Hepatoprotective Effect of Tea Composite Solid Beverage on Alcohol-Caused Rat Liver Injury
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Cell Experiments
2.2.1. Cell Culture
2.2.2. Protective Effect of Tea Solids Beverage on Alcohol-Induced BRL3A Cells Injury
2.2.3. Tea Solid Beverage Prevents Alcohol-Induced BRL3A Cell Injury via Nrf2 and HO-1 Genes Expression
2.3. Animals Experiments
2.3.1. Animals and Treatments
2.3.2. Histopathology of the Liver
2.3.3. Biochemical Assays of the Serum and Liver Samples
2.3.4. Transcriptome Analysis and q-PCR Verification
2.3.5. 16S rRNA Sequencing of Gut Microbiota
2.4. Statistical Analysis
3. Results
3.1. Effect of a Single Fraction on the Survival of BRL3A Cells
3.2. Effect of Tea Composite Solid Beverage on Cell Viability
3.3. Establishment of Alcoholic Liver Injury Model and the Effect of Tea Solid Beverages on Cell Viability
3.4. Effect of Tea Composite Solid Beverage on the Liver Morphological Structure of Rats Drinking
3.5. Effect of Tea Composite Solid Beverage on Serum and Liver Injury-Related Indicators in Alcohol-Drinking Rats
3.6. Transcriptomic Analysis of Effect of tea Composite Solid Beverage on the Liver of Alcohol-Drinking Rats
3.7. Effect of Tea Composite Solid Beverage on the Intestinal Flora of Alcohol-Drinking Rats
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, Y.; Yang, S. Progress on alcoholic liver disease. Chin. J. Liver Dis. (Electron. Version) 2022, 14, 16. [Google Scholar]
- Anderson, P. The Impact of Alcoholic Beverages on Human Health. Nutrients 2021, 13, 4417. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Tan, S.-M.; Chen, X.-M.; Chen, P.; Song, Z.-J. Antialcoholism Effects of Rosa roxburghii Tratt Oral Liquid in Acute Drunkenness Mice. Mod. Food Sci. Technol. 2019, 35, 18–23. [Google Scholar] [CrossRef]
- Yan, M.; Teng, C.-L.; Tao, H.; Yang, H.-B.; Sun, X.-H.; Tan, H. Protective effects of Dictyophora rubrovalvata polysaccharide on alcoholic liver injury in rats. Mycosystema 2022, 41, 291–302. [Google Scholar] [CrossRef]
- Wang, S.; Huang, X.-X.; Yu, P.-F.; Xu, X.-T.; Wang, Y.-F.; Liu, L.; Mei, Q.-B. Intestinal microbiota dysbiosis associated with the development of colon cancer: Progress and prospects. Chin. Pharmacol. Bull. 2014, 30, 1045–1049. [Google Scholar]
- Bai, L.; Qiao, X.; Hai, L.; Qi, B.; Jirimutu; Ming, L. Effect of Camel Milk on Intestinal Flora of Mice with Chronic Alcoholic Liver Injury. Chin. Inst. Food Sci. Technol. 2022, 22, 78–87. [Google Scholar] [CrossRef]
- Yan, Z.; Zhong, Y.; Duan, Y. Antioxidant mechanism of tea polyphenols and its impact on health benefits. Anim. Nutr. 2020, 6, 115–123. [Google Scholar] [CrossRef]
- Tao, J.; Shen, X.; Ai, Y.; Han, X. Tea polyphenols protect against ischemia/reperfusion-induced liver injury in mice through anti-oxidative and anti-apoptotic properties. Exp. Ther. Med. 2016, 12, 3433–3439. [Google Scholar] [CrossRef][Green Version]
- Wang, D.; Zhang, M.; Wang, T.; Liu, T.; Guo, Y.; Granato, D. Green tea polyphenols mitigate the plant lectins-induced liver inflammation and immunological reaction in C57BL/6 mice via NLRP3 and Nrf2 signaling pathways. Food Chem. Toxicol. 2020, 144, 111576. [Google Scholar] [CrossRef]
- Wei, Z.-Q.; Wang, A.-L.; Huang, G.-D.; Huang, Z.-J.; Wang, Z.-Q.; Iang, M.-P.; Zhong, X.-F. Progress in Preparation and Application of Tea Polyphenol Active Films. Food Res. Dev. 2021, 42, 193–199. [Google Scholar]
- Silva, R.F.M.; Pogacnik, L. Polyphenols from Food and Natural Products: Neuroprotection and Safety. Antioxidants 2020, 9, 61. [Google Scholar] [CrossRef] [PubMed]
- Fei, Q.; Gao, Y.; Zhang, X.; Sun, Y.; Hu, B.; Zhou, L.; Jabbar, S.; Zeng, X. Effects of Oolong tea polyphenols, EGCG, and EGCG3’Me on pancreatic alpha-amylase activity in vitro. J. Agric. Food Chem. 2014, 62, 9507–9514. [Google Scholar] [CrossRef] [PubMed]
- Li, J.-C.; Li, S.-Y. Protective effect and mechanism of total flavonoids from Ampelopsis grossedentata on renal function injury of hyperuricemia based on molecular docking technology. Chin. Tradit. Herb. Drugs 2021, 52, 727–735. [Google Scholar]
- Chen, Y.U.-Q.; Ni, D.-J.; Cheng, Q.; Huang, H.-B.; Meng, Y.; Wu, M.-C. Study on the Hypolipidemic Effect of Flavones and Dihydromyricetin From Tengcha. J. Tea Sci. 2007, 3, 221–225+242. [Google Scholar]
- Chen, F.; Peng, M.; Wang, L.; Yang, Y.; Li, L.; Wang, Y.; Yang, X. Effect of Ampelopsis grossedentata Cambogia total flavonoids on mice’s liver damage caused by alcohol. Chin. Tradit. Pat. Med. 2021, 43, 200–203. [Google Scholar]
- Yu, F.; Sun, L.; Xu, L.-J.; Xiao, P.-G.; Miao, J.-H. Research Progress on Modern Application of Cassiae Semen. Mod. Chin. Med. 2018, 20, 626–630. [Google Scholar] [CrossRef]
- Hao, X.; Zhou, L.; Zhao, Y.; Wang, Y.; Kang, L.; Yang, J. Determination of Eighteen Heavy Metals and Hazardous Elements in Cassiae semen by Using ICP-MS Method. Food Ind. 2022, 43, 334–337. [Google Scholar]
- Wang, X.; Yang, B.; Zhou, Z.; Gong, M.; Li, D.; Zheng, X.; Liu, N. Research Progress on the Anti Liver Injury of Traditional Chinese Medicine and Active Ingredients. J. Liaoning Univ. TCM 2021, 23, 138–141. [Google Scholar] [CrossRef]
- Zhan, L.; Zhang, Z.; Shi, Y.; Teng, J.; Liu, Z.; Liu, Z.; Zhang, S. Protective effect of vine tea extract combined with cassia seed extract on chronic alcoholic liver injury in rats. Food Mach. 2022, 38, 157–165 + 172. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, J.; Ma, J.; Zhuo, L.; Kang, M.; Tian, Z.; Ding, C. The Protective Effect and Mechanisms of Hawthorn Flavonoids on DNA Damage of BRL-3A Hepatocytes. J. Chin. Inst. Food Sci. Technol. 2020, 20, 90–95. [Google Scholar] [CrossRef]
- Hao, S.-A.; Li, Y.; He, Y.-N.; Wu, N. Studies of the Effects of Flavone Extracts from Black Chokeberry on Acute Alcoholic Liver Injury in Mice. Food Res. Dev. 2021, 42, 30–35. [Google Scholar]
- Yu, P.; Zhang, X.; Chen, X.; Zheng, J.; Chen, X.; Chen, Y.; Zhang, Q. Study on the formula of ginseng and oyster compound peptide solid beverage. Food Ferment. Ind. 2022, 48, 193–199. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, M.-M.; Hua, T.-M.; Sun, Q.-Y. The protective effect of tea polyphenols on chronic alcoholic liver injury in rats. Chin. J. Appl. Physiol. 2018, 34, 481–484 + 529. [Google Scholar]
- Tang, Y.; Guan, X.; Jiang, Y.; Yue, X.; Chen, P.; Peng, Y.; Yu, J. Effect of tea polyphenols intake one thanol-induced liver injury. Chongqing Med. 2014, 43, 2736–2738. [Google Scholar]
- Carneiro, R.C.V.; Ye, L.; Baek, N.; Teixeira, G.H.A.; O’Keefe, S.F. Vine tea (Ampelopsis grossedentata): A review of chemical composition, functional properties, and potential food applications. J. Funct. Foods 2021, 76, 104317. [Google Scholar] [CrossRef]
- Zou, B.; Zhu, X. Experimental study of the mixture of cassia seed and hovenia dulcis thunb in the treatment of rats with alcoholic fatty liver. Chin. J. Clin. Pharmacol. 2018, 34, 2306–2308 + 2312. [Google Scholar] [CrossRef]
- Liu, S.; Liao, P.; Wu, Y.; Li, Q.; Lao, C.; Zhu, M. Study on Index Components and Hepatotoxicity In Vitro in Wuzhuyu (Euodiae Fructus) Based on Different Adjuvants Processing. Chin. Arch. Tradit. Chin. Med. 2022, 40, 206–210. [Google Scholar] [CrossRef]
- Wang, M.; Hu, J.; Li, C.; Zuo, P.; He, G.; Hu, T. Effects of dictyophora polysaccharide on IL-6 and TNF-α in liver of arsenism rats. J. Guizhou Med. Univ. 2022, 47, 191–196. [Google Scholar] [CrossRef]
- Lu, J.; Huangfu, J.; Liu, Y.; Li, C.; Wang, F.; Tang, P.; Bi, R.; Wang, D. Effects of sauce-aroma baijiu on chronic alcoholic liver injury in mice. Food Ferment. Ind. 2022, 48, 237–244. [Google Scholar] [CrossRef]
- Xu, M.; Zhang, J.; Tang, R.; Yu, X.; Xie, A.; Zou, C. Comparative study on the effects and mechanism of L-carnitine and Tea-polyphenols on acute liver injury induced by lipopolysaccharide in mice. J. Pract. Med. 2020, 36, 711–715. [Google Scholar]
- Li, D. RNA-Seq Transcriptomic Analysis of Fatty Acid Degradation-Related Genes in Dihydromyricetin for the Prevention and Treatment of Alcoholic Fatty Liver in Mice. Master’s Thesis, Shanghai University of Traditional Chinese Medicine, Shanghai, China, 2019. [Google Scholar]
- Pu, J.-W.; Yang, X.; Wu, Y.; Zhou, X.; Wang, X. Protective effect of total anthraquinone in semen cassiae on acute liver injury induced by LPS in rats and its mechanism. China J. Mod. Med. 2020, 30, 6–11. [Google Scholar]
- Niu, Y.; Xu, T.; Zeng, T.; Xie, K. Study on the protective effect of cassia seed extract on alcoholic liver injury in mice. J. Toxicol Febr. 2010, 24, 58–61. [Google Scholar] [CrossRef]
- Xiang, Y.; Zhang, H.; Wang, L.; Wei, Y.; Emu, Q. Effects of Aspergillus terreus on Oxidative Damage and Ferroptosis Related Indicators in Mice Liver. Acta Vet. Et Zootech. Sin. 2021, 52, 3619–3626. [Google Scholar]
- Wang, J.; Yin, Y.; Wen, B.; Ran, L.; Hou, T.; Deng, X. Study on Anti-Hepatic Fibrosis Mechanism of Natural Taurine. Chin. Arch. Tradit. Chin. Med. 2020, 38, 144–147. [Google Scholar] [CrossRef]
- Zhuang, C. Application Value of Alanine Aminotransferas, Gammaglutamyltransferas and Triglyceride in Detecting Fatty Liver in Physical Examination Center. China Health Stand. Manag. 2021, 12, 72–74. [Google Scholar]
- Ito, T.; Ishigami, M.; Ishizu, Y.; Kuzuya, T.; Honda, T.; Ishikawa, T.; Toyoda, H.; Kumada, T.; Fujishiro, M. Serum Nutritional Markers as Prognostic Factors for Hepatic and Extrahepatic Carcinogenesis in Japanese Patients with Nonalcoholic Fatty Liver Disease. Nutr. Cancer 2020, 72, 884–891. [Google Scholar] [CrossRef]
- Chen, T.; Xia, X. Prognostic value of intravenous ketone body ratio in the assessment of prognosis of hepatic artery chemoembolization in patients with hepatocellular carcinoma. Clin. J. Med. Offic. 2019, 47, 938–939 + 941. [Google Scholar] [CrossRef]
- Zhao, L.; Fan, J.; Xia, S.; Pan, Y.; Liu, S.; Qian, G.; Qian, Z.; Kang, H.B.; Arbiser, J.L.; Pollack, B.P.; et al. HMG-CoA synthase 1 is a synthetic lethal partner of BRAF(V600E) in human cancers. J. Biol. Chem. 2017, 292, 10142–10152. [Google Scholar] [CrossRef] [PubMed]
- Steele, M.A.; Dionissopoulos, L.; AlZahal, O.; Doelman, J.; McBride, B.W. Rumen epithelial adaptation to ruminal acidosis in lactating cattle involves the coordinated expression of insulin-like growth factor-binding proteins and a cholesterolgenic enzyme. J. Dairy Sci. 2012, 95, 318–327. [Google Scholar] [CrossRef]
- Wang, X.-T.; Zhang, A.-F. The Effect of Glucose-polymer Supplementon Ketone Body Metabolism of Miceafter Different Exercise Time. China Sport Sci. Technol. 2007, 72–75 + 97. [Google Scholar] [CrossRef]
- Zhang, A.-F. On Development in the Research on Exercise Ketone Bodies. J. Beijing Sport Univ. 2004, 793–796. [Google Scholar] [CrossRef]
- Shi, L.; Long, J.-G.; Liu, J.-K. Ketone Bodies Metabolism and Alzheimer′s Disease. Prog. Biochem. Biophys. 2015, 42, 323–328. [Google Scholar] [CrossRef]
- Zhang, J. The role of tea polyphenols and their effect on exercise capacity. Tea Fujian 2016, 38, 21–22. [Google Scholar]
- Zhou, D. Protective Role and Potential Mechanism of Dihydromyricetin and Myricetin on Physical Performance under Acute Hypoxic Conditions. Ph.D. Thesis, Army Medical University, Chongqing, China, 2016. [Google Scholar]
- Ko, E.; Um, M.Y.; Choi, M.; Han, T.; Kim, I.H.; Shin, S. Cassia tora Seed Improves Pancreatic Mitochondrial Function Leading to Recovery of Glucose Metabolism. Am. J. Chin. Med. 2020, 48, 615–629. [Google Scholar] [CrossRef]
- Wei, L.; Wang, Z.; Liang, H. Expression of 6-phosphofructokinase-2 in colorectal cancer and its clinical significance. J. Third Mil. Med. Univ. 2017, 39, 983–989. [Google Scholar] [CrossRef]
- Dong, Q. The Cytoprotection by Almond Skin Extracts to Rat Hepatocytes Toxicity by Fructose and Its Two Metabolites. Ph.D. Thesis, Northwest A&F University, Xianyang, China, 2010. [Google Scholar]
- Lee, C.-Y.; Oh, J.-H.; Chung, J.-O.; Rha, C.-S.; Park, M.-Y.; Hong, Y.-D.; Kim, W.-K.; Shim, S.-M. Effect of whole green tea products including catechins, polysaccharides, and flavonols on the metabolism of added sugars. Food Biosci. 2021, 41, 100936. [Google Scholar] [CrossRef]
- Dong, J.; Shen, J.; Qiu, L.; LIU, Y.; Song, D.; Xu, L. Prevention and treatment of clozapine-induced increase in body mass and disorders of glucolipid metabolism in rats by aqueous extract of cassia seeds. Chin. Med. Mater. 2014, 37, 2066–2069. [Google Scholar] [CrossRef]
- Rkrao, A.S.; Sheth, P. Recent Advances in Alcoholic Liver Disease I. Role of intestinal permeability and endotoxemia in alcoholic liver disease. AJP-Gastrointest. Liver Physiol. 2004, 286, 881–884. [Google Scholar] [CrossRef]
- Mutlu, E.A.; Gillevet, P.M.; Rangwala, H.; Sikaroodi, M.; Naqvi, A.; Engen, P.A.; Kwasny, M.; Lau, C.K.; Keshavarzian, A. Colonic microbiome is altered in alcoholism. Am. J. Physiol. Gastrointest. Liver Physiol. 2012, 302, G966–G978. [Google Scholar] [CrossRef] [PubMed]
- Zang, Y.; Wang, S.; Liu, N.; Liu, L.; Mei, Q.-B. Alcoholic liver disease: Gut microbiota and therapeutic perspectives. Chin. Pharmacol. Bull. 2016, 32, 451–455. [Google Scholar]
- Chen, X.-A.; Zhai, X.-Y.; Tong, C.-Q.; Zhao, F.; Li, W. Research progress on interaction between bioactive peptides and gut microbiota. J. Food Saf. Qual. 2022, 13, 1044–1049. [Google Scholar] [CrossRef]
- Yan, A.W.; Fouts, D.E.; Brandl, J.; Starkel, P.; Torralba, M.; Schott, E.; Tsukamoto, H.; Nelson, K.E.; Brenner, D.A.; Schnabl, B. Enteric dysbiosis associated with a mouse model of alcoholic liver disease. Hepatology 2011, 53, 96–105. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.-L.; Wu, S.; Wu, Q.; Wang, J.; Zhao, Z.-L.; Zhang, C.-J.; Li, L. Effects of Paeoniflorin on Anxiety-like Behavior, Inflammatory Factors and Intestinal Microflora in Alcohol Withdrawal Rats. Sci. Technol. Food Ind. 2022, 43, 378–387. [Google Scholar] [CrossRef]
- Huang, Y.; Chen, H.; Xie, W.; Tang, T.; Zhao, C.; Gong, X.; Zhou, X. Interaction between polysaccharide and intestinal flora and its structure-effect relationship: A review. Microbiol. China 2022, 49, 2325–2346. [Google Scholar] [CrossRef]
- Sun, Y. Isolation of Leptospira Jiangxi Strain and Estabishment of SPF Canine Morbidity Model. Master’s Thesis, Jiangxi Agricultural University, Nanchang, China, 2020. [Google Scholar]
- Ko, G.; Seo, B.; Kim, W. Roseburia spp. abundance associates with alcohol consumption in humans and its administration ameliorates alcoholic fatty liver in mice. J. Hepatol. 2020, 73, S80–S81. [Google Scholar] [CrossRef]
- Ling, Z.; Zhu, M.; Yan, X.; Cheng, Y.; Shao, L.; Liu, X.; Jiang, R.; Wu, S. Structural and Functional Dysbiosis of Fecal Microbiota in Chinese Patients with Alzheimer’s Disease. Front. Cell Dev. Biol. 2020, 8, 634069. [Google Scholar] [CrossRef]
- Hong, J.; Jia, Y.-M.; Zhao, R.-Q. Butyrate Alleviates High Fat Diet-Induced Obesity through Enhancement of Mitochondrial Function in the Liver of Mice. Chin. J. Biochem. Mol. Biol. 2017, 33, 1266–1273. [Google Scholar] [CrossRef]
- Guo, Y.; Huang, S.; Zhao, L.; Zhang, J.; Ji, C.; Ma, Q. Pine (Pinus massoniana Lamb.) Needle Extract Supplementation Improves Performance, Egg Quality, Serum Parameters, and the Gut Microbiome in Laying Hens. Front. Nutr. 2022, 9, 810462. [Google Scholar] [CrossRef]
- Hou, X.; Zhang, C. The number one forgotten function of vegetables-regulating the acid-base balance of the body. J. Chang. Veg. 2022, 02, 15–17. [Google Scholar]
- Zhou, W.-Y.; Tang, Q.-Q.; Liu, Y. The Egulation of Adipokines on Metabolism. Chin. J. Biochem. Mol. Biol. 2022, 38, 699–707. [Google Scholar] [CrossRef]
- Li, B.; Li, L.; Xie, F.; Guo, D.; Zhang, H.; Huang, X.; Liao, X.; Guan, W. Advances in the Regulation of Inflammatory Signaling Pathways by Peroxisome Proliferators-Activated Receptor-γ. Chin. J. Anim. Sci. 2022, 58, 32–37. [Google Scholar] [CrossRef]






| Primers | Primer Sequence |
|---|---|
| GAPDH | Forward: ACAGCAACAGGGTGGTGGAC Reverse: TTTGAGGGTGCAGCGAACTT |
| Nrf2 | Forward: GAGGATGGGAAACCTTACT Reverse: CTTCTTGCTCTTGGGAACA |
| HO-1 | Forward: GTGCTCGCATGAACACTCTG Reverse: TGCAGAGGTAGTATCTTGAACC |
| Gene | Primer Sequence |
|---|---|
| GAPDH | Forward: ACAGCAACAGGGTGGTGGAC Reverse: TTTGAGGGTGCAAACTT |
| Pfkfb1 | Forward: CTTTCGCCCAGACAACACAGAGG Reverse: GCGGCTGAGATACTTATGGACATCC |
| Hmgcs1 | Forward: CGGTTCCCTTGCTTCTGTTCTGG Reverse: CCTGGTGTGGCATCTTGTGTGAC |
| CON | ETOH | L | M | H | |
|---|---|---|---|---|---|
| ALT (U/L) | 68.88 ± 6.61 | 139.95 ± 8.69 | 109.39 ± 3.11 | 100.89 ± 7.45 | 85.88 ± 5.46 |
| AST (U/L) | 145.00 ± 24.67 | 424.85 ± 14.15 | 324.71 ± 31.19 | 264.33 ± 14.80 | 180.17 ± 30.03 |
| LDH (U/L) | 11.41 ± 1.05 | 21.16 ± 0.30 | 17.91 ± 0.69 | 16.17 ± 1.07 | 13.35 ± 0.66 |
| TNF-α (pg/mL) | 179.30 ± 9.81 | 394.02 ± 17.33 | 331.56 ± 17.45 | 268.74 ± 22.36 | 214.44 ± 6.34 |
| IL-6 (pg/mL) | 100.13 ± 6.76 | 208.46 ± 8.80 | 165.76 ± 10.81 | 13.98 ± 5.12 | 116.59 ± 11.25 |
| GSH (pg/mL) | 8.20 ± 0.26 | 4.53 ± 0.38 | 6.41 ± 0.36 | 7.14 ± 0.50 | 8.08 ± 0.39 |
| MDA (mmol/mL) | 33.30 ± 2.70 | 58.61 ± 4.39 | 45.83 ± 3.38 | 42.15 ± 3.96 | 36.58 ± 4.21 |
| SOD (U/mL) | 175.40 ± 13.60 | 84.70 ± 10.57 | 126.23 ± 11.90 | 141.75 ± 8.43 | 156.94 ± 10.60 |
| TG (mmol/L) | 3.59 ± 0.38 | 7.07 ± 0.49 | 4.91 ± 0.47 | 4.56 ± 0.62 | 3.43 ± 0.28 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, Z.; Zhan, L.; He, R.; Zhou, Y.; Tang, Q.; Liu, Z.; Zhang, S.; Liu, A. Hepatoprotective Effect of Tea Composite Solid Beverage on Alcohol-Caused Rat Liver Injury. Foods 2023, 12, 4126. https://doi.org/10.3390/foods12224126
Tang Z, Zhan L, He R, Zhou Y, Tang Q, Liu Z, Zhang S, Liu A. Hepatoprotective Effect of Tea Composite Solid Beverage on Alcohol-Caused Rat Liver Injury. Foods. 2023; 12(22):4126. https://doi.org/10.3390/foods12224126
Chicago/Turabian StyleTang, Zheng, Li Zhan, Ranran He, Yufei Zhou, Quanquan Tang, Zhonghua Liu, Sheng Zhang, and Ailing Liu. 2023. "Hepatoprotective Effect of Tea Composite Solid Beverage on Alcohol-Caused Rat Liver Injury" Foods 12, no. 22: 4126. https://doi.org/10.3390/foods12224126
APA StyleTang, Z., Zhan, L., He, R., Zhou, Y., Tang, Q., Liu, Z., Zhang, S., & Liu, A. (2023). Hepatoprotective Effect of Tea Composite Solid Beverage on Alcohol-Caused Rat Liver Injury. Foods, 12(22), 4126. https://doi.org/10.3390/foods12224126

