Prevalence of Foodborne Bacterial Pathogens and Antibiotic Resistance Genes in Sweets from Local Markets in Iran
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Preparation
2.2. Total DNA Extraction
2.3. PCR Assays for the Detection and Identification of Different Foodborne Bacterial Pathogens
2.4. PCR Assays for the Detection of ARGs
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ashrafi Tamai, I.; Mohammadzadeh, A.; Zahraei Salehi, T.; Mahmoodi, P.; Pakbin, B. Investigation of antimicrobial susceptibility and virulence factor genes in Trueperella pyogenes isolated from clinical mastitis cases of dairy cows. Food Sci. Nutr. 2021, 9, 4529–4538. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faour-Klingbeil, D.; Todd, E. Prevention and control of foodborne diseases in Middle-East North African countries: Review of national control systems. Int. J. Env. Res. Public Health. 2020, 17, 70–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pires, S.M.; Desta, B.N.; Mughini-Gras, L.; Mmbaga, B.T.; Fayemi, O.E.; Salvador, E.M.; Gobena, T.; Majowicz, S.E.; Hald, T.; Hoejskov, P.S.; et al. Burden of foodborne diseases: Think global, act local. Curr. Opin. Food Sci. 2021, 39, 152–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bintsis, T. Foodborne pathogens. AIMS Microbiol. 2017, 3, 529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pakbin, B.; Didban, A.; Brück, W.M.; Alizadeh, M. Phylogenetic analysis and antibiotic resistance of Shigella sonnei isolates. FEMS Microbiol. Lett. 2022, 369, fnac042. [Google Scholar] [CrossRef] [Scilit]
- Pakbin, B.; Brück, W.M.; Allahyari, S.; Rossen, J.W.; Mahmoudi, R. Antibiotic Resistance and Molecular Characterization of Cronobacter sakazakii Strains Isolated from Powdered Infant Formula Milk. Foods 2022, 11, 1093. [Google Scholar] [CrossRef] [Scilit]
- Foddai, A.C.; Grant, I.R. Methods for detection of viable foodborne pathogens: Current state-of-art and future prospects. Appl. Microbiol. Biotechnol. 2020, 104, 4281–4288. [Google Scholar] [CrossRef] [Scilit]
- Bordeleau, S.; Asselin, H.; Mazerolle, M.J.; Imbeau, L. “Is it still safe to eat traditional food?” Addressing traditional food safety concerns in aboriginal communities. Sci. Total Environ. 2016, 565, 529–538. [Google Scholar] [CrossRef] [Scilit]
- Menz, G.; Vriesekoop, F.; Zarei, M.; Zhu, B.; Aldred, P. The growth and survival of food-borne pathogens in sweet and fermenting brewers’ wort. Int. J. Food Microbiol. 2010, 140, 19–25. [Google Scholar] [CrossRef] [Scilit]
- Mashak, Z.; Sodagari, H.; Moradi, B. Microbiological and chemical quality of sohan: An Iranian traditional confectionary product. J. Food Qual. Hazards Control 2014, 1, 56–60. [Google Scholar]
- Pakbin, B.; Mahmoudi, R.; Mousavi, S.; Allahyari, S.; Amani, Z.; Peymani, A.; Qajarbeygi, P.; Hoseinabadi, Z. Genotypic and antimicrobial resistance characterizations of Cronobacter sakazakii isolated from powdered milk infant formula: A comparison between domestic and imported products. Food Sci. Nutr. 2020, 8, 6708–6717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Q.; Xie, S. Genotypes, enterotoxin gene profiles, and antimicrobial resistance of Staphylococcus aureus associated with foodborne outbreaks in Hangzhou, China. Toxins 2019, 11, 307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Argudín, M.Á.; Mendoza, M.C.; Rodicio, M.R. Food poisoning and Staphylococcus aureus enterotoxins. Toxins 2010, 2, 1751–1773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beuchat, L.R.; Komitopoulou, E.; Beckers, H.; Betts, R.P.; Bourdichon, F.; Fanning, S.; Joosten, H.M.; Ter Kuile, B.H. Low–water activity foods: Increased concern as vehicles of foodborne pathogens. J. Food Prot. 2013, 76, 150–172. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-Maldonado, A.F.; Lee, A.; Farber, J.M. Methods for the control of foodborne pathogens in low-moisture foods. Annu. Rev. Food Sci. Technol. 2018, 9, 177–208. [Google Scholar] [CrossRef] [Scilit]
- Arabestani, M.R.; Kamarehei, F.; Dini, M.; Jalilian, F.A.; Moradi, A.; Shokoohizadeh, L. Characterization of Staphylococcus aureus isolates from pastry samples by rep-PCR and phage typing. Iran. J. Microbiol. 2022, 14, 76. [Google Scholar] [CrossRef] [Scilit]
- Larsen, A.; Stegger, M.; Sørum, M. spa typing directly from a mecA, spa and pvl multiplex PCR assay—A cost-effective improvement for methicillin-resistant Staphylococcus aureus surveillance. Clin. Microbiol. Infect. 2008, 14, 611–614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Legese, H.; Kahsay, T.; Gebrewahd, A.; Berhe, B.; Fseha, B.; Tadesse, S.; Gebremariam, G.; Negash, H.; Mardu, F.; Tesfay, K. Prevalence, antimicrobial susceptibility pattern, and associated factors of Salmonella and Shigella among food handlers in Adigrat University student’s cafeteria, northern Ethiopia, 2018. Trop. Dis. Travel Med. Vaccines 2020, 6, 19. [Google Scholar] [CrossRef] [Scilit]
- Nafarrate, I.; Lasagabaster, A.; Sevillano, E.; Mateo, E. Prevalence, molecular typing and antimicrobial susceptibility of Campylobacter spp. isolates in northern Spain. J. Appl. Microbiol. 2021, 130, 1368–1379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pakbin, B.; Brück, W.M.; Rossen, J.W. Virulence factors of enteric pathogenic Escherichia coli: A review. Int. J. Mol. Sci. 2021, 22, 9922. [Google Scholar] [CrossRef] [Scilit]
- Bennani, H.; Mateus, A.; Mays, N.; Eastmure, E.; Stärk, K.D.; Häsler, B. Overview of evidence of antimicrobial use and antimicrobial resistance in the food chain. Antibiotics 2020, 9, 49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caniça, M.; Manageiro, V.; Abriouel, H.; Moran-Gilad, J.; Franz, C.M. Antibiotic resistance in foodborne bacteria. Trends Food Sci. Technol. 2019, 84, 41–44. [Google Scholar] [CrossRef] [Scilit]
- Fetsch, A.; Johler, S. Staphylococcus aureus as a foodborne pathogen. Curr. Clin. Microbiol. Rep. 2018, 5, 88–96. [Google Scholar] [CrossRef] [Scilit]
- Rahimi, E. Enterotoxigenicity of Staphylococcus aureus isolated from traditional and commercial dairy products marketed in Iran. Braz. J. Microbiol. 2013, 44, 393–399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huong, B.T.M.; Mahmud, Z.H.; Neogi, S.B.; Kassu, A.; Van Nhien, N.; Mohammad, A.; Yamato, M.; Ota, F.; Lam, N.T.; Dao, H.T.A. Toxigenicity and genetic diversity of Staphylococcus aureus isolated from Vietnamese ready-to-eat foods. Food Control 2010, 21, 166–171. [Google Scholar] [CrossRef] [Scilit]
- Kim, N.; Yun, A.R.; Rhee, M. Prevalence and classification of toxigenic Staphylococcus aureus isolated from refrigerated ready-to-eat foods (sushi, kimbab and California rolls) in Korea. J. Appl. Microbiol. 2011, 111, 1456–1464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahfoozi, A.; Shirzad-Aski, H.; Kaboosi, H.; Ghaemi, E. Identification of the classical enterotoxin genes of Staphylococcus aureus in various foods by multiplex PCR assay. Iran. J. Vet. Res. 2019, 20, 209. [Google Scholar] [PubMed]
- Hassani, S.; Pakbin, B.; Allahyari, S.; Mahmoudi, R.; Mousavi, S.; Ghajarbeygi, P. Prevalence and antimicrobial susceptibility of foodborne bacterial pathogens isolated from baghlava an iranian exporting pastry sweet. Carpathian J. Food Sci. Technol. 2022, 14, 57–69. [Google Scholar]
- Pakbin, B.; Amani, Z.; Allahyari, S.; Mousavi, S.; Mahmoudi, R.; Brück, W.M.; Peymani, A. Genetic diversity and antibiotic resistance of Shigella spp. isolates from food products. Food Sci. Nutr. 2021, 9, 6362–6371. [Google Scholar] [CrossRef] [Scilit]
- Nisa, I.; Qasim, M.; Driessen, A.; Nijland, J.; Ali, A.; Mirza, M.R.; Khan, M.A.; Khan, T.A.; Jalal, A.; Rahman, H. Prevalence and associated risk factors of Shigella flexneri isolated from drinking water and retail raw foods in Peshawar, Pakistan. J. Food Sci. 2021, 86, 2579–2589. [Google Scholar] [CrossRef] [Scilit]
- Dranenko, N.O.; Tutukina, M.N.; Gelfand, M.S.; Kondrashov, F.A.; Bochkareva, O.O. Chromosome-encoded IpaH ubiquitin ligases indicate non-human enteroinvasive Escherichia. Sci. Rep. 2022, 12, 6868. [Google Scholar] [CrossRef] [Scilit]
- Ling, N.; Jiang, X.; Forsythe, S.; Zhang, D.; Shen, Y.; Ding, Y.; Wang, J.; Zhang, J.; Wu, Q.; Ye, Y. Food safety risks and contributing factors of Cronobacter spp. Engineering 2022, 12, 128–138. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.-B.; Park, Y.-B.; Kang, S.-H.; Lee, M.-J.; Kim, K.-C.; Jeong, H.-R.; Kim, D.-H.; Yoon, M.-H.; Lee, J.-B.; Oh, D.-H. Prevalence, genetic diversity, and antibiotic susceptibility of Cronobacter spp.(Enterobacter sakazakii) isolated from Sunshik, its ingredients and soils. Food Sci. Biotechnol. 2011, 20, 941–948. [Google Scholar] [CrossRef] [Scilit]
- Endtz, H.P. Campylobacter infections. In Hunter’s Tropical Medicine and Emerging Infectious Diseases; Elsevier: Amsterdam, The Netherlands, 2020; pp. 507–511. [Google Scholar]
- Asuming-Bediako, N.; Parry-Hanson Kunadu, A.; Abraham, S.; Habib, I. Campylobacter at the human–food interface: The african perspective. Pathogens 2019, 8, 87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gharbi, M.; Béjaoui, A.; Ben Hamda, C.; Alaya, N.; Hamrouni, S.; Bessoussa, G.; Ghram, A.; Maaroufi, A. Campylobacter spp. in Eggs and Laying Hens in the North-East of Tunisia: High Prevalence and Multidrug-Resistance Phenotypes. Vet. Sci. 2022, 9, 108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aaliya, B.; Sunooj, K.V.; Navaf, M.; Akhila, P.P.; Sudheesh, C.; Mir, S.A.; Sabu, S.; Sasidharan, A.; Hlaing, M.T.; George, J. Recent trends in bacterial decontamination of food products by hurdle technology: A synergistic approach using thermal and non-thermal processing techniques. Food Res. Int. 2021, 147, 110514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shane, S. Campylobacter infection of commercial poultry. Rev. Sci. Tech.-Off. Int. Epizoot. 2000, 19, 376–385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malavi, D.N.; Abong, G.O.; Muzhingi, T. Effect of food safety training on behavior change of food handlers: A case of orange-fleshed sweetpotato purée processing in Kenya. Food Control 2021, 119, 107500. [Google Scholar] [CrossRef] [Scilit]
- Lee, G.-I.; Lee, H.-M.; Lee, C.-H. Food safety issues in industrialization of traditional Korean foods. Food Control 2012, 24, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Papp-Wallace, K.M. The latest advances in β-lactam/β-lactamase inhibitor combinations for the treatment of Gram-negative bacterial infections. Expert Opin. Pharmacother. 2019, 20, 2169–2184. [Google Scholar] [CrossRef] [Scilit]
- Wu, Z.; Luo, Y.; Bao, J.; Luo, Y.; Yu, Z. Additives affect the distribution of metabolic profile, microbial communities and antibiotic resistance genes in high-moisture sweet corn kernel silage. Bioresour. Technol. 2020, 315, 123821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Gene | Primer | Sequence (5′ → 3′) | Reference |
|---|---|---|---|
| spa | spa1 | TAAAGACGATCCTTCGGTGAGC | [17] |
| spa2 | CAGCAGTAGTGCCGTTTGCTT | ||
| ompA | ompAF | GGATTTAACCGTGAACTTTTCC | [6] |
| ompAR | CGCCAGCGATGTTAGAAGA | ||
| ipaH | ipaHF | GTTCCTTGACCGCCTTTCCGATACCGTC | [18] |
| ipaHR | GCCGGTCAGCCACCCTCTGAGAGTAC | ||
| hipO | hipOF | AATGCACAAATTTGCCTTATAAAAGC | [19] |
| hipOR | TNCCATTAAAATTCTGACTTGCTAAATA | ||
| cadF | cadFF | GAGAAATTTTATTTTTATGGTTTAGCTGGT | [19] |
| cadFR | ACCTGCTCCATAATGGCCAA | ||
| blaTEM | blaTEMF | CATTTCCGTGTCGCCCTTATTC | [18] |
| blaTEMR | CGTTCATCCATAGTTGCCTGAC | ||
| blaSHV | blaSHVF | AGCCGCTTGAGCAAATTAAAC | [18] |
| blaSHVR | ATCCCGCAGATAAATCACCAC | ||
| blaOXA | blaOXAF | GGCACCAGATTCAACTTTCAAG | [18] |
| blaOXAR | GACCCCAAGTTTCCTGTAAGTG | ||
| blaCTX-M-1 | CTXM1F | TTAGGAARTGTGCCGCTGYA | [18] |
| CTXM1R | CGATATCGTTGGTGGTRCCAT | ||
| blaCTX-M-2 | CTXM2F | CGTTAACGGCACGATGAC | [18] |
| CTXM2R | CGATATCGTTGGTGGTRCCAT | ||
| blaCTX-M-8 | CTXM8F | AACRCRCAGACGCTCTAC | [18] |
| CTXM8R | TCGAGCCGGAASGTGTYAT | ||
| blaCTX-M-9 | CTXM9F | TCAAGCCTGCCGATCTGGT | [18] |
| CTXM9R | TGATTCTCGCCGCTGAAG |
| Foodborne Bacterial Pathogen Profile a | Positive Samples (%) (n) | |
|---|---|---|
| Single | SA | 25 (10) |
| SH | 15 (6) | |
| CR | 2.5 (1) | |
| CC | 2.5 (1) | |
| Double | SH + CC | 10 (4) |
| SA + SH | 5 (2) | |
| SA + CC | 2.5 (1) | |
| SA + CJ | 2.5 (1) | |
| CR + CC | 2.5 (1) | |
| SH + CR | 2.5 (1) | |
| Multiple | SA + CR + SH | 2.5 (1) |
| CR + SH + CC | 2.5 (1) | |
| SA + SH + CC | 2.5 (1) | |
| SA + CR + SH + CC | 5 (2) | |
| SA + CR + CJ + CC | 2.5 (1) |
| C. coli | C. jejuni | Cr. sakazakii | Shigella spp. | S. aureus | |
|---|---|---|---|---|---|
| C. coli | 1.000 | 0.100 | 0.355 * | 0.285 | −0.076 |
| C. jejuni | 1.000 | 0.172 | −0.208 | 0.241 | |
| cr. sakazakii | 1.000 | 0.176 | 0.025 | ||
| Shigella spp. | 1.000 | −0.257 | |||
| S. aureus | 1.000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pakbin, B.; Amani, Z.; Rahimi, Z.; Najafi, S.; Familsatarian, B.; Khakpoor, A.; Brück, W.M.; Brück, T.B. Prevalence of Foodborne Bacterial Pathogens and Antibiotic Resistance Genes in Sweets from Local Markets in Iran. Foods 2023, 12, 3645. https://doi.org/10.3390/foods12193645
Pakbin B, Amani Z, Rahimi Z, Najafi S, Familsatarian B, Khakpoor A, Brück WM, Brück TB. Prevalence of Foodborne Bacterial Pathogens and Antibiotic Resistance Genes in Sweets from Local Markets in Iran. Foods. 2023; 12(19):3645. https://doi.org/10.3390/foods12193645
Chicago/Turabian StylePakbin, Babak, Zahra Amani, Zahra Rahimi, Somayeh Najafi, Behnaz Familsatarian, Alireza Khakpoor, Wolfram Manuel Brück, and Thomas B. Brück. 2023. "Prevalence of Foodborne Bacterial Pathogens and Antibiotic Resistance Genes in Sweets from Local Markets in Iran" Foods 12, no. 19: 3645. https://doi.org/10.3390/foods12193645
APA StylePakbin, B., Amani, Z., Rahimi, Z., Najafi, S., Familsatarian, B., Khakpoor, A., Brück, W. M., & Brück, T. B. (2023). Prevalence of Foodborne Bacterial Pathogens and Antibiotic Resistance Genes in Sweets from Local Markets in Iran. Foods, 12(19), 3645. https://doi.org/10.3390/foods12193645

