Whole-Cell Biocatalytic Production of Acetoin with an aldC-Overexpressing Lactococcus lactis Using Soybean as Substrate
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains, Media and Regents
2.2. Gene Cloning, Sequence Analysis and Homology Modeling
2.3. Plasmid Construction and Gene Expression in L. lactis
2.4. Determination of Enzyme Activity
2.5. Optimizing the Concentration of Nisin
2.6. Optimizing the Substrate/Biomass Ratio in a Whole-Cell Bioconversion System
2.7. Optimizing the Induction Conditions
2.8. Whole-Cell Biosynthesis of Acetoin Using Soybeans as Substrate
2.9. Statistical Analysis
3. Results and Discussion
3.1. Cloning, Sequence and Phylogenetic Analysis of the aldC Gene
3.2. Heterologous Expression and Enzyme Activity Analysis
3.3. Optimizing the Concentration of Nisin to Increase ALDC Expression
3.4. Optimization of Substrate/Biomass Ratio and Induction Conditions
3.5. Orthogonal Test of the Induction Conditions for Improving Acetoin Production
3.6. Fermentation/Whole-Cell Bioconversion of Soybean with Recombinant L. lactis
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Cui, Z.; Wang, Z.; Zheng, M.; Chen, T. Advances in biological production of acetoin: A comprehensive overview. Crit. Rev. Biotechnol. 2021, 42, 1135–1156. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Z.; Lu, J.R. Strategies for enhancing fermentative production of acetoin: A review. Biotechnol. Adv. 2014, 32, 492–503. [Google Scholar] [CrossRef]
- Forster, A.H.; Beblawy, S.; Golitsch, F.; Gescher, J. Electrode-assisted acetoin production in a metabolically engineered Escherichia coli strain. Biotechnol. Biofuels 2017, 10, 65. [Google Scholar] [CrossRef] [PubMed]
- Ji, X.J.; Xia, Z.F.; Fu, N.H.; Nie, Z.K.; Shen, M.Q.; Tian, Q.Q.; Huang, H. Cofactor engineering through heterologous expression of an NADH oxidase and its impact on metabolic flux redistribution in Klebsiella pneumoniae. Biotechnol. Biofuels 2013, 6, 7. [Google Scholar] [CrossRef] [PubMed]
- Bursac, T.; Gralnick, J.A.; Gescher, J. Acetoin production via unbalanced fermentation in Shewanella oneidensis. Biotechnol. Bioeng. 2017, 114, 1283–1289. [Google Scholar] [CrossRef]
- Ji, X.J.; Huang, H.; Ouyang, P.K. Microbial 2,3-butanediol production: A state-of-the-art review. Biotechnol. Adv. 2011, 29, 351–364. [Google Scholar] [CrossRef]
- Eom, J.; Oh, H.B.; Yoon, S.I. Crystal structure of α-acetolactate decarboxylase from Bacillus subtilis subspecies spizizenii. Korean J. Microbiol. 2019, 55, 9–16. [Google Scholar]
- Li, S.; Gao, X.; Xu, N.; Liu, L.; Chen, J. Enhancement of acetoin production in Candida glabrata by in silico-aided metabolic engineering. Microb. Cell Fact. 2014, 13, 55. [Google Scholar] [CrossRef]
- Choi, M.-H.; Kim, S.-J.; Kim, J.-W.; Park, Y.-C.; Seo, J.-H. Molecular cloning and expression of Enterobacter aerogenes α-acetolactate decarboxylase in pyruvate decarboxylase-deficient Saccharomyces cerevisiae for efficient 2,3-butanediol production. Process Biochem. 2016, 51, 170–176. [Google Scholar] [CrossRef]
- Pervaiz, I.; Ahmad, S.; Madni, M.A.; Ahmad, H.; Khaliq, F.H. Microbial biotransformation: A tool for drug designing. Appl. Biochem. Micro. 2013, 49, 437–450. [Google Scholar] [CrossRef]
- Shin, K.C.; Oh, D.K. An integrative approach to improving the biocatalytic reactions of whole cells expressing recombinant enzymes. World J. Microbiol. Biotechnol. 2021, 37, 105. [Google Scholar] [CrossRef]
- Wang, Z.; Xu, J.; Chen, D. Whole cell microbial transformation in cloud point system. J. Ind. Microbiol. Biotechnol. 2008, 35, 645–656. [Google Scholar] [CrossRef]
- Monnet, C.; Nardi, M.; Hols, P.; Gulea, M.; Corrieu, G.; Monnet, V. Regulation of branched-chain amino acid biosynthesis by alpha-acetolactate decarboxylase in Streptococcus thermophilus. Lett. Appl. Microbiol. 2003, 36, 399–405. [Google Scholar] [CrossRef]
- Wu, W.; Zhao, Q.; Che, S.; Jia, H.; Liang, H.; Zhang, H.; Liu, R.; Zhang, Q.; Bartlam, M. Structural characterization of an acetolactate decarboxylase from Klebsiella pneumoniae. Biochem. Biophys. Res. Commun. 2019, 509, 154–160. [Google Scholar] [CrossRef]
- Mohseni, A.; Razavilar, V.; Keyvani, H.; Razavi, H.; Khavari-Nejad, R. Efficient production and optimization of E7 oncoprotein from Iranian human papillomavirus type 16 in Lactococcus lactis using nisin-controlled gene expression (NICE) system. Microb. Pathog. 2017, 100, 554–560. [Google Scholar] [CrossRef]
- Boumerdassi, H.; Monnet, C.; Desmazeaud, M.; Corrieu, G. Isolation and properties of Lactococcus lactis subsp. lactis biovar diacetylactis CNRZ 483 mutants producing diacetyl and acetoin from glucose. Appl. Environ. Microb. 1997, 63, 2293–2299. [Google Scholar] [CrossRef]
- Liu, C.J.; Luo, M.Y.; Li, Q.K.; Deng, G.; Li, X.R.; Yang, E.; Luo, Y.Y. Analysis of the antimicrobial activity of Lactobacillus plantarum YM-4-3: Implications of suitable conditions for extending the shelf life of fermented soybean products. Food Funct. 2019, 10, 5282–5289. [Google Scholar] [CrossRef]
- Chandrapati, S.; O’Sullivan, D.J. Nisin independent induction of the nisA promoter in Lactococcus lactis during growth in lactose or galactose. FEMS Microbiol. Lett. 1999, 170, 191–198. [Google Scholar] [CrossRef]
- Bahey-El-Din, M.; Griffin, B.T.; Gahan, C.G. Nisin inducible production of listeriolysin O in Lactococcus lactis NZ9000. Microb. Cell Fact. 2008, 7, 24. [Google Scholar] [CrossRef]
- Van Hoang, V.; Ochi, T.; Kurata, K.; Arita, Y.; Ogasahara, Y.; Enomoto, K. Nisin-induced expression of recombinant T cell epitopes of major Japanese cedar pollen allergens in Lactococcus lactis. Appl. Microbiol. Biotechnol. 2018, 102, 261–268. [Google Scholar] [CrossRef]
- Zheng, Z.Q.; Luo, C.Y.; Chen, H.; Sun, H.; Hui, X.; Chen, Z.D.; Gao, W.Y.; Li, H. Characterization of acetolactate decarboxylase of Streptococcus thermophilus and its stereoselectivity in decarboxylation of alpha-hydroxy-beta-ketoacids. Bioorg. Chem. 2022, 122, 105719. [Google Scholar] [CrossRef] [PubMed]
- Nii, T.; Makino, K.; Tabata, Y. Influence of shaking culture on the biological functions of cell aggregates incorporating gelatin hydrogel microspheres. J. Biosci. Bioeng. 2019, 128, 606–612. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Solem, C.; Jensen, P.R. Integrating biocompatible chemistry and manipulating cofactor partitioning in metabolically engineered Lactococcus lactis for fermentative production of (3S)-acetoin. Biotechnol. Bioeng. 2016, 113, 2744–2748. [Google Scholar] [CrossRef] [PubMed]
Strain, Plasmid and Primer | Relevant Characteristic or Sequence (5′-3′) a | Source | |
---|---|---|---|
Strains | L. plantarum Ly8 | Wild-type strain, isolated from Douchi | This study |
L. lactis NZ9000 | L. lactis MG1363 pepN::nisRK | Biovector | |
L. lactis NZ9000/pNZ8048 | L. lactis MG1363 pepN::nisRK, containing plasmid pNZ8048 | This study | |
L. lactis NZ9000/pNZ8048-aldC | L. lactis MG1363 pepN::nisRK, containing plasmid pNZ8048-aldC | This study | |
E. coli DH5α | F-, endA1, glnV44, thi-1, recA1, relA1, gyrA96, deoR, nupG, Φ80dlacZ ΔM15, Δ(lacZYA-argF) U169, hsdR17(rK−, mK+), λ− | Takara | |
Plasmids | pNZ8048 | Lactic acid bacteria expression vector, CmR | Biovector |
pNZ8048-aldC | Lactic acid bacteria expression vector, CmR, containing aldC gene | This study | |
Primers | aldC-F | CAGCTGCAGACATGGACACAACAACAATTTT | This study |
aldC-R | CTTCTAGATTAGTGGTGGTGGTGGTGGTGACGTTCAGCTTTATTAATGG | This study |
Factor | Item | Level | ||
---|---|---|---|---|
1 | 2 | 3 | ||
X1 | Initial OD600 | 0.4 | 0.6 | 0.8 |
X2 | Initial pH | 6.5 | 7.0 | 7.5 |
X3 | Induction temperature (°C) | 30 | 35 | 37 |
X4 | Shaking speed (rpm) | 0 | 50 | 100 |
X5 | Induction time (h) | 4 | 6 | 8 |
No. | Factor | OD522 | Acetoin (mg/L) | ||||
---|---|---|---|---|---|---|---|
X1 (OD600) | X2 (pH) | X3 (°C) | X4 (rpm) | X5 (h) | |||
1 | 0.4 | 6.5 | 30 | 0 | 4 | 1.61 ± 0.03 | 82.18 ± 1.71 |
2 | 0.6 | 7.0 | 30 | 50 | 6 | 1.49 ± 0.02 | 76.01 ± 1.25 |
3 | 0.8 | 7.5 | 30 | 100 | 8 | 0.72 ± 0.01 | 36.91 ± 0.71 |
4 | 0.6 | 7.0 | 35 | 0 | 4 | 0.84 ± 0.03 | 42.90 ± 1.42 |
5 | 0.8 | 7.5 | 35 | 50 | 6 | 1.44 ± 0.01 | 73.67 ± 0.37 |
6 | 0.4 | 6.5 | 35 | 100 | 8 | 1.61 ± 0.01 | 82.40 ± 0.54 |
7 | 0.4 | 7.5 | 37 | 0 | 6 | 1.68 ± 0.04 | 86.21 ± 2.13 |
8 | 0.6 | 6.5 | 37 | 50 | 8 | 1.45 ± 0.03 | 74.03 ± 1.54 |
9 | 0.8 | 7.0 | 37 | 100 | 4 | 2.01 ± 0.04 | 102.74 ± 1.95 |
10 | 0.8 | 7.0 | 30 | 0 | 8 | 1.46 ± 0.03 | 74.49 ± 1.76 |
11 | 0.4 | 7.5 | 30 | 50 | 4 | 1.64 ± 0.03 | 83.80 ± 1.59 |
12 | 0.6 | 6.5 | 30 | 100 | 6 | 1.28 ± 0.02 | 65.56 ± 1.26 |
13 | 0.8 | 6.5 | 35 | 0 | 6 | 1.24 ± 0.11 | 63.36 ± 5.86 |
14 | 0.4 | 7.0 | 35 | 50 | 8 | 1.75 ± 0.04 | 89.75 ± 2.21 |
15 | 0.6 | 7.5 | 35 | 100 | 4 | 1.76 ± 0.01 | 89.91 ± 0.41 |
16 | 0.6 | 7.5 | 37 | 0 | 8 | 2.09 ± 0.02 | 106.93 ± 1.16 |
17 | 0.8 | 6.5 | 37 | 50 | 4 | 1.42 ± 0.03 | 72.90 ± 1.32 |
18 | 0.4 | 7.0 | 37 | 100 | 6 | 1.76 ± 0.03 | 90.28 ± 1.32 |
K1 | 85.78 | 73.40 | 69.83 | 76.02 | 79.08 | ||
K2 | 75.90 | 79.37 | 73.67 | 78.37 | 75.86 | ||
K3 | 70.68 | 79.58 | 88.86 | 77.96 | 77.42 | ||
R | 15.1 | 6.18 | 19.03 | 2.35 | 3.22 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, H.; Liu, W.; Luo, Y.; Tu, Z.; Liu, B.; Yang, J. Whole-Cell Biocatalytic Production of Acetoin with an aldC-Overexpressing Lactococcus lactis Using Soybean as Substrate. Foods 2023, 12, 1317. https://doi.org/10.3390/foods12061317
Luo H, Liu W, Luo Y, Tu Z, Liu B, Yang J. Whole-Cell Biocatalytic Production of Acetoin with an aldC-Overexpressing Lactococcus lactis Using Soybean as Substrate. Foods. 2023; 12(6):1317. https://doi.org/10.3390/foods12061317
Chicago/Turabian StyleLuo, Huajun, Weihong Liu, Yiyong Luo, Zongcai Tu, Biqin Liu, and Juan Yang. 2023. "Whole-Cell Biocatalytic Production of Acetoin with an aldC-Overexpressing Lactococcus lactis Using Soybean as Substrate" Foods 12, no. 6: 1317. https://doi.org/10.3390/foods12061317
APA StyleLuo, H., Liu, W., Luo, Y., Tu, Z., Liu, B., & Yang, J. (2023). Whole-Cell Biocatalytic Production of Acetoin with an aldC-Overexpressing Lactococcus lactis Using Soybean as Substrate. Foods, 12(6), 1317. https://doi.org/10.3390/foods12061317