Next Article in Journal
Differences and Mechanism of Waxy Corn Starch and Normal Corn Starch in the Preparation of Recrystallized Resistant Starch (RS3)
Previous Article in Journal
Brown Seaweed Byproduct Extracts Improve Intestinal Motility and Auto-Inflammation in Mice with Loperamide-Induced Constipation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 13
Issue 13
10.3390/foods13132038
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Heterologous Expression of Genes Related L–Malic acid Metabolism in Saccharomyces uvarum on Flavor Substances Production in Wine

by
Ping Li
1,*,
Wenjun Song
1,
Yumeng Wang
1,
Xin Li
1,
Shankai Wu
1,
Bingjuan Li
1 and
Cuiying Zhang
2,*
1
College of Biotechnology and Food Science, Tianjin University of Commerce, Tianjin 300134, China
2
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, Tianjin Key Laboratory of Industrial Microbiology, College of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457, China
*
Authors to whom correspondence should be addressed.
Foods 2024, 13(13), 2038; https://doi.org/10.3390/foods13132038
Submission received: 30 May 2024 / Revised: 16 June 2024 / Accepted: 25 June 2024 / Published: 27 June 2024
(This article belongs to the Section Drinks and Liquid Nutrition)
Browse Figures
Versions Notes

Abstract

During malolactic fermentation (MLF) of vinification, the harsh L–malic acid undergoes transformation into the milder L–lactic acid, and via decarboxylation reactions it is catalyzed by malolactic enzymes in LAB. The use of bacterial malolactic starter cultures, which usually present challenges in the industry as the suboptimal conditions after alcoholic fermentation (AF), including nutrient limitations, low temperatures, acidic pH levels, elevated alcohol, and sulfur dioxide concentrations after AF, lead to “stuck” or “sluggish” MLF and spoilage of wines. Saccharomyces uvarum has interesting oenological properties and provides a stronger aromatic intensity than Saccharomyces cerevisiae in AF. In the study, the biological pathways of deacidification were constructed in S. uvarum, which made the S. uvarum carry out the AF and MLF simultaneously, as different genes encoding malolactic enzyme (mleS or mleA), malic enzyme (MAE2), and malate permease (melP or MAE1) from Schizosaccharomyces pombe, Lactococcus lactis, Oenococcus oeni, and Lactobacillus plantarum were heterologously expressed. For further inquiry, the effect of L–malic acid metabolism on the flavor balance in wine, the related flavor substances, higher alcohols, and esters production, were detected. Of all the recombinants, the strains WYm1SN with coexpression of malate permease gene MAE1 from S. pombe and malolactic enzyme gene mleS from L. lactis and WYm1m2 with coexpression of gene MAE1 and malate permease gene MAE2 from S. pombe could reduce the L–malic acid contents to about 1 g/L, and in which the mutant WYm1SN exhibited the best effect on the flavor quality improvement.

1. Introduction

The winemaking process usually involves alcoholic fermentation (AF) performed by Saccharomyces cerevisiae or other non-Saccharomyces yeasts and malolactic fermentation (MLF) driven by lactic acid bacteria (LAB) for most red and some white wines [1,2,3]. Grapes and certain wines undergoing AF harbor a diverse array of organic acids that exert a profound influence on the overall quality and flavor profile of the wine. Among these organic acids, malic acid and tartaric acid collectively constitute a substantial majority, ranging from 70% to 90%. Tartaric acid is regarded as the main contributor to wine acidity and was not metabolized by grape berry cells via respiration in the same manner as malic acid, predominantly existing in the wine matrix as potassium tartrate and potassium hydrogen tartrate, with only a minor fraction susceptible to conversion into lactic and acetic acid during MLF. Specifically, the harsh and astringent malic acid exhibits instability and is susceptible to rapid decomposition by microorganisms, ultimately leading to quality-related concerns [4,5,6,7,8]. It is imperative to conduct the pivotal process of MLF, during which the tart L–malic acid undergoes transformation into the milder L–lactic acid and carbon dioxide via a decarboxylation reaction catalyzed by malolactic enzymes in LAB, enhancing organoleptic balance and bolstering bacteriological stability in the wine. Hence, the malic acid content serves as a crucial indicator of fermentation completion, with a widely accepted guideline specifying that wines should have a malic acid content of less than 1 g/L [9,10]. The MLF process, on the other hand, presents challenges in terms of control due to various suboptimal physicochemical conditions, including nutrient limitations, low temperatures, acidic pH levels, elevated alcohol, and sulfur dioxide concentrations, competition with yeast and other bacterial strains, as well as susceptibility to bacteriophage infections. Additionally, MLF can give rise to undesirable metabolites, such as biogenic amines and ethyl carbamate by LAB [11,12,13].
Several approaches including blending, carbonate additions, precipitation, dilution, and carbonic maceration have been carried out to reduce the acidity of grape must or wine [14,15,16]. Saccharomyces are unable to efficiently metabolize malate due to their deficiency in an active malate permease responsible for the transport of extracellular malate [17]. During MLF, LAB facilitate deacidification by catalyzing the conversion of L-malate into L-lactate and CO2, which is chiefly mediated through malolactic enzyme (MLE) encoding by the gene mleS or mleA, and the malate transporter encoded by the gene mleP [18,19]. Schizosaccharomyces pombe has also demonstrated significant capability in reducing malic acid levels. S. pombe converted L-malate from must into ethanol and CO2, which is facilitated by the active transport of L–malic acid into the cells using an H+-symport system, driven by the activity of the malate permease (MAE1). Subsequently, the cytosolic malic enzyme (MAE2) catalyzes the oxidative decarboxylation of L-malate into pyruvate and CO2; pyruvate is further metabolized into ethanol and other flavors [20,21]. Therefore, the researchers endeavored to engineer malolactic pathways in S. cerevisiae by introducing constitutive expressions of the heterologous malolactic enzyme or malate transporter. Additionally, the recombinants exhibited varying degrees of malate decarboxylation during AF in wine. Bony et al. obtained a malolactic S. cerevisiae through the coexpression of the Sz. pombe malate transport gene (MAE1) and the Lactococcus lactis malolactic enzyme gene (mleS) under the control of promoter PGK1, leading to efficient decarboxylation 3 g/L of malate within a 3-day period [22]. Volschenk et al. demonstrated that a strain of S. cerevisiae containing the Sz. pombe malate permease (MAE1) and malic enzyme (MAE2) genes integrated in the genome efficiently degraded 5 g/L of L–malic acid in synthetic and Chenin Blanc grape musts [23]. Husnik et al. constructed a genetically stable industrial strain of S. cerevisiae by integrating a linear cassette containing the Sz pombe MAE1 and the Oenococcus oeni malolactic gene mleA, resulting in fully decarboxylated 5.5 g/L of malate in Chardonnay grape must during the AF [24]. S. uvarum has been shown to produce a stronger aromatic intensity than that produced by S. cerevisiae, although the regulatory mechanism underlying the heterologous genes in S. uvarum remains unclear. Moreover, it is noteworthy that the expression of the essential genes in S. uvarum metabolizes the malic acid, but at the same time it is bound to ruin the flavor balance of the wine [25,26,27].
Higher alcohols are one of the most important groups of aroma compounds that significantly influence the quality and flavor profiles of wine. Appropriate content and proportion of higher alcohols will lead to an alcoholic beverage that is mellow, soft, and plump, which are factors that coordinate the bouquet. An excessive level of higher alcohols will generate a strong fusel oil flavor, which may also potentially damage health [28,29]. It has been found that approximately 80% of higher alcohols in wine are generated during AF, concurrent with the reproduction and fermentation of wine yeasts. Higher alcohols are converted from α-ketoacids via decarboxylation by α-ketoacid decarboxylase and reduction of an aldehyde group by alcohol dehydrogenase. α-ketoacids involved can either be synthesized from pyruvate by the Harris pathway or from degradation of branched-chain amino acids (BCAAs) via the Ehrlich pathway [30,31]. Thus, it is important to acknowledge that alterations in malate or pyruvate levels resulting from the expression of essential genes related to malic acid degradation may also have an impact on the metabolism of higher alcohols and other related flavors.
In this study, the biosynthetic pathways for degradation of L–malic acid were constructed as the heterologous genes from L. lactis, O. oeni, L. plantarum (considered as the next-generation MLF fermented with the prospect of replacing O. oeni), and S. pombe were expressed or coexpressed in S. uvarum. Besides physiological characteristics and fermentation performances, including the growth curve and the content of ethanol, residual sugar, and organic acid, the higher alcohols and esters concentrations in wine were also detected to confirm the effect the heterologous gene expressions in S. uvarum.

2. Materials and Methods

2.1. Strains and Media

The strains (Escherichia coli DH5α, S. uvarum, L. lactis, O. oeni, L. plantarum, and S. pombe) used in this study are described in Table 1. The E. coli strain DH5α, which was used as a host for recombinant DNA manipulation, was grown at 37 °C in LB broth (1% NaCl, 1% tryptone, and 0.5% yeast extract); L. lactis was cultured via SGM17 medium (37.25 g/L M17 broth, 5 g/L sucrose, and 5.5 g/L glucose); S. uvarum and S. pombe were grown in YPD medium (20 g/L glucose, 10 g/L yeast extract, and 20 g/L bacto-peptone) at 30 °C; L. plantarum cells were propagated in MRS medium (2% glucose, 1.0% tryptone, 1.0% beef extract, 1.0% yeast extract, 0.2% K2HPO4, 0.1% Tween-80, 0.02% MgSO4·7H2O, 0.005% MnSO4·4H2O, 0.2% ammonium citrate, 0.5% sodium acetate, 50 mM NaHCO3) at 37 °C; MRS medium supplemented with 10% (v/v) tomato juice was used to enumerate O. oeni at 25 °C. All engineered strains are derivatives of S. uvarum WY1.

2.2. Construction of Plasmids

The plasmids (Yep352, pUC19-PGK, and pUG6) used in the current study are shown in Table 2. Plasmid pUC19-PGK and pUG6 were used as templates to obtain the promoter PGK1 fragment and selection marker KanMX fragment, respectively. Yep352 was used as the backbone to construct the recombinant plasmids.
The recombinant plasmid Yep-P was constructed as previously reported. The fragments of genes MAE1, MAE2, mleSN, mleAJ, mleSZ amplified from S. uvarum, S. pombe, L. lactis, O. oeni, and L. plantarum were cloned into Yep-P digested with XhoI to obtain the plasmid Yep-PE, Yep-Pm2, Yep-PSN, Yep-PAJ, and Yep-PSZ, respectively. Similarly, the gene MAE1 from S. pombe and genes mleP from L. lactis, O. oeni, and L. plantarum were inserted into Yep-P, constructing the recombinant plasmids Yep-Pm1, Yep-PPN, Yep-PPJ, and Yep-PPZ, respectively. The fragments PGKp-MAE1-PGKt, PGKp-MAE2-PGKt, PGKp-mleSN-PGKt, PGKp-mleSZ-PGKt, and PGKp-mleAJ-PGKt were cloned into Yep-PPN at the SmaI restriction site, obtaining Yep-PPNE, Yep-PPNm2, Yep-PPNSN, Yep-PPNSZ, and Yep-PPNAJ, respectively, and the fragments PGKp-MAE1-PGKt, PGKp-MAE2-PGKt, PGKp-mleSN-PGKt, PGKp-mleAJ-PGKt, and PGKp-mleSZ-PGKt were cloned into Yep-Pm1 at the SmaI restriction site, resulting in Yep-Pm1E, Yep-Pm1m2, Yep-Pm1SN, Yep-Pm1AJ, and Yep-Pm1SZ. Then, the selection marker KanMX was inserted into the recombinant plasmids after digestion of ApaI, the plasmids Yep-PEK, Yep-Pm2K, Yep-PSNK, Yep-PSzK, Yep-PAJK, Yep-Pm1K, Yep-PPNK, Yep-PPZK, Yep-PPJK, Yep-PPNEK, Yep-PPNm2K, Yep-PPNSNK, Yep-PPNSZK, Yep-PPNAJK, Yep-Pm1EK, Yep-Pm1m2K, Yep-Pm1SNK, Yep-Pm1AJK, and Yep-Pm1SZK were constructed.

2.3. Transformation Strategy

The transformation process was performed using the lithium acetate/PEG method. The experiment procedures, including cell culture, preparation, and transformation of competent cells, were carried out as previously reported [16]. The plasmids Yep-P, Yep-PEK, Yep-Pm2K, Yep-PSNK, Yep-PSzK, Yep-PAJK, Yep-Pm1K, Yep-PPNK, Yep-PPZK, Yep-PPJK, Yep-PPNEK, Yep-PPNm2K, Yep-PPNSNK, Yep-PPNSZK, Yep-PPNAJK, Yep-Pm1EK, Yep-Pm1m2K, Yep-Pm1SNK, Yep-Pm1AJK, and Yep-Pm1SZK were transformed into S. uvarum WY1, and then the mutant strains WY0, WYE, WYm2, WYSN, WYSZ, WYAJ, WYm1, WYPN, WYPZ, WYPJ, WYPNE, WYPNm2, WYPNSN, WYPNSZ, WYPNAJ, WYm1E, WYm1m2, WYm1SN, WYm1AJ, and WYm1SZ.

2.4. Fermentation Conditions

The detailed procedures, encompassing grape acquisition, juice adjustment, preparation of yeast strains, and inoculation of S. uvarum, closely followed the protocols established by Li et al. [16]. The must was adjusted to 20.45 Brix and pH 3.4–3.6 by addition of sucrose and tartaric acid, respectively. A 250 mL autoclaved flask was filled with 190 mL of formulated must. The modified grape juice, following adjustments, underwent fermentation at 25 °C in a temperature-controlled environment. The presence of residual sugar at 0.5% indicated completion of the yeast fermentation process. All fermentations were performed in triplicate.

2.5. Chemical Analysis

The growth curves of the parental strain and mutant strains were monitored using a Bioscreen Automated Growth Curves analysis system. The CO2 weight loss was measured at 12 h intervals using an analytical balance throughout the fermentation process. Following fermentation, the pH, ethanol concentration, and residual sugar content were determined using a pH meter, oenometer, and Brix hydrometer, respectively. L–malic acid, L–lactic acid, and other organic acids were identified using high-performance liquid chromatography (HPLC), while flavor compounds, including higher alcohols, ethyl acetate, and ethyl lactate, were analyzed via an Agilent 7890C GC (Santa Clara, CA, USA). The detailed experimental conditions were implemented as reported previously [32]. All analyses were conducted in triplicate.

2.6. Real-Time Quantitative PCR (RT-qPCR)

The total RNA of S. uvarum was extracted using a Yeast RNAiso Kit (Takara Biotechnology, Dalian, China), followed by reverse transcription using a PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Biotechnology, Dalian, China). The abundance of mRNAs encoding the target genes was determined by amplifying the genes using corresponding cDNAs as PCR templates. Changes in gene expression levels were evaluated by RT-qPCR employing an SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara Biotechnology, Dalian, China). The expression level of the target genes was normalized relative to the expression level of UBC6 that served as a reference gene [33]. The results were quantitatively analyzed using the 2−ΔΔCt method.

2.7. Statistical Analysis

Data were represented as the mean ± standard errors. Data analysis was conducted using Origin 9.0 and SPSS 24.0 statistical software. The differences between the mutant strains and parental strain were confirmed by Student’s t-test. Statistical significance was considered at p < 0.05.

3. Results and Discussion

During winemaking, LAB carry out the MLF to convert the harsh malic acid into supple and stable lactic acid and CO2 catalyzed by the malolactic enzyme (MLE), resulting in deacidification and improving the organoleptic balance of wine. When using bacterial malolactic starter cultures, LAB grow poorly and unpredictably in wine, which leads to “stuck” or “sluggish” MLF and spoilage of wines. Thus, performing both the AF and MLF with a single wine yeast strain is an absolute requirement for winemaking. In the current study, recombinant S. uvarums was transferred into malolactic activity genes to perform the MLF during AF, as shown in Figure 1. Following the method used for the introduction of a plasmid carrying a multicopy of regulatory or structural genes after codon optimization to test the gene regulation at molecular levels, a similar process was carried out to investigate the potential for S. uvarum [16].

3.1. Effect on L–Malic acid Degradation of Single-Gene Heterologous Expression in S. uvarum

The malic enzyme encoded by gene MAE1 in S. uvarum and gene MAE2 in S. pombe catalyzes the oxidative decarboxylation of malate to pyruvate and CO2. The malolactic enzyme encoded by gene mleS in L. lactis and L. plantarum, and gene mleA in O. oeni are devoted to transform the L–malic acid to L–lactic acid and CO2 [21,34,35]. Thus, to explore the potential gene regulation on L–malic acid degradation, the genes were expressed in S. uvarum, respectively, under the controls of the promoter PGK1, constructing the mutant strains WYE, WYm2, WYSN, WYSZ, and WYAJ. To verify the expression of the heterologous genes in the mutants, we quantified their relative expression levels using RT-qPCR. The results are depicted in Figure 2. The relative expression levels of genes mleS, mleA, or MAE2 in the mutants exhibited significant improvements compared to those in the parental strain, respectively (p < 0.05). Consequently, the heterologous genes were cloned and expressed accurately in S. uvarum WY1. After AF, the concentrations of L–malic acid, L–lactic acid, and pyruvic acid were detected, the result is shown in Figure 3. The L–malic acid content by the mutant strains WYE, WYm2, WYSN, WYAJ, and WYSz were 3.148, 2.733, 2.557, 2.504, and 2.432 g/L, thus reduced by 10.36%, 22.16%, 27.18%, 28.68%, and 30.73% compared with that of the parental strain (3.511 g/L, p < 0.05). And the L–lactic acid production of WYE and WYm2 showed no significant changes compared to the wild-type strain, but that of WYSN, WYAJ, and WYSz was 2.665, 2.684, and 2.793 g/L, which were 16~18-fold higher than that produced by the parental strain (0.152 g/L, p < 0.05). In addition, the pyruvic acid production of the engineered strains showed no significant difference compared with that of the parental strain. This discrepancy constitutes a primary factor contributing to the variation in fermentation yield of higher alcohols between the mutant strains and the parental counterpart.
Saccharomyces exhibit limited efficiency in malate metabolism, attributed to their lacking an active malate permease responsible for extracellular malate transport [17,36,37]. Malate permease mleP in LAB and MAE1 in S. pombe are the active malate transporters from extracellular to intracellular compartments [21,38]. Consequently, the mleP genes from L. lactis, L. plantarum, and O. oeni, along with the mae1 gene from S. pombe, were cloned and expressed in S. uvarum under the regulation of the PGK1 promoter, respectively. The mutants WYPN, WYPZ, WYPJ, and WYm1 were obtained. The significant improvements observed in the relative expression levels of mleP or MAE1, as shown in Figure 1, in the mutants indicate the successful expression of the exogenous genes in S. uvarum. As shown in Figure 4, The L–malic acid contents of the wine fermented by WYPN, WYPZ, WYPJ, and WYm1 were 2.967, 3.145, 3.222, and 2.514 g/L, respectively, indicating a decrease of 15.51%, 10.42%, 8.23%, and 28.41% compared to that produced by the parental strain (p < 0.05). There were no significant changes in the contents of lactic acid and pyruvate produced by both the mutants and the parental strain. Additionally, to assess the mutants’ capacity for malate transport between extracellular and intracellular compartments, the fermentation experiment was conducted by inoculating simulated grape juice. The production of intracellular L–malic acid was measured as depicted in Figure 5. The intracellular L–malic acid contents in the mutants WYPN, WYPZ, WYPJ, and WYm1 were 0.473, 0.362, 0.285, and 0.792 g/L, respectively, indicating a significant improvement compared to the parental strain. This demonstrates that the heterologous expression of genes encoding malate permease significantly influences the transport of malic acid from extracellular to intracellular compartments in S. uvarum.
In LAB, the malolactic enzyme converts L-malate to L-lactate without free intermediates or net reduction of NAD+; thus, the heterologous expressions of genes encoding malolactic enzyme in WYSN, WYSz, and WYAJ lead to the degradation of L–malic acid, and the L-lactate contents were increased significantly. The malic enzymes MAE1 in S. uvarum and MAE2 in S. pombe are responsible for catalyzing the oxidative decarboxylation of L-malate to pyruvate and CO2. Although the L-malate production was slightly reduced, pyruvate production of WYE and WYm2 were relatively similar to that of the parental strain WY1, which was probably due to further metabolization of pyruvate to ethanol/lactic acid and other flavor compounds under fermentative conditions. The expression of malolactic enzyme from LAB and malic enzyme from S. uvarum and S. pombe in S. uvarum could not effectively degrade malic acid to standard content (≤1 g/L), which was in accordance with the results of the genes expressed in S. cerevisiae. These failed attempts contributed to the absence of a malate transporter in S. uvarum as in S. cerevisiae [35].
Despite reports indicating that the degradation of L–malic acid primarily depends on copies of the malate permease gene in LAB [19,34,35], the expression of the gene mleP in L. lactis, L. plantarum, and O. oeni, or the gene MAE1 in S. pombe, which encodes for malic enzyme in S. uvarum did not result in further malate decarboxylation compared to the heterologous expression of malolactic enzyme in LABs or malic enzyme in S. pombe. Perhaps the lack of enhancement in malate decarboxylation in S. uvarum may be attributed to the metabolic regulation of its cells. Conversely, while malic acid can be transported into the cell via malate permease, the cell exhibits limited capacity and lacks efficient enzymes for malic acid degradation. Hence, to facilitate the efficient metabolism of malic acid in S. uvarum, a synergistic action of both malate permease and malate-degrading enzymes (such as malolactic enzyme or malic enzyme) is indispensable.

3.2. Effects of Coexpression of Malate Permease mleP from L. lactis with Different Malolactic Enzyme or Malic Enzyme Genes in S. uvarum on the Degradation of L–Malic Acid

The heterologous expression of single-gene encoding malate permease, malolactic enzyme, or malic enzyme in S. uvarum proves ineffective in metabolizing malic acid, even upon overexpression of the native gene MAE1. Consequently, the malate transport gene mleP from L. lactis was heterologously expressed in S. uvarum in conjunction with the malolactic enzyme gene (mleS in L. lactis and L. plantarum, mleA in O. oeni) or malic enzyme gene MAE1 in S. uvarum and MAE2 in S. pombe, respectively. The mutants WYPSN, WYPSZ, WYPAJ, WYPE, and WYPm2 were constructed. After fermentation, the results, as shown in Figure 6, revealed that the production of L–malic acid by the mutant strains WYPSN, WYPSZ, WYPAJ, WYPE, and WYPm2, was 2.455, 2.875, 2.982, 2.975, and 2.724 g/L, respectively, indicating a reduction of 30.09%, 18.11%, 15.066%, 15.28%, and 22.43%, respectively, compared to that produced by the parental strain (p < 0.05). Additionally, the concentration of L–lactic acid in the mutant strains WYPSN, WYPSZ, WYPAJ, was 2.708, 2.421, and 2.385 g/L, respectively, showing an increase of approximately 15–17 fold compared to that in the parental strain (p < 0.05). Conversely, there were no significant changes observed in the mutant strains WYPE, WYPm2, and the parental strain WY1. The results demonstrated the combination of gene mleP of L. lactis with different malolactic enzyme or malic enzyme genes in S. uvarum did not lead to further degradation of L–malic acid compared with the single gene expressed in S. uvarum. The inefficiency observed may stem from the fact that the decarboxylation system of L–malic acid in L. lactis necessitates the collaborative action of malate permease, malolactic enzyme, and other regulatory proteins. It was reported that the activator protein MleR serves as a positive regulator crucial for the expression of malolactic enzyme and the initiation of MLF in LABs [37]. Consequently, the coexpression of MleP with malolactic enzyme or malic enzyme genes in S. uvarum have failed to adequately complete the MLF process, potentially also due to the differential expression of the heterologous genes in S. uvarum. Further research is warranted to delve deeper into these observations.

3.3. Effects of Coexpression of Malate Permease MAE1 from S. pombe with Different Malolactic Enzyme or Malic Enzyme Genes in S. uvarum on the Degradation of L–Malic Acid

S. pombe demonstrates the capability to fully convert L-malate into ethanol and CO2 during fermentation in wine, thereby contributing to deacidification. The core system involved in this process consists of the malate transport (encoded by gene MAE1) and the malic enzyme (encoded by gene MAE2). In S. uvarum, the expression of the gene MAE1 was combined with malolactic enzyme genes (mleS from L. lactis, L. plantarum, and mleA in O. oeni), or malic enzyme genes MAE1 in S. uvarum and MAE2 in S. pombe, resulting in the generation of mutants WYm1SN, WYm1AJ, WYm1SZ, WYm1E, and WYm1m2. As depicted in Figure 7, the L-malate concentrations of WYm1E, WYm1m2, WYm1SN, WYm1AJ, and WYm1SZ were 2.502, 1.105, 1.098, 2.788, and 2.452 g/L, respectively, representing reductions of 28.75%, 68.52%, 68.74%, 20.61%, and 30.16%, respectively, compared to those produced by the parental strain WY1 (p < 0.05). Moreover, the L–lactic acid concentration increased in mutant strains WYm1SN and WYm1SZ to 2.437 and 0.745 g/L, respectively, while it decreased by 20.53% in strain WYm1AJ, respectively. These findings demonstrate that the heterologous expression of these genes had a beneficial effect on malate degradation, with strains WYm1m2 and WYm1SN showing the best results, nearly reaching the defined threshold of malic acid (<1 g/L).
The coexpression of malate transport MAE1 from S. pombe with different malolactic enzymes or malic enzymes genes in S. uvarum exhibited different effects on the degradation of L–malic acid in wine. Although O. oeni carried the much greater ability for deacidification than any other LAB during MLF in wine, the gene mleA showed little effect on metabolizing L–malic acid with the malate transport MAE1 from S. pombe in S. uvarum. The result was inconsistent with the research reported by Husnik et al., in which the industrial strain of S. cerevisiae coexpressing the S. pombe malate permease gene (MAE1) and the O. oeni malolactic gene (mleA) could fully decarboxylated 5.5 g/L of malate in Chardonnay grape must and produced equimolar amounts of lactate [24]. Besides the alternative expression of the heterologous gene in S. uvarum, it also is probably due to the NAD-dependent malolactic enzyme that is subject to catabolite repression in S. uvarum exhibiting low substrate affinity. Furthermore, the decreased L–lactic acid concentration in strain WYm1AJ may be attributed to more intracellular malate transported from the extracellular environment by malate permease, which was metabolized by the native malic enzyme rather than the malolactic enzyme. In addition, the result, which showed that the combination of S. pombe malate permease gene (MAE1) and malic enzyme gene (MAE2) or L. lactis malolactic gene (mleS) could effectively degrade malate production to about 1 g/L during AF, was in accord with Volschenk and colleagues’ research, in which the mutant S. cerevisiae expressing the S. pombe MAE1 and MAE2 genes degraded 8 g/L malate in a glycerol–ethanol medium within 7 days, and the recombinant malolactic S. cerevisiae (S. pombe MAE1 and L. lactis mleS genes) could ferment 4.5 g/L of malate in a synthetic grape must within 4 days [23]. L. plantarum strains were capable of surviving harsh wine conditions and displayed a more diverse enzyme profile than O. oeni, whereas coexpression of S. pombe MAE1 and L. plantarum mleS genes did not completely metabolize the malate content to about 1 g/L. The results also demonstrated that the main cause that the LAB completed the MLF in wine is that the genes resisted the harsh wine conditions. The mechanisms underlying these effects, however, require further research.

3.4. Effects of the Gene Expressions in S. uvarum on Higher Alcohols and Other Flavor Substances Production

Currently, research on the regulation of genes involved in deacidification in S. cerevisiae during alcoholic fermentation (AF) largely concentrates on studying individual substances such as malic acid, precursors, or metabolites within a single metabolic pathway, neglecting the balance of wine flavor. Higher alcohols and esters, crucial factors determining the sensory characteristics and flavor profile quality in wine, were detected to assess the impact of heterologous gene expressions in S. uvarum, as outlined in Table 3. The production of flavor substances was not affected by the overexpression of the MAE1 gene encoding malic enzyme in S. uvarum. In mutant WYm2, with heterologous expression of the gene MAE2 from S. pombe, isoamyl alcohol and ethyl acetate levels were 212.105 and 28.520 mg/L, reflecting increases of 5.25% and 22.40%, respectively, compared to the parental strain WY1 (isoamyl alcohol content: 201.530 mg/L; ethyl acetate production: 23.301 mg/L, p < 0.05). In addition, the production of isobutyl alcohol, isoamyl alcohol, ethyl acetate, and ethyl lactate were variably affected as the heterologous expression of malolactic enzyme genes. For example, the isobutyl alcohol contents of strains WYSN, WYAJ, WYSZ were 29.955, 31.832, and 32.375 mg/L, showing reductions of 15.27%, 9.96%, and 8.43%, respectively, compared to the parental strain WY1 (35.354 mg/L). The isoamyl alcohol contents of the mutants were 176.282, 189.205, and 191.472 mg/L, representing decreases of 12.53%, 6.12%, and 5.04%, respectively, compared to the parental strain WY1 (201.53 mg/L). The ethyl acetate production by the mutants were 21.716, 21.573, and 21.630 mg/L, exhibiting reductions of 6.80%, 7.42%, and 7.17%, respectively, compared to the parental strain WY1 (23.301 mg/L). The ethyl lactate levels in the mutants increased to 11.115, 5.065, and 6.130 mg/L, respectively. Additionally, the isobutyl alcohol, isoamyl alcohol, and ethyl acetate contents produced by WYPN (with heterologous expression of gene mleP encoding malate permease from L. lactis) were 36.335, 217.858, and 27.482 mg/L, increased by 2.78%, 8.10%, and 17.90%, respectively. Lastly, those produced by mutant WYm1 (heterologous expression of gene MAE1 encoding malate permease from S. pombe), were 45.244, 223.662, and 25.915 mg/L, reflecting improvements of 27.98%, 10.98%, and 11.22%, respectively, compared to those produced by the parental strain WY1.
The heterologous expression of the malic enzyme gene MAE2 from S. pombe in S. uvarum WY1 resulted in a significant increase in the content of ethyl acetate and isoamyl alcohol in wine. This may be attributed to the fact that expression of the malic enzyme gene MAE2 in S. uvarum WY1 resulted in the conversion of malic acid to pyruvic acid. Subsequently, a portion of the pyruvic acid was metabolized to produce acetaldehyde, which further formed acetic acid and was then esterified with ethanol to generate ethyl acetate. Another portion of pyruvic acid was channeled through a series of enzymes in the ILV pathway, leading to the formation of α-keto acid, eventually resulting in the production of isoamyl alcohol (as shown in Figure 8). The malolactic enzyme encoded by gene mleS or mleA degrades malic acid to lactic acid. And the lactic acid reacts with ethanol to produce ethyl lactate, effectively slowing the metabolic flow from malic acid to pyruvic acid in S. uvarum. Thus, the production of isobutyl alcohol and isoamyl alcohol were reduced after pyruvic acid metabolism. Additionally, alterations in L–malic acid levels could affect the tricarboxylic acid cycle, and then impacts the metabolism of compounds such as pyruvic acid and α-ketoglutaric acid in S. uvarum, thereby leading to variations in higher alcohols and ethyl acetate concentration in wine. Malate permease plays a crucial role in supporting MLF. We suspect that that the heterologous expression of gene mleP promoted the L–malic acid transfer from extracellular to intracellular, induced the expression of malic enzyme in S. uvarum and facilitated the conversion of malate to pyruvate. This process, in turn, leads to an increase in levels of higher alcohols. Additionally, malate permease-regulated malate transporter proteins exhibit permeability to other extracellular dibasic acids, such as α-ketoglutarate. This dual function affects the tricarboxylic acid cycle in S. uvarum. In yeast cells, aminotransfer between amino acids and their corresponding α-keto acids is catalyzed by branched-chain amino acid aminotransferases (BCAATases) in both the mitochondria and cytoplasm. This process synthesizes leucine, isoleucine, and valine using glutamate and α-ketoglutarate as donor and acceptor, respectively. Furthermore, the amino acids and α-ketoglutarate are utilized to produce the corresponding α-keto acids by transaminases. These α-keto acids, such as α-ketoisovaleric acid, hexanoic acid, and α-ketoisocaproic acid, undergo decarboxylation and dehydrogenation to produce isobutanol and isopentyl alcohol [38,39,40].
Therefore, the coexpression of the malate permease gene and either the malolactic enzyme gene or the malic enzyme gene in the mutants exhibited varying effects on the content of higher alcohols and esters in wine. The malate transporter facilitated the transfer of L-malate and α-ketoglutarate from the extracellular environment to the intracellular space. The transportation promotes the expression of malic enzyme and malolactamase genes (as shown in Figure 2), leading to the degradation of malic acid into lactic acid or pyruvic acid. Consequently, the metabolism of higher alcohols and esters were affected differently. Of the mutants, strain WYm1SN exhibited the best effect whether on higher alcohols levels or on esters production. The increased lactic acid content led to an ethyl lactate concentration rising from approximately 0 to about 13.990 mg/L. This finding is essentially consistent with our previous report on wine fermented by yeast and LAB simultaneously [16]. Additionally, the production of higher alcohols was effectively reduced. Excessive levels of higher alcohols can contribute to the generation of a strong fusel oil flavor and pose potential health problems.

3.5. Effects of the Gene Expressions in S. uvarum on Growth and Fermentation Performance

A stable fermentation performance of the mutant strain was closely related with liquor yield, fermentation period, and flavor quality of the wine in industrial fermentation. Thus, the physiological characteristic and fermentation performances, such as ethanol, residual sugar, and organic acid of wine, were determined to investigate the effects of heterologous expressions of the genes in S. uvarum. Growth curves, which were detected during the culture of yeast cells at 30 °C in YEPD medium, showed that the mutant strains exhibited a similar growth rate and final cell density as the parental strain. Weight losses were detected every 12 h during the fermentation process, and production of ethanol, residual sugar, and organic acid in wine were detected after AF. Table 4 and Figure 9 and Figure 10 suggest that the mutant strains with heterologous expressions of the genes had similar fermentation rate and no obvious changes in the liquor yield and residual sugar compared with the parental strain WY1.
In current study, we constructed a biological pathway of deacidification into S. uvarum, which make the S. uvarum carry out the AF and MLF simultaneously, as different genes related to the deacidification were heterologously expressed in S. uvarum. Analysis of L–malic acid production and other flavor substances (higher alcohols and esters) produced by the mutant strains with different gene expression and coexpression suggested different roles for the relevant enzymes during deacidification of AF in wine. In addition, of all the recombinant strains, the engineered S. uvarum that expressed gene MAE1 from S. pombe and mleS from L. lactis exhibited the best effect, not only on deacidification of the wine, but also on the improvement in flavor quality. Our work settled several important questions caused by LAB in deacidification of MLF, and shortened the fermentation period.

Author Contributions

Data curation, Y.W., X.L. and W.S.; Writing—original draft, P.L.; Writing—review & editing, S.W., B.L. and C.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Innovative Research Team of Tianjin Municipal Education Commission (TD13-5013) and the Key Research and Development Project of Hebei Province (21327105D).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors confirm that they have no conflicts of interest with respect to the work described in this manuscript.

References

  1. Ruiz-De-Villa, C.; Poblet, M.; Cordero-Otero, R.; Bordons, A.; Reguant, C.; Rozès, N. Screening of Saccharomyces cerevisiae and Torulaspora delbrueckii strains in relation to their effect on malolactic fermentation. Food Microbiol. 2023, 112, 104212. [Google Scholar] [CrossRef]
  2. Balmaseda, A.; Rozès, N.; Bordons, A.; Reguant, C. Modulation of a defined community of Oenococcus oeni strains by Torulaspora delbrueckii and its impact on malolactic fermentation. Aust. J. Grape Wine Res. 2022, 28, 374–382. [Google Scholar] [CrossRef]
  3. Dimopoulou, M.; Troianou, V.; Paramithiotis, S.; Proksenia, N.; Kotseridis, Y. Evaluation of malolactic starters in white and rosé winemaking of moschofilero wines. Appl. Sci. 2022, 12, 5722–5736. [Google Scholar] [CrossRef]
  4. Umino, M.; Onozato, M.; Sakamoto, T.; Koishi, M.; Fukushima, T. Analyzing citramalic acid enantiomers in apples and commercial fruit juice by liquid Chromatography–Tandem mass spectrometry with pre-column derivatization. Molecules 2023, 28, 1556. [Google Scholar] [CrossRef]
  5. Fu, J.; Wang, L.; Sun, J.; Ju, N.; Jin, G. Malolactic fermentation: New approaches to old problems. Microorganisms 2022, 10, 2363–2378. [Google Scholar] [CrossRef]
  6. Liszt, K.I.; Walker, J.; Somoza, V. Identification of organic acids in wine that stimulate mechanisms of gastric acid secretion. J. Agric. Food Chem. 2012, 60, 7022–7030. [Google Scholar] [CrossRef]
  7. Krieger-Weber, S.; Heras, J.M.; Suarez, C. Lactobacillus plantarum, a new biological tool to control malolactic fermentation: A review and an outlook. Beverages 2020, 6, 23. [Google Scholar] [CrossRef]
  8. Gabler, A.M.; Ludwig, A.; Biener, F.; Waldner, M.; Dawid, C.; Oliver, F. Chemical characterization of red wine polymers and their interaction affinity with odorants. Foods 2024, 13, 526. [Google Scholar] [CrossRef]
  9. Jakabová, S.; Fikselová, M.; Mendelová, A.; Ševčík, M.; Jakab, I.; Aláčová, Z.; Ivanova-Petropulos, V. Chemical composition of white wines produced from different grape varieties and wine regions in slovakia. Appl. Sci. 2021, 11, 11059. [Google Scholar] [CrossRef]
  10. Tzamourani, A.; Paramithiotis, S.; Favier, M.; Coulon, J.; Moine, V.; Paraskevopoulos, I.; Dimopoulou, M. New insights into the production of assyrtiko wines from the volcanic terroir of santorini island using Lachancea thermotolerans. Microorganisms 2024, 12, 786. [Google Scholar] [CrossRef]
  11. Bauer, R.; Dicks, L.M.T. Control of malolactic fermentation in wine. A review. S. Afr. Soc. Enol. Vitic. 2017, 25, 74–88. [Google Scholar] [CrossRef]
  12. Prusova, B.; Licek, J.; Kumsta, M.; Baron, M.; Sochor, J. Effect of new methods for inhibiting malolactic fermentation on the analytical and sensory parameters of wines. Fermentation 2024, 10, 122. [Google Scholar] [CrossRef]
  13. Edwards, C.G.; Reynolds, A.G.; Rodriguez, A.V.; Semon, M.J.; Mills, J.M. Implication of acetic acid in the induction of slow/stuck grape juice fermentations and inhibition of yeast by Lactobacillus sp. Am. J. Enol. Vitic. 1999, 50, 204–210. [Google Scholar] [CrossRef]
  14. Sgouros, G.; Mallouchos, A.; Dourou, D.; Banilas, G.; Chalvantzi, I.; Kourkoutas, Y.; Nisiotou, A. Torulaspora delbrueckii may help manage total and volatile acidity of santorini-assyrtiko wine in view of global warming. Foods 2023, 12, 191. [Google Scholar] [CrossRef]
  15. Vicente, J.; Vladic, L.; Marquina, D.; Brezina, S.; Rauhut, D.; Santiago, B. The influence of chitosan on the chemical composition of wines fermented with Lachancea thermotolerans. Foods 2024, 13, 987. [Google Scholar] [CrossRef]
  16. Li, P.; Gao, Y.; Wang, C.; Zhang, C.Y.; Guo, X.; Xiao, D. Effect of ILV6 deletion and expression of aldB from Lactobacillus plantarum in Saccharomyces uvarum on diacetyl production and wine flavor. J. Agric. Food Chem. 2018, 66, 8556–8565. [Google Scholar] [CrossRef]
  17. Zelle, R.M.; Harrison, J.C.; Pronk, J.T.; Maris, A.J.A.V. Anaplerotic role for cytosolic malic enzyme in engineered Saccharomyces cerevisiae strains. Appl. Environ. Microbiol. 2011, 77, 732–738. [Google Scholar] [CrossRef]
  18. Schümann, C.; Michlmayr, H.; Eder, R.; Del Hierro, A.M.; Kulbe, K.D.; Mathiesen, G.; Nguyen, T. Heterologous expression of Oenococcus oeni malolactic enzyme in Lactobacillus plantarum for improved malolactic fermentation. AMB Express 2012, 2, 19. [Google Scholar] [CrossRef]
  19. Landete, J.M.; Ferrer, S.; Monedero, V.; Zuniga, M. Malic enzyme and malolactic enzyme pathways are functionally linked but independently regulated in Lactobacillus casei BL23. Appl. Environ. Microbiol. 2013, 79, 5509–5518. [Google Scholar] [CrossRef] [PubMed]
  20. Taillandier, P.; Strehaiano, P. The role of malic acid in the metabolism of Schizosaccharomyces pombe: Substrate con2 sumption and cell growth. Appl. Microbiol. Biotechnol. 1991, 35, 541–543. [Google Scholar] [CrossRef]
  21. Camarasa, C.; Bidard, F.; Bony, M.; Barre, P.; Dequin, S. Characterization of Schizosaccharomyces pombe malate permease by expression in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 2001, 67, 4144–4151. [Google Scholar] [CrossRef]
  22. Bony, M.; Bidart, F.; Camarasa, C.; Ansanay, V.; Dulau, L.; Barre, P.; Dequin, S. Metabolic analysis of S. cerevisiae strains engineered for malolactic fermentation. FEBS Lett. 1997, 410, 452–456. [Google Scholar] [CrossRef] [PubMed]
  23. Volschenk, H.; Viljoen-Bloom, M.; Subden, R.E.; van Vuuren, H.J.J. Malo-ethanolic fermentation in grape must by recombinant strains of Saccharomyces cerevisiae. Yeast 2001, 18, 963–970. [Google Scholar] [CrossRef] [PubMed]
  24. Husnik, J.I.; Volschenk, H.; Bauer, J.; Colavizza, D.; Luo, Z.; van Vuuren, H.J. Metabolic engineering of malolactic wine yeast. Metab. Eng. 2006, 8, 315–323. [Google Scholar] [CrossRef]
  25. Gamero, A.; Tronchoni, J.; Querol, A.; Belloch, C. Production of aroma compounds by cryotolerant Saccharomyces species and hybrids at low and moderate fermentation temperatures. J. Appl. Microbiol. 2013, 114, 1405–1414. [Google Scholar] [CrossRef]
  26. Almeida, P.; Gonçalves, C.; Teixeira, S.; Libkind, D.; Bontrager, M.; Masneuf-Pomarède, I.; Albertin, W.; Durrens, P.; Sherman, D.J.; Marullo, P.; et al. A Gondwanan imprint on global diversity and domestication of wine and cider yeast Saccharomyces uvarum. Nat. Commun. 2014, 5, 4044–4067. [Google Scholar] [CrossRef] [PubMed]
  27. Stribny, J.; Gamero, A.; Pérez-Torrado, R.; Querol, A. Saccharomyces kudriavzevii and Saccharomyces uvarum differ from Saccharomyces cerevisiae during the production of aroma-active higher alcohols and acetate esters using their amino acidic precursors. Int. J. Food Microbiol. 2015, 205, 41–46. [Google Scholar] [CrossRef]
  28. Solomon, M.; Schulkin, A.; Kolouchova, R.; Francis, I.L.; Schmidt, S.A. Aromatic higher alcohols in wine: Implication on aroma and palate attributes during chardonnay aging. Molecules 2021, 26, 4979. [Google Scholar] [CrossRef]
  29. Valero, E.; Moyano, L.; Millan, M.; Medina, M.; Ortega, J. Higher alcohols and esters production by Saccharomyces cerevisiae influence of the initial oxygenation of the grape must. Food Chem. 2002, 78, 57–61. [Google Scholar] [CrossRef]
  30. Henschke, P.A.; Jiranek, V. Yeast-Metabolism of Nitrogen Compounds in Wine Microbiology and Biotechnology; Harwood Academic Publishers: Reading, UK, 1993; pp. 77–164. [Google Scholar]
  31. Hazelwood, L.A.; Daran, J.M.; van Maris, A.J.; Pronk, J.T.; Dickinson, J.R. The Ehrlich pathway for fusel alcohol production: A century of research on Saccharomyces cerevisiae metabolism. Appl. Environ. Microbiol. 2008, 74, 2259–2266. [Google Scholar] [CrossRef]
  32. Cui, D.Y.; Ge, J.L.; Song, Y.M.; Feng, P.P.; Lin, L.C.; Guo, L.Y.; Zhang, C.Y. Regulating the ratio of higher alcohols to esters by simultaneously overexpressing ATF1 and deleting BAT2 in brewer’s yeast Saccharomyces pastorianus. Food Biosci. 2021, 3, 101231. [Google Scholar] [CrossRef]
  33. Teste, M.-A.; Duquenne, M.; François, J.M.; Parrou, J.-L. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Mol. Biol. 2009, 10, 99. [Google Scholar] [CrossRef] [PubMed]
  34. Williams, S.A.; Hodges, R.A.; Strike, T.L.; Snow, R.; Kunkee, R.E. Cloning the gene for the malolactic fermentation of wine from lactobacillus delbrueckii in escherichia coli and yeasts. Appl. Environ. Microbiol. 1984, 47, 288–293. [Google Scholar] [CrossRef] [PubMed]
  35. Ansanay, V.; Dequin, S.; Camarasa, C.; Schaeffer, V.; Grivet, J.P.; Blondin, B.; Salmon, J.M.; Barre, P. Malolactic fermentation by engineered Saccharomyces cerevisiae as compared with engineered Schizosaccharomyces pombe. Yeast 1996, 12, 215–225. [Google Scholar] [CrossRef]
  36. Lemme, A.; Sztajer, H.; Wagner-Döbler, I. Characterization of mleR, a positive regulator of malolactic fermentation and part of the acid tolerance response in streptococcus mutans. BMC Microbiol. 2010, 10, 58. [Google Scholar] [CrossRef] [PubMed]
  37. Paramithiotis, S.; Stasinou, V.; Tzamourani, A.; Kotseridis, Y.; Dimopoulou, M. Malolactic fermentation—Theoretical advances and practical considerations. Fermentation 2022, 8, 521. [Google Scholar] [CrossRef]
  38. Styger, G.; Jacobson, D.; Bauer, F.F. Identifying genes that impact on aroma profiles produced by Saccharomyces cerevisiae and the production of higher alcohols. Appl. Microbiol. Biotechnol. 2001, 91, 713–730. [Google Scholar] [CrossRef] [PubMed]
  39. Eden, A.; Nedervelde, L.V.; Drukker, M.; Benvenisty, N.; Debourg, A. Involvement of branched-chain amino acid aminotransferases in the production of fusel alcohols during fermentation in yeast. Appl. Microbiol. Biotechnol. 2001, 55, 296–300. [Google Scholar] [CrossRef]
  40. Kim, B.; Cho, B.R.; Hahn, J.S. Metabolic engineering of Saccharomyces cerevisiae for the production of 2-phenylethanol via ehrlich pathway. Biotechnol. Bioeng. 2014, 111, 115–124. [Google Scholar] [CrossRef]
Foods 13 02038 g001
Figure 1. Biosynthetic pathway of L–malic acid metabolism in yeast.
Figure 1. Biosynthetic pathway of L–malic acid metabolism in yeast.
Foods 13 02038 g001
Foods 13 02038 g002
Figure 2. Determination of heterologous genes and MAE1 expression levels in parental strain WY1 and recombinant strains. Data are the average of three independent experiments. Error bars represent ±SD. (a) Relative expression levels of MAE1 gene in the mutants WYE, WYPE, WYm1E compared with the parental strain WY1. (b) Relative expression levels of mleS gene from Lactococcus lactis in the mutants WYPSN, WYm1SN, and parental WY1 compared with the mutant WYSN. (c) Relative expression levels of mleS gene from Lactobacillus plantarum in the mutants WYPSZ, WYm1SZ, and parental WY1 compared with the mutant WYSZ. (d) Relative expression levels of mleA gene from Oenococcus oeni in the mutants WYPAJ, WYm1AJ, and parental WY1 compared with the mutant WYAJ. (e) Relative expression levels of MAE2 gene from Schizosaccharomyces pombe in the mutants WYPm2, WYm1m2, and parental WY1 compared with the mutant WYm2. (f) Relative expression levels of mleP gene from Lactobacillus plantarum in the parental WY1 compared with the mutant WYPZ, and relative expression levels of mleP gene from Oenococcus oeni in the parental WY1 compared with the mutant WYPJ. (g) Relative expression levels of mleP gene from Lactococcus lactis in the mutants WYPE, WYPSN, WYPSZ, WYPAJ, WYPm2, and parental WY1 compared with the mutant WYPN. (h) Relative expression levels of MAE1 gene from Schizosaccharomyces pombe in the mutants WYm1E, WYm1SN, WYm1SZ, WYm1AJ, WYm1m2, and parental WY1 compared with the mutant WYm1.
Figure 2. Determination of heterologous genes and MAE1 expression levels in parental strain WY1 and recombinant strains. Data are the average of three independent experiments. Error bars represent ±SD. (a) Relative expression levels of MAE1 gene in the mutants WYE, WYPE, WYm1E compared with the parental strain WY1. (b) Relative expression levels of mleS gene from Lactococcus lactis in the mutants WYPSN, WYm1SN, and parental WY1 compared with the mutant WYSN. (c) Relative expression levels of mleS gene from Lactobacillus plantarum in the mutants WYPSZ, WYm1SZ, and parental WY1 compared with the mutant WYSZ. (d) Relative expression levels of mleA gene from Oenococcus oeni in the mutants WYPAJ, WYm1AJ, and parental WY1 compared with the mutant WYAJ. (e) Relative expression levels of MAE2 gene from Schizosaccharomyces pombe in the mutants WYPm2, WYm1m2, and parental WY1 compared with the mutant WYm2. (f) Relative expression levels of mleP gene from Lactobacillus plantarum in the parental WY1 compared with the mutant WYPZ, and relative expression levels of mleP gene from Oenococcus oeni in the parental WY1 compared with the mutant WYPJ. (g) Relative expression levels of mleP gene from Lactococcus lactis in the mutants WYPE, WYPSN, WYPSZ, WYPAJ, WYPm2, and parental WY1 compared with the mutant WYPN. (h) Relative expression levels of MAE1 gene from Schizosaccharomyces pombe in the mutants WYm1E, WYm1SN, WYm1SZ, WYm1AJ, WYm1m2, and parental WY1 compared with the mutant WYm1.
Foods 13 02038 g002
Foods 13 02038 g003
Figure 3. Concentrations of L–malic acid, L–lactic acid, and pyruvic acid in the mutants WYE, WYm2, WYSN, WYSZ, WYAJ, and the parental WY1. Error bars represent the SD of the average values. Statistical significance is denoted as ★★ = p < 0.01.
Figure 3. Concentrations of L–malic acid, L–lactic acid, and pyruvic acid in the mutants WYE, WYm2, WYSN, WYSZ, WYAJ, and the parental WY1. Error bars represent the SD of the average values. Statistical significance is denoted as ★★ = p < 0.01.
Foods 13 02038 g003
Foods 13 02038 g004
Figure 4. Concentrations of L–malic acid, L–lactic acid, and pyruvic acid in the mutants WYPN, WYPZ, WYPJ, WYm1, and the parental WY1. Error bars represent the SD of the average values. Statistical significance is denoted as ★★ = p < 0.01.
Figure 4. Concentrations of L–malic acid, L–lactic acid, and pyruvic acid in the mutants WYPN, WYPZ, WYPJ, WYm1, and the parental WY1. Error bars represent the SD of the average values. Statistical significance is denoted as ★★ = p < 0.01.
Foods 13 02038 g004
Foods 13 02038 g005
Figure 5. The extracellular and intracellular production of L–malic acid in the mutants WYPN, WYPZ, WYPJ, WYm1, and the parental WY1. Error bars represent the SD of the average values. Statistical significance is denoted as ★★ = p < 0.01.
Figure 5. The extracellular and intracellular production of L–malic acid in the mutants WYPN, WYPZ, WYPJ, WYm1, and the parental WY1. Error bars represent the SD of the average values. Statistical significance is denoted as ★★ = p < 0.01.
Foods 13 02038 g005
Foods 13 02038 g006
Figure 6. Concentrations of L–malic acid, L–lactic acid, and pyruvic acid in the mutants WYPE, WYPm2, WYPSN, WYPSZ, WYPAJ, and the parental WY1. Error bars represent the SD of the average values. Statistical significance is denoted as ★★ = p < 0.01.
Figure 6. Concentrations of L–malic acid, L–lactic acid, and pyruvic acid in the mutants WYPE, WYPm2, WYPSN, WYPSZ, WYPAJ, and the parental WY1. Error bars represent the SD of the average values. Statistical significance is denoted as ★★ = p < 0.01.
Foods 13 02038 g006
Foods 13 02038 g007
Figure 7. Concentrations of L–malic acid, L–lactic acid, and pyruvic acid in the mutants WYPE, WYm1m2, WYm1SN, WYm1SZ, WYm1AJ, and the parental WY1. Error bars represent the SD of the average values. Statistical significance is denoted as ★★ = p < 0.01.
Figure 7. Concentrations of L–malic acid, L–lactic acid, and pyruvic acid in the mutants WYPE, WYm1m2, WYm1SN, WYm1SZ, WYm1AJ, and the parental WY1. Error bars represent the SD of the average values. Statistical significance is denoted as ★★ = p < 0.01.
Foods 13 02038 g007
Foods 13 02038 g008
Figure 8. Metabolic pathways of higher alcohols in yeast.
Figure 8. Metabolic pathways of higher alcohols in yeast.
Foods 13 02038 g008
Foods 13 02038 g009
Figure 9. Growth curve of the mutants and the parental strain WY1.
Figure 9. Growth curve of the mutants and the parental strain WY1.
Foods 13 02038 g009
Foods 13 02038 g010
Figure 10. The cumulative CO2 weightlessness of the wine fermented by the parental strain and the mutants.
Figure 10. The cumulative CO2 weightlessness of the wine fermented by the parental strain and the mutants.
Foods 13 02038 g010
Table 1. Strains and plasmids used in the current study.
Table 1. Strains and plasmids used in the current study.
Strains or PlasmidsRelevant CharacteristicReference or Source
Strain
E. coli DH5αsupE44ΔlacU169(ϕ80lacZΔM15) hsdR17 recAl endAl gyrA96 thi-1 relAThis lab
WY1Wild-type industrial Saccharomyces uvarumThis lab
Lactococcus lactisWild-type industrial Lactococcus lactis This lab
Lactobacillus plantarumWild-type industrial Lactobacillus plantarum This lab
Oenococcus oeniWild-type industrial Oenococcus oeniThis lab
Schizosaccharomyces pombeWild-type industrial Schizosaccharomyces pombeThis lab
WY0PGK1p-PGK1t-loxP-KanMX-loxPThis study
WYEPGK1p-MAE1-PGK1t-loxP-KanMX-loxPThis study
WYSNPGK1p-mleSN (Lactococcus lactis)-PGK1t-loxP-KanMX-loxPThis study
WYSZPGK1p-mleSZ (Lactobacillus plantarum)-PGK1t-loxP-KanMX-loxPThis study
WYAJPGK1p-mleAJ(Oenococcus oeni)-PGK1t-loxP-KanMX-loxPThis study
WYm2PGK1p-MAE2(Schizosaccharomyces pombe)-PGK1t-loxP-KanMX-loxPThis study
WYPNPGK1p-mlePN (Lactococcus lactis)-PGK1t-loxP-KanMX-loxPThis study
WYPZPGK1p-mlePZ(Lactobacillus plantarum)-PGK1t-loxP-KanMX-loxPThis study
WYPJPGK1p-mlePJ(Oenococcus oeni)-PGK1t-loxP-KanMX-loxPThis study
WYm1PGK1p-MAE1(Schizosaccharomyces pombe)-PGK1t-loxP-KanMX-loxPThis study
WYPEPGK1p-mlePN(Lactococcus lactis)-PGK1t-PGK1p-MAE1-PGK1t-loxP
-KanMX-loxP		This study
WYPSNPGK1p-mlePN(Lactococcus lactis)-PGK1t-PGK1p-mleSN(Lactococcus lactis)-PGK1t-loxP-
KanMX-loxP		This study
WYPSZPGK1p-mlePN(Lactococcus lactis)-PGK1t-PGK1p-mleSZ(Lactobacillus plantarum)-PGK1t-loxP-
KanMX-loxP		This study
WYPAJPGK1p-mlePN(Lactococcus lactis)-PGK1t-PGK1p-mleAJ(Oenococcus oeni)-PGK1t-loxP-
KanMX-loxP		This study
WYPm2PGK1p-mlePN(Lactococcus lactis)-PGK1t-PGK1p-MAE2(Schizosaccharomyces pombe)-PGK1t-loxP-
KanMX-loxP		This study
WYm1EPGK1p-MAE1(Schizosaccharomyces pombe)-PGK1t-PGK1p-MAE1-PGK1t-loxP
-KanMX-loxP		This study
WYm1SNPGK1p-MAE1(Schizosaccharomyces pombe)-PGK1t-PGK1p-mleSN(Lactococcus lactis)-PGK1t-loxP-
KanMX-loxP		This study
WYm1SZPGK1p-MAE1(Schizosaccharomyces pombe)-PGK1t-PGK1p-mleSZ(Lactobacillus plantarum)-PGK1t-loxP-
KanMX-loxP		This study
WYm1AJPGK1p-MAE1(Schizosaccharomyces pombe)-PGK1t-PGK1p-mleAJ(Oenococcus oeni)-PGK1t-loxP-
KanMX-loxP		This study
WYm1m2PGK1p-MAE1(Schizosaccharomyces pombe)-PGK1t-PGK1p-MAE2(Schizosaccharomyces pombe)-PGK1t-loxP-
KanMX-loxP		This study
Plasmids
Yep352
pUG6		Apr, cloning vector
E. coli/S. cerevisiae shuttle vector, containing Amp+ and loxP-KanMX-loxP cassette		This lab
This study
pPGK1E. coli/S. cerevisiae shuttle vector, containing Amp+and PGK1p and PGK1tThis study
pSH-ZeocinZeor, Cre expression vectorThis study
Table 2. Primers used in the present study.
Table 2. Primers used in the present study.
PrimersSequence (5′→3′)
PGK-UCGCGGATCCTCTAACTGATCTATCCAAAACTG
PGK-DACGCGTCGACTAACGAACGCAGAATTTTCGAG
MAE-UGAATTCCAGATCTCCTCGAGATGCTTAGAACCAGACTATCCG
MAE-DTCTATCGCAGATCCCTCGAGCTACAATTGGTTGGTGTGCAC
MAE2-UGAATTCCAGATCTCCTCGAGGCACGTGGACCGTCTTACC
MAE2-DTCTATCGCAGATCCCTCGAGAGTTGATGAATAACAATAGGAGAAA
mleSN-UGAATTCCAGATCTCCTCGAGATGCGTGCACATGAAATTT
mleSN-DTCTATCGCAGATCCCTCGAGTTAGTACTCTGGATACCATTTAAGA
K(ApaI)-UCCGCTAACAATACCTGGGCCCCAGCTGAAGCTTCGTACGC
K(ApaI)-D GCACACGGTGTGGTGGGCCCGCATAGGCCACTAGTGGATCTG
MAE1-UGAATTCCAGATCTCCTCGAGTTCATTTTCTCTCTTGGCCAC
MAE1-DTCTATCGCAGATCCCTCGAGCTTTTGTCATGAAATCCCTCTTA
mlePN-UGAATTCCAGATCTCCTCGAGATGAAAAAACTTAAAGAAACGA
mlePN-DTCTATCGCAGATCCCTCGAGTTAATAAAAGAATCGTATAAGAATT
PGK(SmaI)-UGTACCCGGGTCTAACTGATCTATCCAAAACTGA
PGK(SmaI)-DGATCCCCGGGTAACGAACGCAGAATTTTC
mleSZ-UGAATTCCAGATCTCCTCGAGATGACAAAAACTGCAAGTGAAAT
mleSZ-DTCTATCGCAGATCCCTCGAGCTATTTGCTGATGGCCCG
mleAJ-UGAATTCCAGATCTCCTCGAGATGACAGATCCAGTAAGTATT
mleAJ-DTCTATCGCAGATCCCTCGAGATTAGTATTTCGGATCCCACT
YmlePN-UATGAAAAAACTTAAAGAAACGA
YmlePN-DTTAATAAAAGAATCGTATAAGAATT
YmleSZ-UATGACAAAAACTGCAAGTGAAAT
YmleSZ-DCTATTTGCTGATGGCCCG
YmleAJ-UATGACAGATCCAGTAAGTATT
YmleAJ-DATTAGTATTTCGGATCCCACT
K-UCAGCTGAAGCTTCGTACGC
K-D GCATAGGCCACTAGTGGATCTG
ApaI-UCCTGCTTCAAACCGCTAACAATA
ApaI-DCGAATGCACACGGTGTGGT
SmaI-U TTCGAGCTCGGTACCCG
SmaI-DAGTTAGAGGATCCCCGGG
Table 3. Contents of the higher alcohols and esters produced by the mutants and the parental strain in the study a.
Table 3. Contents of the higher alcohols and esters produced by the mutants and the parental strain in the study a.
Strainsn-Propanol
(mg/L)		Isobutyl Alcohol (mg/L)Isoamyl Alcohol (mg/L)Phenethyl Alcohol (mg/L)Ethyl Acetate (mg/L)Ethyl Lactate (mg/L)
WY151.83 ± 2.9435.354 ± 1.54201.53 ± 2.6713.521 ± 0.9823.301 ± 1.04≈0
WY052.342 ± 3.21235.421 ± 1.89204.321 ± 2.8513.395 ± 1.1323.721 ± 1.75≈0
WYE51.921 ± 1.9735.015 ± 2.16205.127 ± 3.5713.832 ± 0.9723.55 ± 2.53≈0
WYm252.044 ± 1.7234.199 ± 1.05212.105 ± 7.61 *14.145 ± 1.3228.521 ± 1.93 *≈0
WYSN50.697 ± 1.5629.955 ± 3.52 *176.282 ± 4.05 *14.290 ± 1.5321.716 ± 1.00 *11.115 ± 0.59 *
WYAJ51.017 ± 1.0531.832 ± 1.35 *189.205 ± 2.13 *14.315 ± 1.0521.573 ± 0.45 *5.065 ± 0.84 *
WYSZ50.538 ± 1.3532.375 ± 2.30 *191.372 ± 1.85 *13.580 ± 1.3821.063 ± 0.75 *6.130 ± 0.05 *
WYPN53.757 ± 2.4536.335 ± 0.15 *217.858 ± 5.93 *14.033 ± 0.7527.473 ± 1.89 *≈0
WYm155.646 ± 0.8945.244 ± 1.92 *223.662 ± 3.19 *14.257 ± 0.6225.914 ± 2.33 *≈0
WYPE52.216 ± 3.6740.785 ± 0.98 *219.903 ± 4.97 *13.889 ± 1.0526.530 ± 1.83 *≈0
WYPSN52.385 ± 2.4134.639 ± 1.53210.775 ± 6.05 *14.496 ± 1.4229.741 ± 2.04 *13.942 ± 1.42 *
WYPSZ52.353 ± 2.8635.745 ± 2.05205.62 ± 3.55 *13.753 ± 1.9524.342 ± 1.05 *7.431 ± 1.55 *
WYPAJ51.964 ± 2.6735.069 ± 1.80204.175 ± 2.4213.766 ± 1.6520.156 ± 0.055.905 ± 1.80 *
WYPm254.791 ± 1.9834.881 ± 2.94211.031 ± 2.45 *14.468 ± 1.0829.896 ± 1.52 *≈0
WYm1E55.521 ± 4.05 *45.004 ± 5.08 *220.291 ± 3.12 *14.823 ± 0.6726.393 ± 2.74 *≈0
WYm1SN51.068 ± 1.5428.184 ± 1.06 *171.756 ± 1.09 *14.630 ± 0.3215.850 ± 1.08 *13.992 ± 1.08 *
WYm1SZ53.532 ± 2.0534.977 ± 2.04202.437 ± 4.9612.966 ± 0.8527.906 ± 2.48 *9.327 ± 0.76 *
WYm1AJ52.462 ± 1.7735.728 ± 3.62182.482 ± 4.96 *12.964 ± 1.0514.874 ± 2.16 *5.594 ± 0.63 *
WYm1m253.705 ± 3.0632.144 ± 2.95 *210.968 ± 3.25 *13.989 ± 1.9332.705 ± 1.33 *≈0
a Data are the average of three independent experiments ± the standard deviation. Significant difference of the mutants and the parental strain was confirmed by Student’s t-test (* p < 0.05, n = 3).
Table 4. Fermentation performances of the mutant strains and the parental strain in the wine fermentation a.
Table 4. Fermentation performances of the mutant strains and the parental strain in the wine fermentation a.
StrainsWeight Losses of CO2 (g)Ethanol (%, v/v)Residual Sugar (g/L)
WY114.95 ± 0.1511.02 ± 0.122.65 ± 0.10
WY014.83 ± 0.2511.03 ± 0.152.78 ± 0.21
WYE14.90 ± 0.1411.04 ± 0.152.66 ± 0.10
WYm214.79 ± 0.1210.95 ± 0.202.70 ± 0.08
WYSN14.82 ± 0.2010.80 ± 0.142.60 ± 0.05
WYAJ14.92 ± 0.2211.16 ± 0.222.61 ± 0.12
WYSZ14.93 ± 0.2012.10 ± 0.252.78 ± 0.27
WYPN14.72 ± 0.1211.00 ± 0.152.67 ± 0.20
WYm114.79 ± 0.1210.95 ± 0.182.62 ± 0.14
WYPE14.75 ± 0.1411.05 ± 0.212.7 ± 0.15
WYPSN14.82 ± 0.2010.95 ± 0.102.65 ± 0.15
WYPSZ14.85 ± 0.1511.05 ± 0.052.70 ± 0.02
WYPAJ14.80 ± 0.2211.00 ± 0.132.72 ± 0.13
WYPm214.79 ± 0.1211.10 ± 0.152.66 ± 0.12
WYm1E14.75 ± 0.1411.00 ± 0.142.65 ± 0.15
WYm1SN14.86 ± 0.2411.05 ± 0.102.64 ± 0.14
WYm1SZ14.83 ± 0.1211.00 ± 0.062.70 ± 0.10
WYm1AJ14.62 ± 0.1510.83 ± 0.12 *2.97 ± 0.05 *
WYm1m214.82 ± 0.2011.02 ± 0.152.62 ± 0.06
a Data are the average of three independent experiments ± the standard deviation. Significant difference of the mutants and the parental strain was confirmed by Student’s t-test (* p < 0.05, n = 3).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, P.; Song, W.; Wang, Y.; Li, X.; Wu, S.; Li, B.; Zhang, C. Effects of Heterologous Expression of Genes Related L–Malic acid Metabolism in Saccharomyces uvarum on Flavor Substances Production in Wine. Foods 2024, 13, 2038. https://doi.org/10.3390/foods13132038

AMA Style

Li P, Song W, Wang Y, Li X, Wu S, Li B, Zhang C. Effects of Heterologous Expression of Genes Related L–Malic acid Metabolism in Saccharomyces uvarum on Flavor Substances Production in Wine. Foods. 2024; 13(13):2038. https://doi.org/10.3390/foods13132038

Chicago/Turabian Style

Li, Ping, Wenjun Song, Yumeng Wang, Xin Li, Shankai Wu, Bingjuan Li, and Cuiying Zhang. 2024. "Effects of Heterologous Expression of Genes Related L–Malic acid Metabolism in Saccharomyces uvarum on Flavor Substances Production in Wine" Foods 13, no. 13: 2038. https://doi.org/10.3390/foods13132038

APA Style

Li, P., Song, W., Wang, Y., Li, X., Wu, S., Li, B., & Zhang, C. (2024). Effects of Heterologous Expression of Genes Related L–Malic acid Metabolism in Saccharomyces uvarum on Flavor Substances Production in Wine. Foods, 13(13), 2038. https://doi.org/10.3390/foods13132038

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop