Effects of Corn–Soybean Meal-Based Fermented Feed Supplementation on Growth Performance, Meat Quality, Fatty Acid Profiles, Nutritional Values, and Gut Microbiota of Lean-Type Finishing Pigs
Abstract
1. Introduction
2. Materials and Methods
2.1. The Preparation of Microbial Fermented Feed
2.2. Animal Feeding and Management
2.3. Sample Collection
2.4. Growth Performance Determination
2.5. Serum Biochemical and Hormonal Assays
2.6. Determination of Meat Quality and Meat Chemical Composition
2.7. Fatty Acid Composition and Nutritional Value
2.8. Real-Time Quantitative PCR Analysis
2.9. DNA Extraction and Sequencing of 16S rDNA
2.10. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Serum Biochemical and Hormonal Analysis
3.3. Meat Quality
3.4. Chemical Composition and Lipid Metabolism-Related RNA Expression
3.5. Muscle Fatty Acid Profiles and Nutritional Values
| Item | Treatment | p-Value | |
|---|---|---|---|
| CON | FF | ||
| DHA + EPA | 0.19 ± 0.02 | 0.17 ± 0.03 | 0.315 |
| PUFAs: SFA | 0.43 ± 0.01 b | 0.48 ± 0.01 a | 0.024 |
| UI | 74.48 ± 3.36 b | 79.93 ± 2.45 a | 0.032 |
| PI | 21.86 ± 1.13 b | 23.84 ± 1.17 a | 0.027 |
| NVI | 2.21 ± 0.15 | 2.29 ± 0.13 | 0.513 |
| HPI | 2.02 ± 0.14 | 2.19 ± 0.15 | 0.264 |
| IA | 0.495 ± 0.02 a | 0.457 ± 0.02 b | 0.018 |
| IT | 1.22 ± 0.02 | 1.12 ± 0.01 | 0.235 |
| HH ratio | 2.22 ± 0.03 | 2.4 ± 0.02 | 0.061 |
3.6. Colonic Microbiota Communities
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Han, Q.; Huang, X.; Yan, F.; Yin, J.; Xiao, Y. The Role of Gut Microbiota in the Skeletal Muscle Development and Fat Deposition in Pigs. Antibiotics 2022, 11, 793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, H.; Chen, S.; Zhou, W.; Xu, J.; Yang, Z.; Guo, L.; Li, Q.; Guo, Q.; Duan, Y.; Li, J.; et al. A Comprehensive Characterization of the Differences in Meat Quality, Nonvolatile and Volatile Flavor Substances Between Taoyuan Black and Duroc Pigs. Foods 2025, 14, 1935. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Razmaite, V.; Šveistienė, R.; Šiukščius, A. Effects of Genotype on Pig Carcass, Meat Quality and Consumer Sensory Evaluation of Loins and Bellies. Foods 2024, 13, 798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, L.; Li, K.; Li, Z.; Huang, X.; Wang, L.; Wang, X.; Di, S.; Cui, S.; Xu, Y. Investigation into Critical Gut Microbes Influencing Intramuscular Fat Deposition in Min Pigs. Animals 2024, 14, 3123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, C.; Xiong, P.; Song, W.; Song, Q.; Hu, Y.; Song, T.; Ji, H.; Chen, X.; Zou, Z. Effects of Fermented Navel Orange Pulp on Growth Performance, Carcass Characteristics, Meat Quality, Meat Nutritional Value, and Serum Biochemical Indicators of Finishing Tibetan Pigs. Foods 2024, 13, 1910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, L.; Chang, Y.; Sun, Z.; Deng, J.; Jin, Y.; Shi, M.; Zhang, J.; Miao, Z. Effects of Chinese Yam Polysaccharide on Intramuscular Fat and Fatty Acid Composition in Breast and Thigh Muscles of Broilers. Foods 2023, 12, 1479. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prates, J.A.M. Enhancing Meat Quality and Nutritional Value in Monogastric Livestock Using Sustainable Novel Feed Ingredients. Foods 2025, 14, 146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, S.; Du, M.; Tu, Y.; You, W.; Chen, W.; Liu, G.; Li, J.; Wang, Y.; Lu, Z.; Wang, T.; et al. Fermented Mixed Feed Alters Growth Performance, Carcass Traits, Meat Quality and Muscle Fatty Acid and Amino Acid Profiles in Finishing Pigs. Anim. Nutr. 2023, 12, 87–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, H.; Azad, M.A.K.; Zhu, Q.; Ni, H.; Kong, X. Fermented Cassava Residue Meal Improves Meat Quality by Regulating Muscle Fiber and Enhancing Lipid Metabolism in Huanjiang Mini-Pigs. Animals 2025, 15, 177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niu, Y.; Zhang, J.F.; Wan, X.L.; Huang, Q.; He, J.T.; Zhang, X.H.; Zhao, L.G.; Zhang, L.L.; Wang, T. Effect of Fermented Ginkgo biloba Leaves on Nutrient Utilisation, Intestinal Digestive Function and Antioxidant Capacity in Broilers. Br. Poult. Sci. 2019, 60, 47–55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, Y.; Tang, J.; Wang, L.; Yang, X.; Jiang, Z. Fermented Corn–Soybean Meal Improved Growth Performance and Reduced Diarrhea Incidence by Modulating Intestinal Barrier Function and Gut Microbiota in Weaned Piglets. Int. J. Mol. Sci. 2024, 25, 3199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, Y.Q.; Li, K.B.; Zhao, X.C.; Liu, S.L.; Wang, L.; Yang, X.F.; Jiang, Z.Y. Fermented Feed Modulates Meat Quality and Promotes the Growth of Longissimus thoracis of Late-Finishing Pigs. Animals 2020, 10, 1682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sarmiento-García, A.; Vieira-Aller, C. Improving Fatty Acid Profile in Native Breed Pigs Using Dietary Strategies: A Review. Animals 2023, 13, 1696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Q.; Xie, K.; Yi, J.; Song, Z.; Zhang, H.; He, X. The Effects of Magnolol Supplementation on Growth Performance, Meat Quality, Oxidative Capacity, and Intestinal Microbiota in Broilers. Poult. Sci. 2022, 101, 101722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.; Kong, B.; Chen, Q. Meat and Meat Products: Explorations of Microbiota, Flavor, and Quality. Foods 2024, 13, 3900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, S.T.; Zhang, Y.; Zhang, Q.; Azeem, R.M.; Jing, Z.; Pan, L.; Sun, W.S.; Zhao, Y.; Zhang, S.M. Breed-Specific Differences of Gut Microbiota and Metabolomic Insights into Fat Deposition and Meat Quality in Chinese Songliao Black Pig and Large White × Landrace Pig Breeds. BMC Microbiol. 2025, 25, 334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, C.; Teng, J.; Wang, X.; Xu, B.; Niu, Y.; Ma, L.; Yan, X. Multi-Omics Analysis Reveals Gut Microbiota-Induced Intramuscular Fat Deposition via Regulating Expression of Lipogenesis-Associated Genes. Anim. Nutr. 2022, 9, 84–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Liu, C.; Kong, Y.; Li, F.; Yue, X. Effects of Intramuscular Fat on Meat Quality and Its Regulation Mechanism in Tan Sheep. Front. Nutr. 2022, 9, 908355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, M.; Li, W.; Yang, S.; Lv, Q.; Yang, J.; Sun, D.; Yang, G.; Zhao, Y.; Zhang, W.; Li, M.; et al. Integrated Multi-Tissue Lipidomics and Transcriptomics Reveal Differences in Lipid Composition Between Mashen and Duroc × (Landrace × Yorkshire) Pigs. Animals 2025, 15, 1280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Wen, J.; Fang, G.Y.; Li, Z.R.; Dong, Z.Y.; Liu, J. The Effects of Raising System on the Lipid Metabolism and Meat Quality Traits of Slow-Growing Chickens. J. Appl. Anim. Res. 2015, 43, 147–152. [Google Scholar] [CrossRef] [Scilit]
- Lan, R.; Wang, Y.; Wang, H.; Zhang, J. Dietary Chitosan Oligosaccharide Supplementation Improves Meat Quality by Improving Antioxidant Capacity and Fiber Characteristics in the Thigh Muscle of Broilers. Antioxidants 2024, 13, 366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, X.; Fang, X.; Li, Y.; Yan, Z.; Zhai, S.; Yang, Y.; Song, J. Effects of Dietary Protein Level on Liver Lipid Deposition, Bile Acid Profile and Gut Microbiota Composition of Growing Pullets. Poult. Sci. 2024, 103, 104183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Wang, J.; Ma, C.; Wang, W.; Wang, H.; Jiang, Y. Comparative Transcriptomic Analysis of mRNAs, miRNAs and lncRNAs in the Longissimus dorsi Muscles between Fat-Type and Lean-Type Pigs. Biomolecules 2022, 12, 1294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Chen, J.F.; Ma, Q.; Mo, D.L.; Sun, J.J.; Ren, Q.L.; Zhang, J.Q.; Lu, Q.X.; Xing, B.S. Identification and Characterization of circRNAs Related to Meat Quality During Embryonic Development of the Longissimus Dorsi Muscle in Two Pig Breeds. Front. Genet. 2022, 13, 1019687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, X.P.; Liu, X.G.; Zhang, K. Effects of Microbial Fermented Feed on Serum Biochemical Profile, Carcass Traits, Meat Amino Acid and Fatty Acid Profile, and Gut Microbiome Composition of Finishing Pigs. Front. Vet. Sci. 2021, 8, 744630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, Y.; He, J.; Zheng, P.; Yu, J.; Pu, J.; Huang, Z.; Mao, X.; Luo, Y.; Luo, J.; Yan, H.; et al. Effects of replacing soybean meal with enzymolysis-fermentation compound protein feed on growth performance, apparent digestibility of nutrients, carcass traits, and meat quality in growing-finishing pigs. J. Anim. Sci. Biotechnol. 2024, 15, 127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ji, M.; Rong, X.; Wu, Y.; Li, H.; Zhao, X.; Zhao, Y.; Guo, X.; Cao, G.; Yang, Y.; Li, B. Effects of Fermented Liquid Feed with Compound Probiotics on Growth Performance, Meat Quality, and Fecal Microbiota of Growing Pigs. Animals 2025, 15, 733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amin, A.B.; Mao, S. Influence of yeast on rumen fermentation, growth performance and quality of products in ruminants: A review. Anim Nutr. 2021, 7, 31–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, J.; Zhang, X.; Liu, Y.; Cao, H.; Han, Q.; Xie, B.; Fan, L.; Li, X.; Hu, J.; Yang, G.; et al. Effect of fermented corn-soybean meal on serum immunity, the expression of genes related to gut immunity, gut microbiota, and bacterial metabolites in grower-finisher pigs. Front. Microbiol. 2019, 10, 2620. [Google Scholar] [CrossRef] [Scilit]
- Ding, X.; Li, H.; Wen, Z.; Hou, Y.; Wang, G.; Fan, J.; Qian, L. Effects of Fermented Tea Residue on Fattening Performance, Meat Quality, Digestive Performance, Serum Antioxidant Capacity, and Intestinal Morphology in Fatteners. Animals 2020, 10, 185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, B.; Zhu, L.; Fu, J.; Li, Z.; Wang, Y.; Jin, M. Overall assessment of fermented feed for pigs: A series of meta-analyses. J. Anim. Sci. 2019, 97, 4810–4821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, H.; Jiang, Z.; Chen, Z.; Liu, G.; Liu, Z. Effects of fermented unconventional protein feed on pig production in China. Front. Vet. Sci. 2024, 11, 1446233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gagaoua, M.; Suman, S.P.; Purslow, P.P.; Lebret, B. The Color of Fresh Pork: Consumers Expectations, Underlying Farm-to-Fork Factors, Myoglobin Chemistry and Contribution of Proteomics to Decipher the Biochemical Mechanisms. Meat Sci. 2023, 206, 109340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, M.; Bai, H.; Wang, R.; Zhao, Y.; Yang, W.; Liu, J.; Zhang, Y.; Jiao, P. Impact of Dietary Lysophospholipids Supplementation on Growth Performance, Meat Quality, and Lipid Metabolism in Finishing Bulls Fed Diets Varying in Fatty Acid Saturation. J. Anim. Sci. Biotechnol. 2025, 16, 7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, H.; Chen, X.; He, J.; Zheng, P.; Luo, Y.; Yu, B.; Chen, D.; Huang, Z. Effects of Dietary Grape Seed Proanthocyanidin Extract Supplementation on Muscle Water-Holding Capacity of Finishing Pigs. Meat Sci. 2025, 227, 109865. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Montaigne, D.; Butruille, L.; Staels, B. PPAR Control of Metabolism and Cardiovascular Functions. Nat. Rev. Cardiol. 2021, 18, 809–823. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yi, W.; Huang, Q.; Wang, Y.; Shan, T. Lipo-Nutritional Quality of Pork: The Lipid Composition, Regulation, and Molecular Mechanisms of Fatty Acid Deposition. Anim. Nutr. 2023, 13, 373–385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, C.; Li, M.; Zhang, Y.; Meng, S.; Yang, Y.; Gao, P.; Guo, X.; Cao, G.; Li, B. Comparative Transcriptome Analyses of Longissimus Thoracis Between Pig Breeds Differing in Muscle Characteristics. Front. Genet. 2020, 11, 526309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodriguez, E.E.; Hamblen, H.; Leal-Gutierrez, J.D.; Carr, C.; Scheffler, T.; Scheffler, J.M.; Mateescu, R.G. Exploring the Impact of Fatty Acid Composition on Carcass and Meat Quality in Bos taurus indicus Influenced Cattle. J. Anim. Sci. 2024, 102, skae306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szabó, R.T.; Kovács-Weber, M.; Zimborán, Á.L.; Kovács, L.; Erdélyi, M. Effects of Short- and Medium-Chain Fatty Acids on Production, Meat Quality, and Microbial Attributes—A Review. Molecules 2023, 28, 4956. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, J.; Wang, M.; Xie, J.; Zhao, M.; Hou, L.; Liang, J.; Wang, S.; Cheng, J. Volatile Flavor Constituents in the Pork Broth of Black-Pig. Food Chem. 2017, 226, 51–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cameron, N.D.; Enser, M.; Nute, G.R.; Whittington, F.M.; Penman, J.C.; Fisken, A.C.; Perry, A.M.; Wood, J.D. Genotype with Nutrition Interaction on Fatty Acid Composition of Intramuscular Fat and the Relationship with Flavour of Pig Meat. Meat Sci. 2000, 55, 187–195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Liu, H. Nutritional Indices for Assessing Fatty Acids: A Mini-Review. Int. J. Mol. Sci. 2020, 21, 5695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, B.; Li, D.; Leng, D.; Kui, H.; Bai, X.; Wang, T. Gut Microbiota and Meat Quality. Front. Microbiol. 2022, 13, 951726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, J.; Li, Y.; Tian, Y.; Zhou, F.; Ma, J.; Xia, S.; Yang, T.; Ma, L.; Zeng, Q.; Liu, G.; et al. Obese Ningxiang Pig-Derived Microbiota Rewires Carnitine Metabolism to Promote Muscle Fatty Acid Deposition in Lean DLY Pigs. Innovation 2023, 4, 100486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, S.F.; Ji, F.; Fan, P.; Denryter, K. Swine Gastrointestinal Microbiota and the Effects of Dietary Amino Acids on Its Composition and Metabolism. Int. J. Mol. Sci. 2024, 25, 1237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, Z.; Deng, D.; Cui, Y.; Chen, W.; Yu, M.; Ma, X. Diet Supplemented with Fermented Okara Improved Growth Performance, Meat Quality, and Amino Acid Profiles in Growing Pigs. Nutr. Food Sci. 2020, 8, 5650–5659. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lei, Y.; Tang, L.; Chen, Q.; Wu, L.; He, W.; Tu, D.; Wang, S.; Chen, Y.; Liu, S.; Xie, Z.; et al. Disulfiram Ameliorates Nonalcoholic Steatohepatitis by Modulating the Gut Microbiota and Bile Acid Metabolism. Nat. Commun. 2022, 13, 6862. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Zhang, W.; Yun, D.; Li, L.; Zhao, W.; Li, Y.; Liu, X.; Liu, Z. Alternate-Day Fasting Alleviates Diabetes-Induced Glycolipid Metabolism Disorders: Roles of FGF21 and Bile Acids. J. Nutr. Biochem. 2020, 83, 108403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peter Dürre, P. Physiology and Sporulation in Clostridium. Microbiol. Spectr. 2014, 2, TBS-0010-2012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, H.; Li, Z.; Zhang, F.; Liu, S.; Jiang, Q.; Chen, J.; Tan, B.; Fan, Z.; Ma, X. Effects of xylanase on growth performance, nutrient digestibility, serum metabolites, and fecal microbiota in growing pigs fed wheat–soybean meal-based diets. J. Anim Sci. 2022, 100, skac270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, W.; Wang, Y.; Li, G.; Xue, S.; Zhang, G.; Dang, Y.; Wang, H. Modulating the gut gut microbiota is involved in the effect of low-molecular-weight Glycyrrhiza polysaccharide on immune function. Gut Microbes 2023, 15, 2276814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niu, J.; Liu, X.; Xu, J.; Li, F.; Wang, J.; Zhang, X.; Yang, X.; Wang, L.; Ma, S.; Li, D.; et al. Effects of Silage Diet on Meat Quality through Shaping Gut Microbiota in Finishing Pigs. Microbiol. Spectr. 2023, 11, e0241622. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Item | CON | FF |
|---|---|---|
| Corn, % | 63.0 | 51.0 |
| Soybean meal, % | 23.5 | 26.0 |
| Wheat bran, % | 9.0 | 9.5 |
| Fermented feed, % | 0 | 10.0 |
| Premix (1), % | 4.0 | 4.0 |
| Total | 100.0 | 100.0 |
| Nutrient level (2) | ||
| Digestible energy, MJ/kg | 13.2 | 13.3 |
| Crude protein, % | 16.5 | 16.5 |
| Lysine, % | 0.90 | 0.92 |
| Calcium, % | 0.75 | 0.78 |
| Available phosphorus, % | 0.32 | 0.33 |
| Gene | Primer | Size/bp | Gene Bank ID |
|---|---|---|---|
| β-actin | Forward: CCACGAAACTACCTTCAACTC Reverse: TGATCTCCTTCTGCATCCTGT | 131 | NM_414396 |
| IGF-1 | Forward: AGCCCACAGCCTACGCCTC Reverse: CTTCTGAGCCTTGGCCATCTC | 179 | NM_101055488 |
| SREBP1c | Forward: GCGACGGTGCCTCTGGTAGT Reverse: CGCAAGACGGCGGATTTA | 218 | NM_214157.1 |
| PPARγ | Forward: CTGACCAAAGCAAAG-GCG Reverse: TGGCG- TAGAGGTCCTTGCG | 162 | NM_214379.1 |
| SCD5 | Forward: GCCACCTTTCTTCGTTACG Reverse: CCTCACCCACAGCTCCCAAT | 142 | NM_125137883 |
| FAT/CD36 | Forward: ACCCTGAGACCCCACACAGTC Reverse: TACAGCTGCCACAGCCAGAT | 156 | NM_733702 |
| Item | Treatment | p-Value | |
|---|---|---|---|
| CON | FF | ||
| Initial body weight, kg | 59.19 ± 2.32 | 59.34 ± 1.27 | 0.827 |
| Final body weight, kg | 112.53 ± 2.41 | 117.64 ± 2.53 | 0.035 |
| ADFI, kg | 2.37 ± 0.02 | 2.38 ± 0.02 | 0.862 |
| ADG, kg | 0.762 ± 0.01 b | 0.819 ± 0.02 a | 0.027 |
| F/G | 3.11 ± 0.03 | 91 ± 0.05 | 0.012 |
| Item | Treatment | p-Value | |
|---|---|---|---|
| CON | FF | ||
| Glucose (mmol/L) | 5.12 ± 1.21 | 5.47 ± 1.18 | 0.174 |
| Total cholesterol (mmol/L) | 2.24 ± 0.13 b | 2.85 ± 0.11 a | 0.042 |
| Triglyceride (mmol/L) | 0.61 ± 0.03 | 0.75 ± 0.04 | 0.093 |
| Insulin (ng/mL) | 25.15 ± 5.18 b | 28.92 ± 6.21 a | 0.008 |
| Leptin (ng/mL) | 31.21 ± 2.13 b | 41.52 ± 2.17 a | 0.036 |
| IGF-1 (ng/mL) | 148 ± 9.26 b | 162 ± 8.69 a | 0.018 |
| Item | Treatment | p-Value | |
|---|---|---|---|
| CON | FF | ||
| pH45min | 6.47 ± 0.06 | 6.38 ± 0.05 | 0.585 |
| pH24h | 5.66 ± 0.04 | 5.73 ± 0.05 | 0.157 |
| ΔpH | 0.81 ± 0.03 a | 0.65 ± 0.03 b | 0.025 |
| Lightness, L*45min | 45.62 ± 1.32 a | 41.63 ± 0.28 b | 0.026 |
| Redness, a*45min | 11.48 ± 0.35 b | 12.16 ± 0.42 a | 0.015 |
| Yellowness, b*45min | 8.74 ± 0.17 a | 8.16 ± 0.21 b | 0.034 |
| Lightness, L*24h | 47.25 ± 1.69 a | 43.18 ± 1.38 b | 0.006 |
| Redness, a*24h | 13.17 ± 0.17 b | 14.65 ± 0.14 a | 0.014 |
| Yellowness, b*24h | 9.36 ± 0.16 a | 8.32 ± 0.15 b | 0.032 |
| ΔE (45 min–24 h) | 2.43 ± 0.09 b | 2.94 ± 0.13 a | 0.015 |
| Drip loss, % | 1.35 ± 0.07 a | 1.22 ± 0.06 b | 0.026 |
| Shear force, kg.f | 2.40 ± 0.02 a | 2.05 ± 0.03 b | 0.022 |
| Marbling scores | 3.3 ± 0.06 b | 3.5 ± 0.05 a | 0.017 |
| Backfat thickness, mm | 3.08 ± 0.11 | 3.14 ± 0.13 | 0.082 |
| Treatment | Moisture | Crude Protein | IMF | Crude Ash |
|---|---|---|---|---|
| CON | 70.30 ± 0.01 | 21.41 ± 0.01 | 3.36 ± 0.01 b | 3.54 ± 0.02 |
| FF | 69.86 ± 0.01 | 21.64 ± 0.01 | 3.79 ± 0.01 a | 3.42 ± 0.01 |
| p-value | 0.592 | 0.724 | 0.005 | 0.862 |
| Item | Treatment | p-Value | |
|---|---|---|---|
| CON | FF | ||
| C10:0 | 0.32 ± 0.01 | 0.26 ± 0.02 | 0.174 |
| C12:0 | 0.063 ± 0.002 | 0.072 ± 0.001 | 0.142 |
| C14:0 | 1.31 ± 0.031 | 1.25 ± 0.048 | 0.093 |
| C16:0 | 22.15 ± 0.18 | 21.92 ± 0.16 | 0.108 |
| C18:0 | 12.21 ± 0.13 a | 11.52 ± 0.17 b | 0.036 |
| C20:0 | 0.24 ± 0.01 | 0.25 ± 0.01 | 0.418 |
| C16:1 | 2.91 ± 0.03 | 2.95 ± 0.05 | 0.237 |
| C18:1n-9 | 36.66 ± 1.69 b | 38.78 ± 1.54 a | 0.006 |
| C20:1 | 0.22 ± 0.001 | 0.23 ± 0.003 | 0.281 |
| C18:2n-6 | 13.53 ± 1.27 b | 14.85 ± 1.61 a | 0.026 |
| C18:3n-3 | 0.46 ± 0.01 | 0.45 ± 0.01 | 0.215 |
| C18:3n-6 | 0.15 ± 0.07 | 0.17 ± 0.03 | 0.127 |
| C20:4n-6 | 1.18 ± 0.03 b | 1.36 ± 0.08 a | 0.017 |
| C20:5n-3 | 0.06 ± 0.01 | 0.05 ± 0.01 | 0.309 |
| C22:6n-3 | 0.13 ± 0.02 | 0.12 ± 0.03 | 0.083 |
| Total saturated fatty acids | 36.29 ± 1.58 a | 35.27 ± 1.73 b | 0.035 |
| Total monounsaturated fatty acids | 39.79 ± 1.75 b | 41.96 ± 2.16 a | 0.015 |
| Total polyunsaturated fatty acids | 15.51 ± 1.36 b | 17.00 ± 1.52 a | 0.031 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, J.; Wang, X.; Cao, Y.; He, Y.; Yang, Y. Effects of Corn–Soybean Meal-Based Fermented Feed Supplementation on Growth Performance, Meat Quality, Fatty Acid Profiles, Nutritional Values, and Gut Microbiota of Lean-Type Finishing Pigs. Foods 2025, 14, 2641. https://doi.org/10.3390/foods14152641
Song J, Wang X, Cao Y, He Y, Yang Y. Effects of Corn–Soybean Meal-Based Fermented Feed Supplementation on Growth Performance, Meat Quality, Fatty Acid Profiles, Nutritional Values, and Gut Microbiota of Lean-Type Finishing Pigs. Foods. 2025; 14(15):2641. https://doi.org/10.3390/foods14152641
Chicago/Turabian StyleSong, Jiao, Xin Wang, Yuhan Cao, Yue He, and Ye Yang. 2025. "Effects of Corn–Soybean Meal-Based Fermented Feed Supplementation on Growth Performance, Meat Quality, Fatty Acid Profiles, Nutritional Values, and Gut Microbiota of Lean-Type Finishing Pigs" Foods 14, no. 15: 2641. https://doi.org/10.3390/foods14152641
APA StyleSong, J., Wang, X., Cao, Y., He, Y., & Yang, Y. (2025). Effects of Corn–Soybean Meal-Based Fermented Feed Supplementation on Growth Performance, Meat Quality, Fatty Acid Profiles, Nutritional Values, and Gut Microbiota of Lean-Type Finishing Pigs. Foods, 14(15), 2641. https://doi.org/10.3390/foods14152641

