Activity Changes of the Peptic Lactoferrin Hydrolysate in Human Gastric Cancer AGS Cells in Response to Cu(II) or Mn(II) Addition
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Sample Preparation
2.3. Cell Culture Conditions
2.4. Colony Formation Assay
2.5. Assay of DNA Fragmentation by Gel Electrophoresis
2.6. Assay of Apoptotic Induction
2.7. RT-PCR Assay
2.8. Western-Blot Assay
2.9. Statistical Analysis
3. Results
3.1. Effects of LFH and Mixtures I–IV on Colony Formation of AGS Cells
3.2. DNA Fragmentation and Cell Apoptosis in Response to LFH and Mixtures I–IV
3.3. Effects of LFH and Mixtures I–IV on the Expression of Apoptosis-Related Genes
3.4. Bax, Bcl-2, and Caspase-3 Protein Expression in Response to LFH and Mixtures I–IV
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Naidu, A.S. Lactoferrin: Natural-Multifunctional-Antimicrobial; CRC Press LLC: Boca Raton, FL, USA, 2000. [Google Scholar]
- Lonnerdal, B. Iyer S Lactoferrin: Molecular structure and biological function. Annu. Rev. Nutr. 1995, 15, 93–110. [Google Scholar] [CrossRef] [PubMed]
- García-Montoya, I.A.; Cendón, T.S.; Arévalo-Gallegos, S.; Rascón-Cruz, Q. Lactoferrin a multiple bioactive protein: An overview. Biochim. Biophys. Acta Gen. Subj. 2012, 1820, 226–236. [Google Scholar] [CrossRef] [PubMed]
- Huma, B.; Trang, T.; Nidhi, B.; Lisbeth, G.; Bhesh, B. Evaluation of different methods for determination of the iron saturation level in bovine lactoferrin. Food Chem. 2014, 152, 121–127. [Google Scholar]
- Xu, X.; Jiang, H.; Li, H.; Zhang, T.; Zhou, Q.; Liu, N. Apoptosis of stomach cancer cell SGC-7901 and regulation of Akt signaling way induced by bovine lactoferrin. J. Dairy Sci. 2010, 93, 2344–2350. [Google Scholar] [CrossRef] [Green Version]
- Pan, W.R.; Chen, P.W.; Chen, Y.L.; Hsu, H.C.; Lin, C.C.; Chen, W.J. Bovine lactoferricin B (LFcinB25) induces apoptosis of human gastric cancer cell line AGS by inhibition of autophagy at a late stage. J. Dairy Sci. 2013, 96, 7511–7520. [Google Scholar] [CrossRef] [Green Version]
- Bo, L.Y.; Li, T.J.; Zhao, X.H. Copper or magnesium supplementation endows the peptic hydrolysate from bovine lactoferrin with enhanced activity to human gastric cancer AGS cells. Biol. Trace Elem. Res. 2019, 189, 64–74. [Google Scholar] [CrossRef]
- Bo, L.-Y.; Li, T.-J.; Zhao, X.-H. Effect of Cu/Mn-Fortification on In Vitro Activities of the Peptic Hydrolysate of Bovine Lactoferrin against Human Gastric Cancer BGC-823 Cells. Molecules 2019, 24, 1195. [Google Scholar] [CrossRef] [Green Version]
- Xia, J.Y.; Aadam, A.A. Advances in screening and detection of gastric cancer. J. Surg. Oncol. 2022, 125, 1104–1109. [Google Scholar] [CrossRef]
- Pan, G.; O’Rourke, K.; Chinnaiyan, A.M.; Gentz, R.; Ebner, R.; Ni, J.; Dixit, V.M. The Receptor for the Cytotoxic Ligand TRAIL. Science 1997, 276, 111–113. [Google Scholar] [CrossRef]
- Rodzik, A.; Pomastowski, P.; Sagandykova, G.N.; Buszewski, B. Interactions of Whey Proteins with Metal Ions. Int. J. Mol. Sci. 2020, 21, 2156. [Google Scholar] [CrossRef] [Green Version]
- Jomova, K.; Makova, M.; Suliman, Y.; Alomar, S.Y.; Alwasel, S.H.; Nepovimova, E.; Kuca, K.; Rhodes, C.J.; Valko, M. Essential metals in health and disease. Chem-Biol. Interact. 2022, 367, 110173. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Zhou, H.; Huang, G.; Liu, N. Inhibition of HBV infection by bovine lactoferrin and iron-, zinc-saturated lactoferrin. Med. Microbiol. Immunol. 2009, 198, 19–25. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Prohaska, J.R.; Thiele, D.J. Essential role for mammalian copper transporter Ctr1 in copper homeostasis and embryonic development. Proc. Natl. Acad. Sci. USA 2001, 98, 6842–6847. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, J.; Uppal, K.; Liu, K.H.; Hu, X.; Orr, M.; Tran, V.; Go, Y.-M.; Jones, D.P. Antagonistic Interactions in Mitochondria ROS Signaling Responses to Manganese. Antioxidants 2023, 12, 804. [Google Scholar] [CrossRef] [PubMed]
- Beard, J.L. Iron Biology in Immune Function, Muscle Metabolism and Neuronal Functioning. J. Nutr. 2001, 131, 568S–580S. [Google Scholar] [CrossRef] [Green Version]
- Tisato, F.; Marzano, C.; Porchia, M.; Pellei, M.; Santini, C. Copper in diseases and treatments, and copper-based anticancer strategies. Med. Res. Rev. 2010, 30, 708–749. [Google Scholar] [CrossRef]
- Yu, Y.; Wong, J.; Lovejoy, B.D.; Kalinowski, S.; Richardsond, D.R. Chelators at the cancer coalface: Desferrioxamine to triapine and beyond. Clin. Cancer Res. 2006, 12, 6876–6883. [Google Scholar] [CrossRef] [Green Version]
- Xu, X.-L.; Shao, J.; Chen, Q.-Y.; Li, C.-H.; Kong, M.-Y.; Fang, F.; Ji, L.; Boison, D.; Huang, T.; Gao, J.; et al. A Mn(II) complex of boradiazaindacene (BODIPY) loaded graphene oxide as both LED light and H2O2 enhanced anticancer agent. J. Inorg. Biochem. 2016, 159, 1–6. [Google Scholar] [CrossRef] [Green Version]
- Bellamy, W.; Takase, M.; Wakabayashi, H.K.; Kawase, K.; Tomita, M. Antibacterial spectrum of lactoferricin B, a potent bac-tericidal peptide derived from the N-terminal region of bovine lactoferrin. J. Appl. Bacteriol. 1992, 73, 472–479. [Google Scholar] [CrossRef]
- Masson, P.L.; Heremans, J.F. Metal-Combining Properties of Human Lactoferrin (Red Milk Protein). 1. The Involvement of Bicarbonate in the Reaction. JBIC J. Biol. Inorg. Chem. 1968, 6, 579–584. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆Ct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Rayaprolu, S.J.; Hettiarachchy, N.S.; Horax, R.; Kumar-Phillips, G.; Liyanage, R.; Lay, J.; Chen, P.Y. Purification and charac-terization of a peptide from soybean with cancer cell proliferation inhibition. J. Food Biochem. 2017, 41, 12374. [Google Scholar] [CrossRef]
- Abeysekera, W.; Premakumara, G.; Dar, A.; Choudhary, M.I.; Ratnasooriya, W.; Kashif, M.; Mudassar, C.; Ali, S.; Chandrasekharan, N. Growth Inhibition and Cytotoxicity in Human Lung and Cervical Cancer Cell Lines and Glutathione S-Transferase Inhibitory Activity of Selected Sri Lankan Traditional Red Rice (Oryza Sativa L.) Brans. J. Food Biochem. 2015, 39, 585–593. [Google Scholar] [CrossRef]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef]
- West, N.J.; Courtney, E.D.; Poullis, A.P.; Leicester, R.J. Apoptosis in the Colonic Crypt, Colorectal Adenomata, and Manipulation by Chemoprevention. Cancer Epidemiol. Biomark. Prev. 2009, 18, 1680–1687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wyllie, A.H.; Beattie, G.J.; Hargreaves, A.D. Chromatin changes in apoptosis. Histochem. J. 1981, 13, 681–692. [Google Scholar] [CrossRef] [PubMed]
- Yoo, Y.-C.; Watanabe, S.; Watanabe, R.; Hata, K.; Shimazaki, K.-I.; Azuma, I. Bovine Lactoferrin and LactoferricinTM Inhibit Tumor Metastasis in Mice. Adv. Exp. Med. Biol. 1997, 443, 285–291. [Google Scholar] [CrossRef]
- Mao, X.; Gu, J.; Sun, Y.; Xu, S.; Zhang, X.; Yang, H.; Ren, F. Anti-proliferative and anti-tumour effect of active components in donkey milk on A549 human lung cancer cells. Int. Dairy J. 2009, 19, 703–708. [Google Scholar] [CrossRef]
- Sheih, I.-C.; Fang, T.J.; Wu, T.-K.; Lin, P.-H. Anticancer and Antioxidant Activities of the Peptide Fraction from Algae Protein Waste. J. Agric. Food Chem. 2010, 58, 1202–1207. [Google Scholar] [CrossRef]
- Yang, J.I.; Tang, J.Y.; Liu, Y.S.; Wang, H.R.; Lee, S.Y.; Yen, C.Y.; Chang, H.W. Roe protein hydrolysates of giant grouper (Epi-nephelus Lanceolatus) inhibit cell proliferation of oral cancer cells involving apoptosis and oxidative stress. Biomed. Res. Int. 2016, 23, 112. [Google Scholar]
- Furlong, S.J.; Mader, J.S.; Hoskin, D.W. Bovine lactoferricin induces caspase-independent apoptosis in human B-lymphoma cells and extends the survival of immune-deficient mice bearing B-lymphoma xenogafts. Exp. Mol. Pathol. 2010, 88, 371–375. [Google Scholar] [CrossRef] [PubMed]
- Cutone, A.; Rosa, L.; Ianiro, G.; Lepanto, M.S.; di Patti, M.C.B.; Valenti, P.; Musci, G. Lactoferrin’s Anti-Cancer Properties: Safety, Selectivity, and Wide Range of Action. Biomolecules 2020, 10, 456. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pfeffer, C.M.; Singh, A.T.K. Apoptosis: A Target for Anticancer Therapy. Int. J. Mol. Sci. 2018, 19, 448. [Google Scholar] [CrossRef] [Green Version]
- Pistritto, G.; Trisciuoglio, D.; Ceci, C.; Garufi, A.; D’Orazi, G. Apoptosis as anticancer mechanism: Function and dysfunction of its modulators and targeted therapeutic strategies. Aging 2016, 8, 603–619. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, P.; Zhou, L.; Zhao, T.; Liu, X.; Zhang, P.; Liu, Y.; Zheng, X.; Li, Q. Caspase-9: Structure, mechanisms and clinical application. Oncotarget 2017, 8, 23996–24008. [Google Scholar] [CrossRef] [Green Version]
- Tummers, B.; Green, D.R. Caspase-8: Regulating life and death. Immunol. Rev. 2017, 277, 76–89. [Google Scholar] [CrossRef] [Green Version]
- Fulda, S.; Debatin, K.-M. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 2006, 25, 4798–4811. [Google Scholar] [CrossRef] [Green Version]
- Reed, K.L.; Blaeser, L.L.; Dantzer, V.M.; Green, L.; Simmen, R.C. Control of secretory leukocyte protease inhibitor gene ex-pression in the porcine periimplantation endometrium: A case of maternal-embryo communication. Biol. Reprod. 1998, 58, 448–457. [Google Scholar] [CrossRef] [Green Version]
- Ashe, P.C.; Berry, M.D. Apoptotic signaling cascades. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2003, 27, 199–214. [Google Scholar] [CrossRef]
- Hardwick, J.M.; Soane, L. Multiple Functions of BCL-2 Family Proteins. Cold Spring Harb. Perspect. Biol. 2013, 5, a008722. [Google Scholar] [CrossRef] [Green Version]
- Chauhan, D.; Velankar, M.; Brahmandam, M.; Hideshima, T.; Podar, K.; Richardson, P.; Schlossman, R.I.; Ghobrial, N.; Raje, N.M.; Anderson, K.C. A novel Bcl-2/Bcl-XL/Bcl-w inhibitor ABT-737 as therapy in multiple myeloma. Oncogene 2007, 26, 2374–2380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mirjolet, J.F.; Barberi-Heyob, M.; Didelot, C.; Peyrat, J.-P.; Abecassis, J.; Millon, R.; Merlin, J.L. Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status. Brit. J. Cancer 2000, 83, 1380–1386. [Google Scholar] [CrossRef] [PubMed]
- Huang, F.; Yang, Z.; Yu, D.; Wang, J.; Li, R.; Ding, G. Sepia Ink Oligopeptide Induces Apoptosis in Prostate Cancer Cell Lines via Caspase-3 Activation and Elevation of Bax/Bcl-2 Ratio. Mar. Drugs 2012, 10, 2153–2165. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, M.; Mu, T.H. Contribution of different molecular weight fractions to anticancer effect of sweet potato protein hy-drolysates by six proteases on HT-29 colon cancer cells. Int. J. Food Sci. Technol. 2018, 53, 525–532. [Google Scholar] [CrossRef]
- Dia, V.P.; de Mejia, E.G. Lunasin promotes apoptosis in human colon cancer cells by mitochondrial pathway activation and induction of nuclear clusterin expression. Cancer Lett. 2010, 295, 44–53. [Google Scholar] [CrossRef]
Genes | Primer Sequences (5′-3′) | Primer Lengths (bp) |
---|---|---|
Bax | Forward GAAGACCTGGATGCTCTGGAACAC | 159 |
Reverse GAGTACCACGAAGGCACAACTGAC | ||
Bcl-2 | Forward ACATCCATTATAAGCTGTGGCAGAGG | 166 |
Reverse TGCAGCGGCGAGGTCCTG | ||
Caspase-3 | Forward TTGAGACAGACAGTGGTGTTGATGATG | 98 |
Reverse ATAATAACCAGGTGCTGTGGAGTATGC | ||
β-Actin | Forward GGAGCTGCCGTTATACTGTTCTGG | 240 |
Reverse TGCCTCCTGTGTCTTCAATCTTGC |
Genes | LFH | Mixture I | Mixture II | Mixture III | Mixture IV |
---|---|---|---|---|---|
Bax | 2.23 ± 0.07 | 2.35 ± 0.05 | 2.54 ± 0.05 | 2.64 ± 0.05 | 2.83 ± 0.03 |
Bcl-2 | 0.96 ± 0.03 | 0.95 ± 0.04 | 0.92 ± 0.02 | 0.90 ± 0.03 | 0.88 ± 0.07 |
Caspase-3 | 1.21 ± 0.10 | 1.65 ± 0.18 | 2.34 ± 0.08 | 3.07 ± 0.05 | 3.26 ± 0.01 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bo, L.-Y.; Pan, Z.-Q.; Zhang, Q.; Song, C.-L.; Ren, J.; Zhao, X.-H. Activity Changes of the Peptic Lactoferrin Hydrolysate in Human Gastric Cancer AGS Cells in Response to Cu(II) or Mn(II) Addition. Foods 2023, 12, 2662. https://doi.org/10.3390/foods12142662
Bo L-Y, Pan Z-Q, Zhang Q, Song C-L, Ren J, Zhao X-H. Activity Changes of the Peptic Lactoferrin Hydrolysate in Human Gastric Cancer AGS Cells in Response to Cu(II) or Mn(II) Addition. Foods. 2023; 12(14):2662. https://doi.org/10.3390/foods12142662
Chicago/Turabian StyleBo, Li-Ying, Zhi-Qin Pan, Qiang Zhang, Chun-Li Song, Jian Ren, and Xin-Huai Zhao. 2023. "Activity Changes of the Peptic Lactoferrin Hydrolysate in Human Gastric Cancer AGS Cells in Response to Cu(II) or Mn(II) Addition" Foods 12, no. 14: 2662. https://doi.org/10.3390/foods12142662
APA StyleBo, L.-Y., Pan, Z.-Q., Zhang, Q., Song, C.-L., Ren, J., & Zhao, X.-H. (2023). Activity Changes of the Peptic Lactoferrin Hydrolysate in Human Gastric Cancer AGS Cells in Response to Cu(II) or Mn(II) Addition. Foods, 12(14), 2662. https://doi.org/10.3390/foods12142662