC |
| COX-2 | CAGGGCCCTTCCTCCCGTAG | GCCTTGGGGGTCAGGGATGA |
| 18S rRNA | GTCTGTGATGCCCTTAGATG | AGCTTATGACCCGCACTTAC |
| Target | Forward Primer (5’ to 3’) | Reverse Primer (5’ to 3’) |
|---|---|---|
| Firmicutes [18] | TGAAACTYAAAGGAATTGACG | ACCATGCACCACCTGTC |
| Bacteroidetes [19] | GGGGTTCTGAGAGGAAGGT | CCGTCATCCTTCACGCTACT |
| Proteobacteria [20] | CATGACGTTACCCGCAGAAGAAG | CTCTACGAGACTCAAGCTTGC |
| Actinobacteria [21] | TGTAGCGGTGGAATGCGC | AATTAAGCCACATGCTCCGCT |
| Lactobacillus spp. [22] | TGGAAACAGRTGCTAATACCG | GTCCATTGTGGAAGATTCCC |
| Bifidobacterium spp. [23] | GGTGTTCTTCCCGATATCTACA | CTCCTGGAAACGGGTGG |
| Bacteroides fragilis [23] | ATAGCCTTTCGAAAGRAAGAT | CCAGTATCAACTGCAATTTTA |
| Clostridium coccoides [24] | GCCACATTGGGACTGAGA | GCTTCTTAGTCAGGTACCG |
| 16S rRNA [25] | TCCTACGGGAGGCAGCAGT | GGACTACCAGGGTATCTAATCCTGTT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ikarashi, N.; Fujitate, N.; Togashi, T.; Takayama, N.; Fukuda, N.; Kon, R.; Sakai, H.; Kamei, J.; Sugiyama, K. Acacia Polyphenol Ameliorates Atopic Dermatitis in Trimellitic Anhydride-Induced Model Mice via Changes in the Gut Microbiota. Foods 2020, 9, 773. https://doi.org/10.3390/foods9060773
Ikarashi N, Fujitate N, Togashi T, Takayama N, Fukuda N, Kon R, Sakai H, Kamei J, Sugiyama K. Acacia Polyphenol Ameliorates Atopic Dermatitis in Trimellitic Anhydride-Induced Model Mice via Changes in the Gut Microbiota. Foods. 2020; 9(6):773. https://doi.org/10.3390/foods9060773
Chicago/Turabian StyleIkarashi, Nobutomo, Natsumi Fujitate, Takumi Togashi, Naoya Takayama, Natsuko Fukuda, Risako Kon, Hiroyasu Sakai, Junzo Kamei, and Kiyoshi Sugiyama. 2020. "Acacia Polyphenol Ameliorates Atopic Dermatitis in Trimellitic Anhydride-Induced Model Mice via Changes in the Gut Microbiota" Foods 9, no. 6: 773. https://doi.org/10.3390/foods9060773
APA StyleIkarashi, N., Fujitate, N., Togashi, T., Takayama, N., Fukuda, N., Kon, R., Sakai, H., Kamei, J., & Sugiyama, K. (2020). Acacia Polyphenol Ameliorates Atopic Dermatitis in Trimellitic Anhydride-Induced Model Mice via Changes in the Gut Microbiota. Foods, 9(6), 773. https://doi.org/10.3390/foods9060773
