CE–RAA–CRISPR Assay: A Rapid and Sensitive Method for Detecting Vibrio parahaemolyticus in Seafood
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacteria Culture and Genomic DNA Extraction
2.2. Primer Design
2.3. Standard RAA System
2.4. Real-Time RAA and PCR
2.5. CE–RAA–CRISPR System
2.6. Evaluation of Limit of Detection (LOD) of qRAA, RAA–CRISPR, and CE–RAA–CRISPR in Pure Culture
2.7. Evaluation of CE–RAA–CRISPR in Artificially Contaminated Shrimp
2.8. Determination of Specificity
2.9. Comparison of CE–RAA–CRISPR with qPCR Assay on Real Samples
2.10. Data Analyses
3. Results
3.1. Optimization of Primers for RAA
3.2. Optimization of CRISPR Reaction
3.3. Effects of Chemical Additives
3.4. LOD Comparison of qRAA, RAA–CRISPR, and CE–RAA–CRISPR Methods
3.5. LOD of CE–RAA–CRISPR Method in Artificially Contaminated Shrimp
3.6. Specificity of CE–RAA–CRISPR Assays
3.7. Evaluating Consistency between CE–RAA–CRISPR and qPCR Assays Using Actual Samples
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, Y.; Zhang, S.; Li, J.; Chen, M.; He, M.; Wang, Y.; Zhang, Y.; Jing, H.; Ma, H.; Li, Y.; et al. Application of digital PCR and next generation sequencing in the etiology investigation of a foodborne disease outbreak caused by Vibrio parahaemolyticus. Food Microbiol. 2019, 84, 103233. [Google Scholar] [CrossRef] [PubMed]
- Zhu, P.; Gao, W.; Huang, H.; Jiang, J.; Chen, X.; Fan, J.; Yan, X. Rapid detection of Vibrio parahaemolyticus in shellfish by real-time recombinase polymerase amplification. Food Anal. Methods 2018, 11, 2076–2084. [Google Scholar] [CrossRef]
- Zhang, B.; Sun, W.; Ran, L.; Wang, C.; Wang, J.; An, R.; Liang, X. Anti-Interference Detection of Vibrio parahaemolyticus from Aquatic Food Based on Target-Cyclized RCA with Dynamic Adapter Followed by LAMP. Foods 2022, 11, 352. [Google Scholar] [CrossRef] [PubMed]
- Duan, N.; Yan, Y.; Wu, S.; Wang, Z. Vibrio parahaemolyticus detection aptasensor using surface-enhanced Raman scattering. Food Control 2016, 63, 122–127. [Google Scholar] [CrossRef]
- Zhao, S.; Ma, L.; Wang, Y.; Fu, G.; Zhou, J.; Li, X.; Fang, W. Antimicrobial resistance and pulsed-field gel electrophoresis typing of Vibrio parahaemolyticus isolated from shrimp mariculture environment along the east coast of China. Mar. Pollut. Bull. 2018, 136, 164–170. [Google Scholar] [CrossRef] [PubMed]
- Khueankhancharoen, J.; Thipayarat, A.; Saranak, J. Optimized microscale detection of amino acid decarboxylase for rapid screening of Salmonella in the selective enrichment step. Food Control 2016, 69, 352–367. [Google Scholar] [CrossRef]
- Cao, X.; Zhao, L.; Zhang, J.; Chen, X.; Shi, L.; Fang, X.; Xie, H.; Chang, Y.; Wang, L. Detection of viable but nonculturable Vibrio parahaemolyticus in shrimp samples using improved real-time PCR and real-time LAMP methods. Food Control 2019, 103, 145–152. [Google Scholar] [CrossRef]
- Ling, N.; Shen, J.; Guo, J.; Zeng, D.; Ren, J.; Sun, L.; Jiang, Y.; Xue, F.; Dai, J.; Li, B. Rapid and accurate detection of viable Vibrio parahaemolyticus by sodium deoxycholate-propidium monoazide-qPCR in shrimp. Food Control 2020, 109, 106883. [Google Scholar] [CrossRef]
- Lei, S.; Gu, X.; Zhong, Q.; Duan, L.; Zhou, A. Absolute quantification of Vibrio parahaemolyticus by multiplex droplet digital PCR for simultaneous detection of tlh, tdh and ureR based on single intact cell. Food Control 2020, 114, 107207. [Google Scholar] [CrossRef]
- Techathuvanan, C.; Draughon, F.A.; D’Souza, D.H. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments. J. Food Prot. 2011, 74, 294–301. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Wang, J.; Sun, X.; Wang, J.; Chen, Z.; Xu, X.; Dong, M.; Guo, Y.; Wang, Y.; Chen, P.; et al. Development and Evaluation of the Rapid and Sensitive RPA Assays for Specific Detection of Salmonella spp. in Food Samples. Front. Cell. Infect. Microbiol. 2021, 11, 631921. [Google Scholar] [CrossRef]
- James, A.; Macdonald, J. Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics. Expert Rev. Mol. Diagn. 2015, 15, 1475–1489. [Google Scholar] [CrossRef] [Green Version]
- Ma, B.; Li, J.; Chen, K.; Yu, X.; Sun, C.; Zhang, M. Multiplex recombinase polymerase amplification assay for the simultaneous detection of three foodborne pathogens in seafood. Foods 2020, 9, 278. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qian, J.; Huang, D.; Ni, D.; Zhao, J.; Shi, Z.; Fang, M.; Xu, Z. A portable CRISPR Cas12a based lateral flow platform for sensitive detection of Staphylococcus aureus with double insurance. Food Control 2022, 132, 108485. [Google Scholar] [CrossRef]
- Aman, R.; Mahas, A.; Mahfouz, M. Nucleic acid detection using CRISPR/Cas biosensing technologies. ACS Synth. Biol. 2020, 9, 1226–1233. [Google Scholar] [CrossRef]
- Zhu, C.; Liu, C.; Qiu, X.; Xie, S.; Li, W.; Zhu, L.; Zhu, L. Novel nucleic acid detection strategies based on CRISPR-Cas systems: From construction to application. Biotechnol. Bioeng. 2020, 117, 2279–2294. [Google Scholar] [CrossRef] [PubMed]
- Swarts, D.C.; Jinek, M. Mechanistic Insights into the cis- and trans-Acting DNase Activities of Cas12a. Mol. Cell 2019, 73, 589–600. [Google Scholar] [CrossRef] [Green Version]
- Yamano, T.; Nishimasu, H.; Zetsche, B.; Hirano, H.; Slaymaker, I.M.; Li, Y.; Fedorova, I.; Nakane, T.; Makarova, K.S.; Koonin, E.V.; et al. Crystal Structure of Cpf1 in Complex with Guide RNA and Target DNA. Cell 2016, 165, 949–962. [Google Scholar] [CrossRef]
- Wu, H.; Chen, Y.; Yang, Q.; Peng, C.; Wang, X.; Zhang, M.; Qian, S.; Xu, J.; Wu, J. A reversible valve-assisted chip coupling with integrated sample treatment and CRISPR/Cas12a for visual detection of Vibrio parahaemolyticus. Biosens. Bioelectron. 2021, 188, 113352. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Liu, T.; Liu, C.; Xu, Q.; Fang, S.; Wu, Y.; Wu, M.; Liu, Q. An ultrasensitive and contamination-free on-site nucleic acid detection platform for Listeria monocytogenes based on the CRISPR-Cas12a system combined with recombinase polymerase amplification. LWT—Food Sci. Technol. 2021, 152, 112166. [Google Scholar] [CrossRef]
- Cai, Q.; Wang, R.; Qiao, Z.; Yang, W. Single-digit Salmonella detection with the naked eye using bio-barcode immunoassay coupled with recombinase polymerase amplification and a CRISPR-Cas12a system. Analyst 2021, 146, 5271–5279. [Google Scholar] [CrossRef]
- Meng, Q.; Yang, H.; Zhang, G.; Sun, W.; Ma, P.; Liu, X.; Dang, L.; Li, G.; Huang, X.; Wang, X.; et al. CRISPR/Cas12a-assisted rapid identification of key beer spoilage bacteria. Innov. Food Sci. Emerg. Technol. 2021, 74, 102854. [Google Scholar] [CrossRef]
- Guo, L.; Sun, X.; Wang, X.; Liang, C.; Jiang, H.; Gao, Q.; Moyu, D.; Qu, B.; Fang, S.; Yihuan, M.; et al. SARS-CoV-2 detection with CRISPR diagnostics. Cell Discov. 2020, 6, 34. [Google Scholar] [CrossRef]
- Juong, J.; Ladha, A.; Saito, M.; Kim, N.; Zhang, F. Detection of SARS-CoV-2 with SHERLOCK One-Pot Testing. N. Engl. J. Med. 2020, 383, 1492–1494. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Zhao, W.; Ma, S.; Li, Z.; Yao, Y.; Fei, T. A chemical-enhanced system for CRISPR-Based nucleic acid detection. Biosens. Bioelectron. 2021, 192, 113493. [Google Scholar] [CrossRef]
- Yang, X.; Zhao, P.; Dong, Y.; Shen, X.; Shen, H.; Li, J.; Jiang, G.; Wang, W.; Dai, H.; Dong, J.; et al. An improved recombinase polymerase amplification assay for visual detection of Vibrio parahaemolyticus with lateral flow strips. J. Food Sci. 2020, 85, 1834–1844. [Google Scholar] [CrossRef]
- Liu, S.; Geng, Y.; Liu, L.; Sun, X.; Shao, J.; Han, B.; Wang, J.; Tan, K. Development of an isothermal amplification-based assay for the rapid detection of Cronobacter spp. J. Dairy Sci. 2018, 101, 4914–4922. [Google Scholar] [CrossRef] [Green Version]
- Li, S.; Cheng, Q.; Wang, J.; Li, X.; Zhang, Z.; Gao, S.; Cao, R.; Zhao, G.; Wang, J. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discov. 2018, 4, 20. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.S.; Ma, E.; Harrington, L.B.; Costa, M.D.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Ke, Y.; Liu, W.; Sun, Y.; Ding, X. A one-pot toolbox based on Cas12a/crRNA enables rapid foodborne pathogen detection at attomolar level. ACS Sens. 2020, 5, 1427–1435. [Google Scholar] [CrossRef]
- Hua, J.; Wang, Y.; Sue, H.; Ding, H.; Sun, X.; Gao, H.; Geng, Y.; Wang, Z. Rapid analysis of Escherichia coli O157:H7 using isothermal recombinase polymerase amplification combined with triple-labeled nucleotide probes. Mol. Cell. Probes 2020, 50, 101501. [Google Scholar] [CrossRef]
- Yin, L.; Duan, N.; Chen, S.; Yao, Y.; Liu, J.; Ma, L. Ultrasensitive pathogenic bacteria detection by a smartphone-read G-quadruplex-based CRISPR-Cas12a bioassay. Sens. Actuators B Chem. 2021, 347, 130586. [Google Scholar] [CrossRef]
- Li, F.; Ye, Q.; Chen, M.; Xiang, X.; Zhang, J.; Pang, R.; Xue, L.; Wang, J.; Gu, Q.; Lei, T.; et al. Cas12aFDet: A CRISPR/Cas12a-based fluorescence platform for sensitive and specific detection of Listeria monocytogenes serotype 4c. Anal. Chim. Acta 2021, 1151, 338248. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Ye, Q.; Li, F.; Xiang, X.; Shang, Y.; Wang, C.; Shao, Y.; Xue, L.; Zhang, J.; Wang, J.; et al. CRISPR/Cas12a based fluorescence-enhanced lateral flow biosensor for detection of Staphylococcus aureus. Sens. Actuators B Chem. 2022, 351, 130906. [Google Scholar] [CrossRef]
- Hong, H.; Sun, C.; Wei, S.; Sun, X.; Mutukumira, A.; Wu, X. Development of a real-time recombinase polymerase amplification assay for rapid detection of Salmonella in powdered infant formula. Int. Dairy J. 2020, 102, 104579. [Google Scholar] [CrossRef]
- Geng, Y.; Tan, K.; Liu, L.; Sun, X.; Zhao, B.; Wang, J. Development and evaluation of a rapid and sensitive RPA assay for specific detection of Vibrio parahaemolyticus in seafood. BMC Microbiol. 2019, 19, 186. [Google Scholar] [CrossRef]
- Wu, J.; Mukama, O.; Wu, W.; Li, Z.; Habimana, J.D.D.; Zhang, Y.; Zeng, R.; Nie, C.; Zeng, L. A CRISPR/Cas12a Based Universal Lateral Flow Biosensor for the Sensitive and Specific Detection of African Swine-Fever Viruses in Whole Blood. Biosensors 2020, 10, 203. [Google Scholar] [CrossRef]







| Serial Number | Species | Strain | CE–RAA–CRISPR Results |
|---|---|---|---|
| 1 | Vibrio parahaemolyticus | ATCC 17802 | + |
| 2 | Vibrio parahaemolyticus | JNUFN 01 | + |
| 3 | Vibrio parahaemolyticus | JNUFN 02 | + |
| 4 | Vibrio parahaemolyticus | JNUFN 03 | + |
| 5 | Vibrio parahaemolyticus | JNUFN 04 | + |
| 6 | Vibrio parahaemolyticus | JNUFN 05 | + |
| 7 | Vibrio parahaemolyticus | JNUFN 06 | + |
| 8 | Vibrio parahaemolyticus | JNUFN 07 | + |
| 9 | Vibrio parahaemolyticus | JNUFN 08 | + |
| 10 | Vibrio parahaemolyticus | JNUFN 09 | + |
| 11 | Vibrio parahaemolyticus | JNUFN 10 | + |
| 12 | Escherichia coli O157:H7 | ATCC 35150 | − |
| 13 | Enteroinvasive Escherichia coli | CICC 10662 | − |
| 14 | Enterotoxigenic Escherichia coli | CICC 10667 | − |
| 15 | Escherichia coli O127: K63 | CICC 10411 | − |
| 16 | Escherichia coli EPEC O86: K61 | CICC 10412 | − |
| 17 | Staphylococcus aureus | ATCC 25923 | − |
| 18 | Cronobacter sakazakii | ATCC 29544 | − |
| 19 | Listeria monocytogenes | ATCC 19115 | − |
| 20 | Vibrio alginolyticus | ATCC 33787 | − |
| 21 | Pseudomonas aeruginosa | ATCC 15442 | − |
| 22 | Pseudomonas aeruginosa | ATCC 27853 |
| Name | Sequence (5′-3′) |
|---|---|
| RAA-F1 | AGATTTGGCGAACGAGAACGCAGACATTACG |
| RAA-F2 | TTAGATTTGGCGAACGAGAACGCAGACATTA |
| RAA-F3 | TTAGATTTGGCGAACGAGAACGCAGACATTACG |
| RAA-R1 | GTCACCGAGTGCAACCACTTTGTTGATTTGA |
| RAA-R2 | TTGCCTGTATCAGACAAGCTGTCACCGAGTG |
| RAA-R3 | TGTTGCCTGTATCAGACAAGCTGTCACCGAGTG |
| RAA-Probe | TGACAATCGCTTCTCATACAACCACACGA/i6FAMdT//THF//iBHQ1dT/GGAGCAACGACGCA |
| ssDNA-FQ reporter | 6-FMA-TTATT-BHQ1 |
| crRNA | UAAUUUCUACUAAGUGUAGAUAUCUGGCUGCAUUGCUGCGU |
| qPCR-F | GTTCATCAAGGCACAAGCGA |
| qPCR-R | ACAGACGATGAGCGGTTGAT |
| qPCR-P | FAM-CGTTGTTTGATACTCACGCCTTGTTCG-BHQ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lv, X.; Cao, W.; Zhang, H.; Zhang, Y.; Shi, L.; Ye, L. CE–RAA–CRISPR Assay: A Rapid and Sensitive Method for Detecting Vibrio parahaemolyticus in Seafood. Foods 2022, 11, 1681. https://doi.org/10.3390/foods11121681
Lv X, Cao W, Zhang H, Zhang Y, Shi L, Ye L. CE–RAA–CRISPR Assay: A Rapid and Sensitive Method for Detecting Vibrio parahaemolyticus in Seafood. Foods. 2022; 11(12):1681. https://doi.org/10.3390/foods11121681
Chicago/Turabian StyleLv, Xinrui, Weiwei Cao, Huang Zhang, Yilin Zhang, Lei Shi, and Lei Ye. 2022. "CE–RAA–CRISPR Assay: A Rapid and Sensitive Method for Detecting Vibrio parahaemolyticus in Seafood" Foods 11, no. 12: 1681. https://doi.org/10.3390/foods11121681
APA StyleLv, X., Cao, W., Zhang, H., Zhang, Y., Shi, L., & Ye, L. (2022). CE–RAA–CRISPR Assay: A Rapid and Sensitive Method for Detecting Vibrio parahaemolyticus in Seafood. Foods, 11(12), 1681. https://doi.org/10.3390/foods11121681
