AcOTApks Gene-Based Molecular Tools to Improve Quantitative Detection of the Mycotoxigenic Fungus Aspergillus carbonarius
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolates and Media
2.2. DNA Extraction
2.3. Scorpion Probe Obtainment
2.4. AcOTApks Gene-Based Primers and Probes
2.5. qPCR and ddPCR Assays
2.6. Validation of the Assays
2.7. Analysis of AcOTApks Partial Sequences and OTA Quantification
2.8. Statistical Analysis
3. Results
3.1. Scorpion Primer Obtainment
3.2. AcOTApks Primers and Probe
3.3. Evaluation of the Sensitivity
3.3.1. Sensitivity of Scorpion-Based Real-Time qPCR
3.3.2. Sensitivity of AcOTApks-Based Real-Time qPCR
3.3.3. Sensitivity of ddPCR Assay
3.4. Specificity and Evaluation of the Assays on Field Samples
3.5. Further Investigations of the AcOTApks Polymorphisms
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kuiper-Goodman, T.; Scott, P.M. Risk Assessment of the Mycotoxin Ochratoxin A. Biomed. Environ. Sci. 1989, 2, 179–248. [Google Scholar] [PubMed]
- Van Der Merwe, K.J.; Steyn, P.S.; Fourie, L.; Scott, D.B.; Theron, J.J. Ochratoxin A, a Toxic Metabolite Produced by Aspergillus Ochraceus Wilh. Nature 1965, 205, 1112–1113. [Google Scholar] [CrossRef] [PubMed]
- Marquardt, R.R.; Frohlich, A.A. A Review of Recent Advances in Understanding Ochratoxicosis. J. Anim. Sci. 1992, 70, 3968–3988. [Google Scholar] [CrossRef]
- El Khoury, A.; Atoui, A. Ochratoxin A: General Overview and Actual Molecular Status. Toxins 2010, 2, 461–493. [Google Scholar] [CrossRef] [PubMed]
- Pfohl-Leszkowicz, A.; Tozlovanu, M.; Manderville, R.; Peraica, M.; Castegnaro, M.; Stefanovic, V. New Molecular and Field Evidences for the Implication of Mycotoxins but Not Aristolochic Acid in Human Nephropathy and Urinary Tract Tumor. Mol. Nutr. Food Res. 2007, 51, 1131–1146. [Google Scholar] [CrossRef]
- Malir, F.; Ostry, V.; Novotna, E. Toxicity of the Mycotoxin Ochratoxin A in the Light of Recent Data. Toxin Rev. 2013, 32, 19–33. [Google Scholar] [CrossRef]
- Sava, V.; Reunova, O.; Velasquez, A.; Harbison, R.; Sßnchez-Ramos, J. Acute Neurotoxic Effects of the Fungal Metabolite Ochratoxin-A. Neurotoxicology 2006, 27, 82–92. [Google Scholar] [CrossRef]
- Weidenbach, A.; Petzinger, E. Ochratoxin A: Toxicology of an Abundant Mycotoxin. Curr. Top. Pharmacol. 2004, 8, 235–250. [Google Scholar]
- EFSA Panel on Contaminants in the Food Chain (CONTAM); Schrenk, D.; Bodin, L.; Chipman, J.K.; del Mazo, J.; Grasl-Kraupp, B.; Hogstrand, C.; Hoogenboom, L.; Leblanc, J.-C.; Nebbia, C.S.; et al. Risk Assessment of Ochratoxin A in Food. EFSA J. 2020, 18, e06113. [Google Scholar] [CrossRef]
- Battilani, P.; Pietri, A.; Giorni, P.; Kozakiewicz, Z.; Logrieco, A. Ochratoxin A in Wine: Importance of Preharvest Factors in the Spread of Ochratoxin-Producing Fungi and on Toxin Accumulation in Grapes. In Advances in Stored Product Protection. Proceedings of the 8th International Working Conference on Stored Product Protection, York, UK, 22–26 July 2002; CABI Publishing: Wallingford, UK, 2003; pp. 529–532. [Google Scholar] [CrossRef]
- Mateo, R.; Medina, Á.; Mateo, E.M.; Mateo, F.; Jiménez, M. An Overview of Ochratoxin A in Beer and Wine. Int. J. Food Microbiol. 2007, 119, 79–83. [Google Scholar] [CrossRef]
- Ozden, S.; Akdeniz, A.S.; Alpertunga, B. Occurrence of Ochratoxin A in Cereal-Derived Food Products Commonly Consumed in Turkey. Food Control 2012, 25, 69–74. [Google Scholar] [CrossRef]
- Pardo, E.; Marin, S.; Ramos, A.J.; Sanchis, V. Occurrence of Ochratoxigenic Fungi and Ochratoxin A in Green Coffee from Different Origins. Food Sci. Technol. Int. 2004, 10, 45–49. [Google Scholar] [CrossRef]
- Shundo, L.; de Almeida, A.P.; Alaburda, J.; Lamardo, L.C.; Navas, S.A.; Ruvieri, V.; Sabino, M. Aflatoxins and Ochratoxin A in Brazilian Paprika. Food Control 2009, 20, 1099–1102. [Google Scholar] [CrossRef]
- Zimmerli, B.; Dick, R. Ochratoxin A in Table Wine and Grape-juice: Occurrence and Risk Assessment. Food Addit. Contam. 1996, 13, 655–668. [Google Scholar] [CrossRef] [PubMed]
- European Commission. Commission Regulation (EU) 2022/1370 of 5 August 2022 Amending Regulation (EC) No 1881/2006 as Regards Maximum Levels of Ochratoxin A in Certain Foodstuffs. Off. J. Eur. Union 2022, 50, 11–14. [Google Scholar]
- Paterson, R.R.M.; Venâncio, A.; Lima, N.; Guilloux-Bénatier, M.; Rousseaux, S. Predominant Mycotoxins, Mycotoxigenic Fungi and Climate Change Related to Wine. Food Res. Int. 2018, 103, 478–491. [Google Scholar] [CrossRef]
- Grazioli, B.; Fumi, M.D.; Silva, A. The Role of Processing on Ochratoxin A Content in Italian Must and Wine: A Study on Naturally Contaminated Grapes. Int. J. Food Microbiol. 2006, 111, S93–S96. [Google Scholar] [CrossRef] [PubMed]
- Lasram, S.; Mani, A.; Zaied, C.; Chebil, S.; Abid, S.; Bacha, H.; Mliki, A.; Ghorbel, A. Evolution of Ochratoxin A Content during Red and Rose Vinification. J. Sci. Food Agric. 2008, 88, 1696–1703. [Google Scholar] [CrossRef]
- Battilani, P.; Giorni, P.; Pietri, A. Epidemiology of Toxin-Producing Fungi and Ochratoxin A Occurrence in Grape. In Epidemiology of Mycotoxin Producing Fungi; Xu, X., Bailey, J.A., Cooke, B.M., Eds.; Springer: Berlin/Heidelberg, Germany, 2003; pp. 715–722. ISBN 978-90-481-6387-8. [Google Scholar]
- Magnoli, C.; Violante, M.; Combina, M.; Palacio, G.; Dalcero, A. Mycoflora and Ochratoxin-Producing Strains of Aspergillus Section Nigri in Wine Grapes in Argentina. Lett. Appl. Microbiol. 2003, 37, 179–184. [Google Scholar] [CrossRef] [PubMed]
- Rosa, C.A.D.R.; Palacios, V.; Combina, M.; Fraga, M.E.; Rekson, A.D.O.; Magnoli, C.E.; Dalcero, A.M. Potential Ochratoxin A Producers from Wine Grapes in Argentina and Brazil. Food Addit. Contam. 2002, 19, 408–414. [Google Scholar] [CrossRef]
- Sage, L.; Krivobok, S.; Delbos, É.; Seigle-Murandi, F.; Creppy, E.E. Fungal Flora and Ochratoxin A Production in Grapes and Musts from France. J. Agric. Food Chem. 2002, 50, 1306–1311. [Google Scholar] [CrossRef] [PubMed]
- Bellí, N.; Pardo, E.; Marín, S.; Farré, G.; Ramos, A.J.; Sanchis, V. Occurrence of Ochratoxin A and Toxigenic Potential of Fungal Isolates from Spanish Grapes. J. Sci. Food Agric. 2004, 84, 541–546. [Google Scholar] [CrossRef]
- Cabañes, F.J.; Accensi, F.; Bragulat, M.R.; Abarca, M.L.; Castellá, G.; Minguez, S.; Pons, A. What Is the Source of Ochratoxin A in Wine? Int. J. Food Microbiol. 2002, 79, 213–215. [Google Scholar] [CrossRef] [PubMed]
- Castellá, G.; Bragulat, M.R.; Puig, L.; Sanseverino, W.; Cabañes, F.J. Genomic Diversity in Ochratoxigenic and Non Ochratoxigenic Strains of Aspergillus carbonarius. Sci. Rep. 2018, 8, 5439. [Google Scholar] [CrossRef] [PubMed]
- Palumbo, J.D.; O’keeffe, T.L.; Ho, Y.S.; Fidelibus, M.W. Population Dynamics of Aspergillus Section Nigri Species on Vineyard Samples of Grapes and Raisins. J. Food Prot. 2016, 79, 448–453. [Google Scholar] [CrossRef] [PubMed]
- Pollastro, S.; Dongiovanni, C.; De Miccolis Angelini, R.M.; Abbatecola, A.; de Guido, M.A.; Lepore, A.; Natale, P.; Miazzi, M.; Perrelli, D.; Pastore, C.; et al. Occurrence and distribution of ochratoxin-producing fungi in vineyards in South of Italy. In Proceedings of the Atti International Workshop: Ochratoxin A in Grapes and Wine: Prevention and Control, Marsala, Italy, 20–21 October 2005; p. 61. [Google Scholar]
- Wang, L.; Hua, X.; Shi, J.; Jing, N.; Ji, T.; Lv, B.; Liu, L.; Chen, Y. Ochratoxin A: Occurrence and Recent Advances in Detoxification. Toxicon 2022, 210, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Pollastro, S.; De Miccolis Angelini, R.M.; Faretra, F. A New Semi-Selective Medium for the Ochratoxigenic Fungus Aspergillus carbonarius. J. Plant Pathol. 2006, 88, 107–112. [Google Scholar]
- Perrone, G.; Susca, A.; Stea, G.; Mulè, G. PCR Assay for Identification of Aspergillus carbonarius and Aspergillus japonicus. In Molecular Diversity and PCR-Detection of Toxigenic Fusarium Species and Ochratoxigenic Fungi; Mulè, G., Bailey, J.A., Cooke, B.M., Logrieco, A., Eds.; Springer: Berlin/Heidelberg, Germany, 2004; pp. 641–649. ISBN 978-90-481-6631-2. [Google Scholar]
- Mulè, G.; Susca, A.; Logrieco, A.; Stea, G.; Visconti, A. Development of a Quantitative Real-Time PCR Assay for the Detection of Aspergillus carbonarius in Grapes. Int. J. Food Microbiol. 2006, 111, S28–S34. [Google Scholar] [CrossRef] [PubMed]
- Palumbo, J.D.; O’Keeffe, T.L.; Fidelibus, M.W. Characterization of Aspergillus Section Nigri Species Populations in Vineyard Soil Using Droplet Digital PCR. Lett. Appl. Microbiol. 2016, 63, 458–465. [Google Scholar] [CrossRef]
- Bhat, S.; Herrmann, J.; Armishaw, P.; Corbisier, P.; Emslie, K.R. Single Molecule Detection in Nanofluidic Digital Array Enables Accurate Measurement of DNA Copy Number. Anal. Bioanal. Chem. 2009, 394, 457–467. [Google Scholar] [CrossRef]
- Corbisier, P.; Bhat, S.; Partis, L.; Rui Dan Xie, V.; Emslie, K.R. Absolute Quantification of Genetically Modified MON810 Maize (Zea Mays L.) by Digital Polymerase Chain Reaction. Anal. Bioanal. Chem. 2010, 396, 2143–2150. [Google Scholar] [CrossRef]
- Yang, R.; Paparini, A.; Monis, P.; Ryan, U. Comparison of Next-Generation Droplet Digital PCR (ddPCR) with Quantitative PCR (qPCR) for Enumeration of Cryptosporidium Oocysts in Faecal Samples. Int. J. Parasitol. 2014, 44, 1105–1113. [Google Scholar] [CrossRef]
- Mazaika, E.; Homsy, J. Digital Droplet PCR: CNV Analysis and Other Applications. Curr. Protoc. Hum. Genet. 2014, 82, 7–24. [Google Scholar] [CrossRef]
- Pinheiro, L.B.; Coleman, V.A.; Hindson, C.M.; Herrmann, J.; Hindson, B.J.; Bhat, S.; Emslie, K.R. Evaluation of a Droplet Digital Polymerase Chain Reaction Format for DNA Copy Number Quantification. Anal. Chem. 2012, 84, 1003–1011. [Google Scholar] [CrossRef]
- Whale, A.S.; Cowen, S.; Foy, C.A.; Huggett, J.F. Methods for Applying Accurate Digital PCR Analysis on Low Copy DNA Samples. PLoS ONE 2013, 8, e58177. [Google Scholar] [CrossRef]
- Ferrara, M.; Perrone, G.; Gambacorta, L.; Epifani, F.; Solfrizzo, M.; Gallo, A. Identification of a Halogenase Involved in the Biosynthesis of Ochratoxin A in Aspergillus carbonarius. Appl. Environ. Microbiol. 2016, 82, 5631–5641. [Google Scholar] [CrossRef] [PubMed]
- Ferrara, M.; Gallo, A.; Perrone, G.; Magistà, D.; Baker, S.E. Comparative Genomic Analysis of Ochratoxin A Biosynthetic Cluster in Producing Fungi: New Evidence of a Cyclase Gene Involvement. Front. Microbiol. 2020, 11, 581309. [Google Scholar] [CrossRef] [PubMed]
- Gallo, A.; Bruno, K.S.; Solfrizzo, M.; Perrone, G.; Mulè, G.; Visconti, A.; Baker, S.E. New Insight into the Ochratoxin A Biosynthetic Pathway through Deletion of a Nonribosomal Peptide Synthetase Gene in Aspergillus carbonarius. Appl. Environ. Microbiol. 2012, 78, 8208–8218. [Google Scholar] [CrossRef]
- Gallo, A.; Knox, B.P.; Bruno, K.S.; Solfrizzo, M.; Baker, S.E.; Perrone, G. Identification and Characterization of the Polyketide Synthase Involved in Ochratoxin A Biosynthesis in Aspergillus carbonarius. Int. J. Food Microbiol. 2014, 179, 10–17. [Google Scholar] [CrossRef]
- Gerin, D.; Garrapa, F.; Ballester, A.-R.; González-Candelas, L.; De Miccolis Angelini, R.M.; Faretra, F.; Pollastro, S. Functional Role of Aspergillus carbonarius AcOTAbZIP Gene, a bZIP Transcription Factor within the OTA Gene Cluster. Toxins 2021, 13, 111. [Google Scholar] [CrossRef]
- O’Callaghan, J.; Caddick, M.X.; Dobson, A.D.W. A Polyketide Synthase Gene Required for Ochratoxin A Biosynthesis in Aspergillus ochraceus. Microbiology 2003, 149, 3485–3491. [Google Scholar] [CrossRef]
- Bacha, N.; Atoui, A.; Mathieu, F.; Liboz, T.; Lebrihi, A. Aspergillus westerdijkiae Polyketide Synthase Gene “Aoks1” Is Involved in the Biosynthesis of Ochratoxin A. Fungal Genet. Biol. 2009, 46, 77–84. [Google Scholar] [CrossRef] [PubMed]
- Pollastro, S.; Dongiovanni, C.; Miccolis Angelini, R.M.; Abbatecola, A.; Natale, P.; Guido, M.A.; Faretra, F. Grape Rot and Contamination of Wine by Ochratoxin A [Vitis Vinifera L.; Southern Italy]. Inf. Fitopatol. Italy 2005, 55, 15–21. [Google Scholar]
- De Miccolis Angelini, R.M.; Habib, W.; Rotolo, C.; Pollastro, S.; Faretra, F. Selection, Characterization and Genetic Analysis of Laboratory Mutants of Botryotinia Fuckeliana (Botrytis Cinerea) Resistant to the Fungicide Boscalid. Eur. J. Plant Pathol. 2010, 128, 185–199. [Google Scholar] [CrossRef]
- Hoffman, C.S.; Winston, F. A Ten-Minute DNA Preparation from Yeast Efficiently Releases Autonomous Plasmids for Transformaion of Escherichia coli. Gene 1987, 57, 267–272. [Google Scholar] [CrossRef] [PubMed]
- Pollastro, S.; Dongiovanni, C.; Faretra, F.; De Guido, M.A.; De Miccolis Angelini, R.M.; Abbatecola, A. Specific SCAR primers for fungi associated with wood decay of grapevine. Phytopathol. Mediterr. 2001, 40 (Suppl. S2001), 1000–1007. [Google Scholar]
- Gerin, D.; De Miccolis Angelini, R.M.; Pollastro, S.; Faretra, F. RNA-Seq Reveals OTA-Related Gene Transcriptional Changes in Aspergillus carbonarius. PLoS ONE 2016, 11, e0147089. [Google Scholar] [CrossRef]
- Pfohl-Leszkowicz, A. Ochratoxin A and Aristolochic Acid Involvement in Nephropathies and Associated Urothelial Tract Tumours. Arh. Hig. Rada Toksikol. 2009, 60, 465–483. [Google Scholar] [CrossRef]
- Bellver Soto, J.; Fernández-Franzón, M.; Ruiz, M.-J.; Juan-García, A. Presence of Ochratoxin A (OTA) Mycotoxin in Alcoholic Drinks from Southern European Countries: Wine and Beer. J. Agric. Food Chem. 2014, 62, 7643–7651. [Google Scholar] [CrossRef]
- Torović, L.; Lakatoš, I.; Majkić, T.; Beara, I. Risk to Public Health Related to the Presence of Ochratoxin A in Wines from Fruška Gora. LWT 2020, 129, 109537. [Google Scholar] [CrossRef]
- Mariño-Repizo, L.; Gargantini, R.; Manzano, H.; Raba, J.; Cerutti, S. Assessment of ochratoxin A occurrence in Argentine red wines using a novel sensitive quechers-solid phase extraction approach prior to ultra high performance liquid chromatography-tandem mass spectrometry methodology. J. Sci. Food Agric. 2017, 97, 2487–2497. [Google Scholar] [CrossRef]
- De Jesus, C.L.; Bartley, A.; Welch, A.Z.; Berry, J.P. High Incidence and Levels of Ochratoxin A in Wines Sourced from the United States. Toxins 2018, 10, 1. [Google Scholar] [CrossRef] [PubMed]
- Comuzzo, P.; Rauhut, D.; Werner, M.; Lagazio, C.; Zironi, R. A Survey on Wines from Organic Viticulture from Different European Countries. Food Control 2013, 34, 274–282. [Google Scholar] [CrossRef]
- Ohana-Levi, N.; Netzer, Y. Long-Term Trends of Global Wine Market. Agriculture 2023, 13, 224. [Google Scholar] [CrossRef]
- Gil-Serna, J.; Vázquez, C.; González-Jaén, M.T.; Patiño, B. Wine Contamination with Ochratoxins: A Review. Beverages 2018, 4, 6. [Google Scholar] [CrossRef]
- Ding, L.; Han, M.; Wang, X.; Guo, Y. Ochratoxin A: Overview of Prevention, Removal, and Detoxification Methods. Toxins 2023, 15, 565. [Google Scholar] [CrossRef]
- Palumbo, J.D.; Sarreal, S.B.L.; Kim, J.H. Simultaneous Detection of Mycotoxigenic Aspergillus Species of Sections Circumdati and Flavi Using Multiplex Digital PCR. Lett. Appl. Microbiol. 2023, 76, ovad142. [Google Scholar] [CrossRef]
- Lucchetta, G.; Bazzo, I.; Cortivo, G.D.; Stringher, L.; Bellotto, D.; Borgo, M.; Angelini, E. Occurrence of Black Aspergilli and Ochratoxin A on Grapes in Italy. Toxins 2010, 2, 840–855. [Google Scholar] [CrossRef]
- Tessonnière, H.; Vidal, S.; Barnavon, L.; Alexandre, H.; Remize, F. Design and Performance Testing of a Real-Time PCR Assay for Sensitive and Reliable Direct Quantification of Brettanomyces in Wine. Int. J. Food Microbiol. 2009, 129, 237–243. [Google Scholar] [CrossRef]
- Wang, X.; Glawe, D.A.; Weller, D.M.; Okubara, P.A. Real-Time PCR Assays for the Quantification of Native Yeast DNA in Grape Berry and Fermentation Extracts. J. Microbiol. Methods 2020, 168, 105794. [Google Scholar] [CrossRef] [PubMed]
- Hindson, B.J.; Ness, K.D.; Masquelier, D.A.; Belgrader, P.; Heredia, N.J.; Makarewicz, A.J.; Bright, I.J.; Lucero, M.Y.; Hiddessen, A.L.; Legler, T.C.; et al. High-Throughput Droplet Digital PCR System for Absolute Quantitation of DNA Copy Number. Anal. Chem. 2011, 83, 8604–8610. [Google Scholar] [CrossRef]
- del Pilar Martínez-Diz, M.; Andrés-Sodupe, M.; Berbegal, M.; Bujanda, R.; Díaz-Losada, E.; Gramaje, D. Droplet Digital PCR Technology for Detection of Ilyonectria Liriodendri from Grapevine Environmental Samples. Plant Dis. 2020, 104, 1144–1150. [Google Scholar] [CrossRef] [PubMed]
- Kim, W.-B.; Park, C.; Cho, S.-Y.; Chun, H.-S.; Lee, D.-G. Development of Multiplex Real-Time PCR for Rapid Identification and Quantitative Analysis of Aspergillus Species. PLoS ONE 2020, 15, e0229561. [Google Scholar] [CrossRef] [PubMed]
- Poh, T.Y.; Ali, N.A.B.M.; Chan, L.L.; Tiew, P.Y.; Chotirmall, S.H. Evaluation of Droplet Digital Polymerase Chain Reaction (ddPCR) for the Absolute Quantification of Aspergillus Species in the Human Airway. Int. J. Mol. Sci. 2020, 21, 3043. [Google Scholar] [CrossRef]
- Raguseo, C.; Gerin, D.; Pollastro, S.; Rotolo, C.; Rotondo, P.R.; Faretra, F.; De Miccolis Angelini, R.M. A Duplex-Droplet Digital PCR Assay for Simultaneous Quantitative Detection of Monilinia Fructicola and Monilinia Laxa on Stone Fruits. Front. Microbiol. 2021, 12, 747560. [Google Scholar] [CrossRef]
- Zhao, Y.; Xia, Q.; Yin, Y.; Wang, Z. Comparison of Droplet Digital PCR and Quantitative PCR Assays for Quantitative Detection of Xanthomonas Citri Subsp. Citri. PLoS ONE 2016, 11, e0159004. [Google Scholar] [CrossRef] [PubMed]
- Mellikeche, W.; Ricelli, A.; Casini, G.; Gallo, M.; Baser, N.; Colelli, G.; D’Onghia, A.M. Development of Loop-Mediated Isothermal Amplification (LAMP) Assays for the Rapid Detection of Toxigenic Aspergillus Flavus and A. Carbonarius in Nuts. Int. J. Mol. Sci. 2024, 25, 3809. [Google Scholar] [CrossRef] [PubMed]
- Dingle, T.C.; Sedlak, R.H.; Cook, L.; Jerome, K.R. Tolerance of Droplet-Digital PCR vs Real-Time Quantitative PCR to Inhibitory Substances. Clin. Chem. 2013, 59, 1670–1672. [Google Scholar] [CrossRef] [PubMed]
- Maheshwari, Y.; Selvaraj, V.; Hajeri, S.; Yokomi, R. Application of Droplet Digital PCR for Quantitative Detection of Spiroplasma Citri in Comparison with Real Time PCR. PLoS ONE 2017, 12, e0184751. [Google Scholar] [CrossRef]
- Bertinelli, G.; Tizzani, L.; Luigi, M.; Monticelli, S.; Ilardi, V. Development and Validation of One-Step Reverse Transcription-Droplet Digital PCR for Plum Pox Virus Detection and Quantification from Plant Purified RNA and Crude Extract. Plants 2024, 13, 3276. [Google Scholar] [CrossRef] [PubMed]




| Set No. | Name | Sequence (5′-3′) | Amplicon Size (bp) |
|---|---|---|---|
| 1 | AcOTApks-F1 | CCACGAGTACGACCGAGTCAA | 101 |
| AcOTApks-R1 | CACTTGCCATGGCCGATT | ||
| AcOTApks-P1 | FAM-TGACCGCATTCCAC-BHQ1 | ||
| 2 | AcOTApks-F2 | ACGAGGGCGTCAACGAGAT | 101 |
| AcOTApks-R2 | CCCATAACGGGACGAGTAGATG | ||
| AcOTApks-P2 | FAM-ACCCAGCATGTCTGCA- BHQ1 | ||
| 3 | AcOTApks-F3 | GACCAGGAGTTGCGGAAT | 60 |
| AcOTApks-R3 | CTCGTCGGTGTCGTCAA | ||
| AcOTApks-P3 | FAM-CGGTCTTCAATCCCGGCTTCTT- BHQ1 | ||
| - | Seq-F1 | ACCTCATGTGTTCCCCTCTG | 570 |
| Seq-R1 | GCAGAATAAAATTGACGCCGTC | ||
| - | Scorpion Probe | FAM-GCCGCATTCCCTGCATTGCATTGCAATTGAGGCGGC76GTGTATCCTGCTCTGAATCC-3′ | 157 |
| OPA-3519C-Rev | CTATCAACCTCGACTACTTCC |
| RAPD Marker | Primer Couple | Primer Sequence | Expected Product | |
|---|---|---|---|---|
| Forward (5′→3′) | Reverse (5′→3′) | Length (bp) | ||
| OPA-2800 | A | TTTCTCCTATCTACTCCGTACC | CACCTATCAATGTCTGACACC | 112 |
| B | TCCTATCTACTCCGTACC | CTATCAATGTCTGACACC | 105 | |
| C | CTTTTTCTCCTATCTACTCC | CTATCAATGTCTGACACC | 112 | |
| D | GTGTTTTTCTCCTATCTACTCC | ATACTCAAGCTATGCATCC | 478 | |
| OPA-3519 | A | GCAGAGATCCTTAGATCC | AAGCTACGAGTAAACATCC | 145 |
| B | TGTATCCTGCTCTGATCC | TCAACCTCGACTACTTCC | 153 | |
| C | GTGTATCCTGCTCTGATCC | CTATCAACCTCGACTACTTCC | 157 | |
| D | CACAGCAGAGATCCTTAGATCC | AGACTCTCATCAATTATCGACG | 308 | |
| OPA-9720 | A | TGAGTAAGAGTATCGTGGTGGGGG | TTGGGGTGTTCAATCCAGGGTC | 150 |
| B | TGACCCTGGATTGAACACC | GACCATGATTACGCCAAGC | 173 | |
| C | ACACCCCAACATTATTAGG | TTTCACACAGGAAACAGC | 180 | |
| D | TGACCCTGGATTGAACACC | GACCATGATTACGCCAAGC | 293 | |
| E | GGAATTCGATTGTGTGCC | AAATGTAGGCCCCAACTC | 119 | |
| F | GAGTTGGGGCCTACATTT | CCAGGGTCATGAAACACC | 299 | |
| Assay | Correlation Coefficient (r) |
|---|---|
| Scorpion qPCR | +0.86 * |
| AcOTApks qPCR | +0.81 * |
| AcOTApks ddPCR | +0.81 * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Agnusdei, A.; De Miccolis Angelini, R.M.; Faretra, F.; Pollastro, S.; Gerin, D. AcOTApks Gene-Based Molecular Tools to Improve Quantitative Detection of the Mycotoxigenic Fungus Aspergillus carbonarius. Foods 2025, 14, 65. https://doi.org/10.3390/foods14010065
Agnusdei A, De Miccolis Angelini RM, Faretra F, Pollastro S, Gerin D. AcOTApks Gene-Based Molecular Tools to Improve Quantitative Detection of the Mycotoxigenic Fungus Aspergillus carbonarius. Foods. 2025; 14(1):65. https://doi.org/10.3390/foods14010065
Chicago/Turabian StyleAgnusdei, Angelo, Rita Milvia De Miccolis Angelini, Francesco Faretra, Stefania Pollastro, and Donato Gerin. 2025. "AcOTApks Gene-Based Molecular Tools to Improve Quantitative Detection of the Mycotoxigenic Fungus Aspergillus carbonarius" Foods 14, no. 1: 65. https://doi.org/10.3390/foods14010065
APA StyleAgnusdei, A., De Miccolis Angelini, R. M., Faretra, F., Pollastro, S., & Gerin, D. (2025). AcOTApks Gene-Based Molecular Tools to Improve Quantitative Detection of the Mycotoxigenic Fungus Aspergillus carbonarius. Foods, 14(1), 65. https://doi.org/10.3390/foods14010065

