You are currently viewing a new version of our website. To view the old version click .
Foods
  • Correction
  • Open Access

14 August 2025

Correction: Yoon et al. Black Wheat Extracts (Arriheuk) Regulate Adipogenesis and Lipolysis via Adenosine Monophosphate (AMP) Activated Protein Kinase (AMPK)/Sirtuin 1 (SIRT1) Signaling Pathways. Foods 2023, 12, 2727

,
,
and
1
Imsil Cheese & Food Research Institute, Doin 2-gil, Seongsu-myeon, Imsil-gun 55918, Republic of Korea
2
National Institute of Crop Science, Rural Development Administration, Wanju 55365, Republic of Korea
3
Non-Clinical Evaluation Center, Biomedical Research Institute, Jeonbuk National University Hospital, Jeonjusi 54907, Republic of Korea
*
Author to whom correspondence should be addressed.
In the original publication [1], there were errors in Table 2 and Figure 4D. In Table 2, the primer sequences for SREBP-1c, PPARγ, FAS, C/EBPα, and β-actin were incorrectly listed or partially omitted. The corrected primer sequences are provided below. In addition, Figure 4D previously contained an incorrect immunofluorescence image for UCP-1/DAPI staining. The corrected figure accurately represents UCP-1 expression in differentiated adipocytes treated with DM, WEA, 50EEA, and 70EEA. These corrections do not affect the scientific conclusions of the article. This correction was approved by the Academic Editor, and the original publication has been updated.
Foods 14 02816 i001
Table 2. Real-time PCR primer sequences.
Table 2. Real-time PCR primer sequences.
GeneSense (5′–3′)Antisense (5′–3′)
SREBP-1cCAAGGCCATCGACTACATCCGCACCACTTCGGGTTTCATGC
PPARγCGCTGATGCACTGCCTATGAAGAGGTCCACAGAGCTGATTCC
FASCTCATCCACTCAGGTTCAGAGGTATGCTCGCTTCTCT
C/EBPαCGCAAGAGCCGAGATAAAGCCACGGCTCAGCTGTTCCA
β-actinAAGACCTCTATGCCAACACCTGCTTGCTGATCCACAT

Reference

  1. Yoon, Y.; Park, M.-K.; Kim, K.-H.; Lee, G.-H. Black Wheat Extracts (Arriheuk) Regulate Adipogenesis and Lipolysis via Adenosine Monophosphate (AMP) Activated Protein Kinase (AMPK)/Sirtuin 1 (SIRT1) Signaling Pathways. Foods 2023, 12, 2727. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.