Chemical Composition and Nutritional Value of Different Species of Vespa Hornets
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Preparation
2.2. Identification of the Species
2.3. Nutritional Composition Analyses
2.3.1. Amino Acid Analysis
2.3.2. Fatty Acid Composition Analysis
2.3.3. Mineral Analysis
2.3.4. Statistical Analysis
3. Results
3.1. Identification of the Species
3.2. Nutritional Composition of Vespa
3.2.1. Amino Acids
3.2.2. Fatty Acids
3.2.3. Mineral Content
4. Discussion
4.1. Amino Acid Composition
4.2. Fatty Acid Composition
4.3. Mineral Content
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| ID | Accession No. | Sequence |
|---|---|---|
| VEUN20 | MN477949 | TATATTATATTTTATTTTTGCCTTATGATCAGGAACTATCGGAGCATCCATAAGATTAATTATTCGAATAGAGCTTAGATCTCCTGGCAATCTAATTAATAATGACCAAATTTACAATTCTATTATTACTGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCCTTTATAATTGGAGGGTTTGGAAATTGATTAATTCCATTAATACTAGGTATTCCAGATATGGCATTTCCTCGAATAAATAATATAAGATTTTGACTTCTACCTCCTTCATTATTCCTTCTAATTATAAGAAACTTTATTGGAGGGGGTGTTGGTACAGGATGAACCCTTTATCCCCCCCTATCATCCATTATTGGCCATAATTCTCCTTCAGTAGATCTAAGAATTTTCTCTCTCCATATTGCAGGAATTTCTTCAATTATAGGAGCAATTAATTTTATTGTAACAATTCTAAATATACATGTCAAAACCCATTCATTAAATTTTTTACCATTATTCTCTTGGTCTGTCCTAATTACAGCATTCTTATTACTTTTATCTTTACCTGTTTTAGCTGGCGCAATCACCATACTTTTAACAGATCGAAATTTTAATACATCCTTTTTCGATCCAACTGGAGGCGGAGACCCCATCTTATACCAACATTTATTC |
| VEUN21 | MN477950 | AATACTTTATTTTATTTTTGCTTTATGATCAGGATCTTTAGGAGCCTCTATAAGTTTAATTATTCGTATAGAACTTAGATCCCCAGGAAGATTAATTAACAACGATCAAATCTATAATTCTATTATTACCGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAATTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTCTGACTATTACCTCCCTCTTTATTTCTATTAATTATAAGAAATTTTATTGGAGGAGGAGTAGGAACTGGATGAACTCTTTACCCACCTCTATCATCAATTACTGGTCATAATTCTCCAGCTGTTGATCTTAGAATCTTTTCATTACATATTGCAGGAATTTCATCAATTATAGGAGCCATTAATTTCATTGTTACAATTTTAAACATACACATTAAAACTCACTCACTAAGATTCTTACCTTTATTTTCATGATCAGTTTTAATTACAGCATTTTTACTATTATTATCCTTACCTGTTCTAGCAGGAGCAATTACAATACTTCTTACCGATCGAAACTTTAATACATCATTTTTTGATCCCACAGGAGGAGGAGACCCTATTTTATATCAACATTTATTT |
| VEUN22 | MN477951 | AATATTATACTTTATTTTTGCATTATGATCTGGAACATTGGGAGCATCAATAAGATTAATTATTCGTATAGAATTAAGATCTCCCGGAAATTTAATTAATAATGATCAAATTTATAATTCAATTATCACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATCGGAGGATTCGGTAACTGAATAATTCCTCTAATACTCGGAATTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTCTGACTACTCCCTCCATCATTATTTATATTAATTATAAGAAACTTTATTGGTGGAGGTGTAGGAACAGGATGAACTTTATATCCTCCTTTATCATCAATTACTGGTCATAACTCACCATCAGTTGATTTAAGAATTTTCTCTTTACATATTGCAGGAATTTCATCAATTATAGGTGCAATTAATTTTATTGTAACAATTCTGAATATACATGTAAAAACACACTCATTAAATTTTTTACCATTATTCTCATGATCAGTCTTAATTACTGCTTTTTTACTTTTATTATCACTCCCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTTAATACATCATTCTTCGATCCAACCGGAGGAGGAGACCCAATTCTATATCAACACTTATTT |
References
- Ying, F.; Xiaoming, C.; Long, S.; Zhiyong, C. Common edible wasps in Yunnan Province, China and their nutritional value. In Forest Insects as Food: Human Bites Back; Durst, P.B., Johnson, D.V., Leslie, R.N., Shono, K., Eds.; Food and Agriculture Organi-zation of the United Nations; Regional Office for Asia and the Pacific: Bangkok, Thailand, 2010; pp. 93–98. [Google Scholar]
- Kim, H.S.; Jung, C. Nutritional characteristics of edible insects as potential food materials. Korean J. Apic. 2013, 28, 1–8. [Google Scholar]
- Barennes, H.; Phimmasane, M.; Rajaonarivo, C. Insect Consumption to Address Undernutrition, a National Survey on the Prevalence of Insect Consumption among Adults and Vendors in Laos. PLoS ONE 2015, 10, e0136458. [Google Scholar] [CrossRef] [Scilit]
- Hanboonsong, Y.; Durst, P.B. Edible Insects in Lao PDR: Building on Tradition to Enhance Food Security; Food and Agriculture Organization of the United Nations—Regional Office for Asia and the Pacific: Bangkok, Thailand, 2014. [Google Scholar]
- Carpenter, J.M.; Kojima, J. Checklist of the species in the subfamily Vespinae (Insects: Hymenoptera: Vespinae). Nat. Hist. Bull. Ibaraki Univ. 1997, 1, 51–92. [Google Scholar]
- Leksawasdi, P. Compendium of research on selected edible insects in northern Thailand. In Forest Insects as Food: Human Bites Back; Durst, P.B., Johnson, D.V., Leslie, R.N., Shono, K., Eds.; Food and Agriculture Organization of the United Nations—Regional Office for Asia and the Pacific: Bangkok, Thailand, 2010; pp. 183–188. [Google Scholar]
- Nonaka, K. Feasting on insects. Èntomol. Res. 2009, 39, 304–312. [Google Scholar] [CrossRef] [Scilit]
- Payne, C.L.R.; Evans, J.D. Nested Houses: Domestication dynamics of human-wasp relations in contemporary rural Japan. J. Ethnobiol. Ethnomedicine 2017, 13, 13. [Google Scholar] [CrossRef] [Scilit]
- Pemberton, R.W. Insects and other arthropods used as drugs in Korean traditional medicine. J. Ethnopharmacol. 1999, 65, 207–216. [Google Scholar] [CrossRef] [Scilit]
- Meyer-Rochow, V.B. Therapeutic arthropods and other largely terrestrial folk-medicinally important invertebrates: A comparative survey and review. J. Ethnobiol. Ethnomedicine 2017, 13, 9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, C.; Kim, D.W.; Lee, H.S.; Baek, H. Some Biological Characteristics of a New Honeybee Pest, Vespa velutina nigrithorax Buysson, 1905 (Hymenoptera: Vespidae). Korean J. Apic. 2009, 24, 61–65. [Google Scholar]
- Jung, C. Initial state risk assessment of an invasive hornet, Vespa velutina nigrithorax Buysson (Hymenoptera: Vespidae) in Korea. Korean J. Apic. 2012, 27, 95–104. [Google Scholar]
- Monceau, K.; Bonnard, O.; Thiéry, D. Vespa velutina: A new invasive predator of honeybees in Europe. J. Pest Sci. 2014, 87, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Shah, F.A.; Shah, T.A. Vespa Velutina, a Serious Pest of Honey Bees in Kashmir. Bee World 1991, 72, 161–164. [Google Scholar] [CrossRef] [Scilit]
- Abrol, D.P. Ecology, behaviour and management of social wasp, Vespa velutina Smith (Hymenoptera: Vespidae), attacking honeybee colonies. Korean J. Apic. 1994, 9, 5–10. [Google Scholar]
- Tan, K.; Radloff, S.E.; Li, J.J.; Hepburn, H.R.; Yang, M.X.; Zhang, L.J.; Neumann, P. Bee-hawking by the wasp, Vespa velutina, on the honeybees Apis cerana and A. mellifera. Naturwissenschaften 2007, 94, 469–472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ono, M.; Okada, I.; Sasaki, M. Heat production by balling in the Japanese honeybee, Apis cerana japonica as a defensive behavior against the hornet Vespa simillima xanthoptera (Hymenoptera: Vespidae). Cell. Mol. Life Sci. 1987, 43, 1031–1034. [Google Scholar] [CrossRef] [Scilit]
- Jung, C. Spatial expansion of an invasive hornet, Vespa velutina nigrithorax Buysson (Hymenoptera: Vespidae) in Korea. Korean J. Apic. 2012, 27, 87–93. [Google Scholar]
- Park, J.-J.; Jung, C. Risk Prediction of the Distribution of Invasive Hornet, Vespa velutina nigrothorax in Korea using CLIMEX Model. J. Apic. 2016, 31, 293–303. [Google Scholar] [CrossRef] [Scilit]
- Jung, C.; Kang, M.S.; Kim, D.W.; Lee, H.S. Vespid Wasps (Hymenoptera) Occurring Around Apiaries in Andong, Korea-I. Taxonomy and life history. Korean J. Apic. 2007, 22, 53–62. [Google Scholar]
- Choi, M.B.; Kim, J.K.; Lee, J.W. Checklist and Distribution of Korean Vespidae Revisited. Korean J. Appl. Èntomol. 2013, 52, 85–91. [Google Scholar] [CrossRef] [Scilit]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
- Hebert, P.D.; Ratnasingham, S.; de Waard, J.R. Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. B Biol. Sci. 2003, 270, S96–S99. [Google Scholar] [CrossRef] [Scilit]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. 1999, 41, 95–98. [Google Scholar]
- AOAC. Official Methods of Analysis of the AOAC, 15th ed.; Association of official analytical chemists: Washington, DC, USA, 1990. [Google Scholar]
- FAO/WHO/UNU. Protein and Amino Acid Requirements in Human Nutrition, Report of a FAO/WHO/UNU Expert Consultation; WHO Technical Report Series no. 935; World Health Organisation: Geneva, Switzerland, 2007. [Google Scholar]
- Millward, D.J. Amino acid scoring patterns for protein quality assessment. Br. J. Nutr. 2012, 108, S31–S43. [Google Scholar] [CrossRef] [Scilit]
- Ministry of Food and Drug Safety. Korean Food Standard Codex; Ministry of Food and Drug Safety: Cheongju, Korea, 2010. [Google Scholar]
- Pickering, M.V.; Newton, P. Amino acid hydrolysis: Old problems, new solutions. Lc Gc 1990, 8, 778–781. [Google Scholar]
- Jeong, H.; Kim, J.M.; Kim, B.; Nam, J.-O.; Hahn, D.; Choi, M.B. Nutritional Value of the Larvae of the Alien Invasive Wasp Vespa velutina nigrithorax and Amino Acid Composition of the Larval Saliva. Foods 2020, 9, 885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Curtis, C.R.; Watkins, J.C. The pharmacology of amino acids related to gamma-aminobutyric acid. Pharmacol. Rev. 1965, 17, 347–391. [Google Scholar]
- Abe, T.; Tanaka, Y.; Miyazaki, H.; Kawasaki, Y.Y. Comparative study of the composition of hornet larval saliva, its effect on bahviour and role of trophallaxis. Comp. Biochem. Physiol. Part C Comp. Pharmacol. 1991, 99C, 79–84. [Google Scholar]
- Beenakkers, A.M.T.; Horst, D.J.V.; Marrewijk, J.A.V. Biochemical process directed to flight muscle metabolism. In Comprehensive Insect Physiology, Biochemistry and Pharmacology; Kerkut, G.A., Gilbert, L.I., Eds.; Pergamon Press: Oxford, UK, 1985; Volume 10, pp. 451–486. [Google Scholar]
- Matsuura, M.; Sakagami, S.F. A bionomic sketch of the giant hornet, Vespa mandarinia, a serious pest for Japanese apiculture. J. Fac. Sci. Hokkaido Univ. Ser. VI Zoo. 1973, 19, 125–162. [Google Scholar]
- Sánchez, X.F.; Charles, R.J. Notes on the nest-architecture and colony composition in winter of the Yellow-legged Asian hornet, Vespa velutina Lepeletier 1836 (Hym.: Vespidae), in its introduced habitat in Galicia (NW Spain). Insects 2019, 10, 237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghosh, S.; Jung, C.; Meyer-Rochow, V.B. Nutritional value and chemical composition of larvae, pupae, and adults of worker honey bee, Apis mellifera ligustica as a sustainable food source. J. Asia Pac. Èntomol. 2016, 19, 487–495. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, S.; Jung, C.; Choi, K.; Choi, H.Y.; Kim, H.W.; Kim, S. Body fat and amino acid composition of a native bumblebee, Bombus ignitus relative to B. terrestris of foreign origin in Korea. J. Apic. 2017, 32, 111–117. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, S.; Choi, K.; Kim, S.; Jung, C. Body Compositional Changes of Fatty Acid and Amino Acid from the Queen of Bumblebee, Bombus terrestris during Overwintering. J. Apic. 2017, 32, 11–18. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, S.; Sohn, H.-Y.; Pyo, S.-J.; Jensen, A.B.; Meyer-Rochow, V.B.; Jung, C. Nutritional Composition of Apis mellifera Drones from Korea and Denmark as a Potential Sustainable Alternative Food Source: Comparison Between Developmental Stages. Foods 2020, 9, 389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tomé, D.; Bos, C. Lysine Requirement through the Human Life Cycle. J. Nutr. 2007, 137, 1642S–1645S. [Google Scholar] [CrossRef] [Scilit]
- Chakravorty, J.; Ghosh, S.; Jung, C.; Meyer-Rochow, V. Nutritional composition of Chondacris rosea and Brachytrupes orientalis: Two common insects used as food by tribes of Arunachal Pradesh, India. J. Asia Pac. Èntomol. 2014, 17, 407–415. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, S.; Lee, S.-M.; Jung, C.; Meyer-Rochow, V. Nutritional composition of five commercial edible insects in South Korea. J. Asia Pac. Èntomol. 2017, 20, 686–694. [Google Scholar] [CrossRef] [Scilit]
- Ayieko, M.A.; Kinyuru, J.N.; Ndonģa, M.F.; Kenji, G.M. Nutritional value and consumption of black ants (Carebara vidua Smith) from the Lake Victoria region in Kenya. Adv. J. Food Sci. Technol. 2012, 4, 39–45. [Google Scholar]
- Sihamala, O.; Bhulaidok, S.; Shen, L.R.; Li, D. Lipids and fatty acid composition of dried edible red and black ants. Agric. Sci. China 2010, 9, 1072–1077. [Google Scholar]
- Bhulaidok, S.; Sihamala, O.; Shen, L.; Li, D. Nutritional and fatty acid profiles of sun dried edible black ants (Polyrhachis vicina Roger). Majeo Int. J. Sci. Technol. 2010, 4, 101–112. [Google Scholar]
- Chakravorty, J.; Ghosh, S.; Megu, K.; Jung, C.; Meyer-Rochow, V. Nutritional and anti-nutritional composition of Oecophylla smaragdina (Hymenoptera: Formicidae) and Odontotermes sp. (Isoptera: Termitidae): Two preferred edible insects of Arunachal Pradesh, India. J. Asia Pac. Èntomol. 2016, 19, 711–720. [Google Scholar] [CrossRef] [Scilit]
- Lehtovaara, V.; Valtonen, A.; Sorjonen, J.; Hiltunen, M.; Rutaro, K.; Malinga, G.; Nyeko, P.; Roininen, H. The fatty acid contents of the edible grasshopper Ruspolia differens can be manipulated using artificial diets. J. Insects Food Feed. 2017, 3, 253–262. [Google Scholar] [CrossRef] [Scilit]
- Rutaro, K.; Malinga, G.M.; Lehtovaara, V.J.; Opoke, R.; Nyeko, P.; Roininen, H.; Valtonen, A. Fatty acid content and composition in edible Ruspolia differens feeding on mixtures of natural food plants. BMC Res. Notes 2018, 11, 687. [Google Scholar] [CrossRef] [Scilit]
- Mensink, R.P. Effects of the individual saturated fatty acids on serum lipids and lipoprotein concentrations. Am. J. Clin. Nutr. 1993, 57, 711S–714S. [Google Scholar] [CrossRef] [Scilit]
- Aluko, R.E. Functional Foods and Nutraceuticals; Springer: New York, NY, USA, 2012. [Google Scholar]
- Grundy, S.M. Comparison of Monounsaturated Fatty Acids and Carbohydrates for Lowering Plasma Cholesterol. N. Engl. J. Med. 1986, 314, 745–748. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abeywardena, M.Y.; Patten, G.S. Role of ω3 long-chain polyunsaturated fatty acids in reducing cardio-metabolic risk factors. Endocr. Metab. Immune Disord. Drug Targets 2011, 11, 232–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bagge, C.N.; Strandhave, C.; Skov, C.M.; Svensson, M.; Schmidt, E.B.; Christensen, J.H. Marine n-3 polyunsaturated fatty acids affect the blood pressure control in patients with newly diagnosed hypertension—A 1-year follow-up study. Nutr. Res. 2017, 38, 71–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cabo, J.; Alonso, R.; Mata, P. Omega-3 fatty acids and blood pressure. Br. J. Nutr. 2012, 107, S195–S200. [Google Scholar] [CrossRef] [Scilit]
- Rumpold, B.A.; Schlüter, O.K. Nutritional composition and safety aspects of edible insects. Mol. Nutr. Food Res. 2013, 57, 802–823. [Google Scholar] [CrossRef] [Scilit]
- He, F.J.; MacGregor, G.A. Beneficial effects of potassium on human health. Physiol. Plant. 2008, 133, 725–735. [Google Scholar] [CrossRef] [Scilit]
- Doyle, M.E.; Glass, K.A. Sodium Reduction and Its Effect on Food Safety, Food Quality, and Human Health. Compr. Rev. Food Sci. Food Saf. 2010, 9, 44–56. [Google Scholar] [CrossRef] [Scilit]
- Iwahori, T.; Miura, K.; Ueshima, H. Time to Consider Use of the Sodium-to-Potassium Ratio for Practical Sodium Reduction and Potassium Increase. Nutrients 2017, 9, 700. [Google Scholar] [CrossRef] [Scilit]
- Institute of Medicine (US) Standing Committee on the Scientific Evaluation of Dietary Reference Intakes. Dietary Reference Intakes for Calcium, Phosphorus, Magnesium, Vitamin D, and Fluoride; National Academies Press: Washington, DC, USA, 1997. [Google Scholar]
- Gennari, C.; Lezama, I.; Lockwood, K.; Bergmann, T. Calcium and vitamin D nutrition and bone disease of the elderly. Public Health Nutr. 2001, 4, 547–559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Power, M.L.; Heaney, R.P.; Kalkwarf, H.J.; Pitkin, R.M.; Repke, J.T.; Tsang, R.C.; Schulkin, J. The role of calcium in health and disease. Am. J. Obstet. Gynecol. 1999, 181, 1560–1569. [Google Scholar] [CrossRef] [Scilit]
- Ramakrishnan, U.; Imhoff-Kunsch, B. Anemia and Iron Deficiency in Developing Countries. In Handbook of Nutrition and Pregnancy; Springer International Publishing: New York, NY, USA, 2008; pp. 337–354. [Google Scholar]
- Lutter, C.K. Iron Deficiency in Young Children in Low-Income Countries and New Approaches for Its Prevention. J. Nutr. 2008, 138, 2523–2528. [Google Scholar] [CrossRef] [Scilit]
- The Problem: About Iron Deficiency. Available online: http://www.unicef.org/nutrition/23964_iron.html (accessed on 27 August 2019).
- Gupta, A.; Gadipudi, A. Iron deficiency anaemia in pregnancy: Developed versus developing countries. EMJ Hematol. 2018, 6, 101–109. [Google Scholar]
- Aggett, P.J.; Comerford, J.G. Zinc and human health. Nutr. Rev. 1995, 53, S16–S22. [Google Scholar] [PubMed]
- Caulfield, L.E.; Black, R.E. Zinc deficiency, In Comparative Quantification of Health Risks: Global and Regional Burden of Disease Attributable to Selected Major Risk Factors; Ezzati, M., Lopez, A.D., Rodgers, A., Murray, C.J.L., Eds.; World Health Organization: Geneva, Switzerland, 2004; Volume 1, pp. 257–279. [Google Scholar]
- Maxfield, L.; Crane, J.S. Zinc Deficiency. Available online: https://www.ncbi.nlm.nih.gov/books/NBK493231/ (accessed on 28 August 2019).
- Wessells, K.R.; Brown, K.H. Estimating the Global Prevalence of Zinc Deficiency: Results Based on Zinc Availability in National Food Supplies and the Prevalence of Stunting. PLoS ONE 2012, 7, e50568. [Google Scholar] [CrossRef] [Scilit]
- Meyer-Rochow, V.B. Can insects help to ease the problem of world food shortage? Search 1975, 6, 261–262. [Google Scholar]
- Han, R.; Shin, J.T.; Kim, J.; Choi, Y.S.; Kim, Y.W. An overview of the South Korean edible insect food industry: Challenges and future pricing/promotion strategies. Èntomol. Res. 2017, 47, 141–151. [Google Scholar] [CrossRef] [Scilit]
- Kim, T.-K.; Yong, H.I.; Kim, Y.-B.; Kim, H.-W.; Choi, Y.-S. Edible Insects as a Protein Source: A Review of Public Perception, Processing Technology, and Research Trends. Food Sci. Anim. Resour. 2019, 39, 521–540. [Google Scholar] [CrossRef] [Scilit]
- Meyer-Rochow, V.B.; Ghosh, S.; Jung, C. Farming of insects for food and feed in South Korea: Tradition and innovation. Berl. Münchener Tierärztliche Wochenschr. 2019, 131, 236–244. [Google Scholar] [CrossRef] [Scilit]

| China | Korea | Indispensable Amino Acid Requirements 1 | Amino Acid Scoring Pattern 1 | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Vespa velutina | Vespa mandarinia | Vespa basalis | Vespa velutina | mg/kg Per Day | mg/g Protein | Amino Acid Score | ||||
| Vespa velutina | Vespa mandarinia | Vespa basalis | Vespa velutina | |||||||
| Leucine * | 3.3 ± 0.18 b | 3.2 ± 0.33 b | 2.4 ± 0.16 c | 4.3 ± 0.32 a | 39 | 59 | 145.8 | 149.3 | 145.0 | 143.7 |
| Valine * | 2.3 ± 0.15 b | 2.3 ± 0.24 b | 1.6 ± 0.11 c | 3.2 ± 0.25 a | 26 | 39 | 152.2 | 158.3 | 149.9 | 161.5 |
| Isoleucine * | 2.1 ± 0.17 ab | 2.1 ± 0.19 b | 1.5 ± 0.07 c | 2.7 ± 0.28 a | 20 | 30 | 188.2 | 185.8 | 177.1 | 174.9 |
| Methionine * | 0.6 ± 0.04 a | 0.3 ± 0.33 a | 0.3 ± 0.07 a | ND | 10 | 16 | 92.3 | 57.8 | 73.5 | ND |
| Cysteine | 0.3 ± 0.28 a | 0.7 ± 0.68 a | 0.1 ± 0.01 a | 2.0 ± 1.13 a | 4 | 6 | 123.1 | 312.7 | 77.2 | 643.6 |
| Lysine * | 2.3 ± 0.03 ab | 2.3 ± 0.22 ab | 1.9 ± 0.23 b | 2.7 ± 0.07 a | 30 | 45 | 134.2 | 137.2 | 148.9 | 116.6 |
| Threonine * | 1.6 ± 0.05 b | 1.6 ± 0.12 b | 1.2 ± 0.13 b | 2.3 ± 0.14 a | 15 | 23 | 188.1 | 183.2 | 182.9 | 193.7 |
| Histidine * | 1.2 ± 0.09 b | 1.2 ± 0.21 b | 0.9 ± 0.06 b | 1.7 ± 0.14 a | 10 | 15 | 212.8 | 208.5 | 211.5 | 217.8 |
| Phenylalanine * | 1.6 ± 0.01 ab | 1.6 ± 0.39 ab | 1.2 ± 0.16 b | 2.1 ± 0.07 a | 25 | 38 | 286.7 | 311.2 | 296.5 | 283.0 |
| Tyrosine ** | 2.5 ± 0.10 ab | 2.7 ± 0.38 ab | 2.0 ± 0.13 b | 3.3 ± 0.46 a | ||||||
| Arginine *** | 1.7 ± 0.05 ab | 0.8 ± 0.86 b | 1.2 ± 0.13 ab | 2.2 ± 0.18 a | ||||||
| Aspartic acid | 2.4 ± 0.06 b | 2.4 ± 0.45 b | 1.8 ± 0.28 b | 3.7 ± 0.04 a | ||||||
| Glutamic acid | 7.6 ± 0.19 a | 7.8 ± 1.6 a | 6.2 ± 1.04 a | 9.0 ± 0.96 a | ||||||
| Serine | 1.7 ± 0.12 b | 1.6 ± 0.09 bc | 1.2 ± 0.13 c | 2.4 ± 0.28 a | ||||||
| Proline | 2.3 ± 0.23 a | 2.1 ± 0.17 a | 1.6 ± 0.05 b | 2.4 ± 0.11 a | ||||||
| Glycine | 2.4 ± 0.60 ab | 2.3 ± 0.34 ab | 1.6 ± 0.13 b | 3.4 ± 1.03 a | ||||||
| Alanine | 2.1 ± 0.69 a | 2.0 ± 0.51 a | 1.4 ± 0.16 a | 3.4 ± 1.27 a | ||||||
| Total | 37.9 ± 1.65 b | 36.8 ± 2.37 b | 28.1 ± 2.22 c | 50.5 ± 4.74 a | ||||||
| China | Korea | |||
|---|---|---|---|---|
| Vespa velutina | Vespa mandarinia | Vespa basalis | Vespa velutina | |
| Saturated Fatty Acids | ||||
| Capric acid | ND | ND | ND | <0.01 |
| Lauric acid | 0.2 ± 0.04 | 0.2 ± 0.04 | 0.1 ± 0.02 | 0.3 ± 0.02 |
| Tridecanoic acid | ND | ND | ND | 0.01 ± 0.00 |
| Myristic acid | 0.7 ± 0.14 a | 0.5 ± 0.17 ab | 0.3 ± 0.06 b | 0.8 ± 0.11 a |
| Palmitic acid | 3.7 ± 0.49 a | 4.3 ± 0.24 a | 3.5 ± 0.01 a | 3.5 ± 0.28 a |
| Heptadecanoic acid | 0.02 ± 0.00 | 0.02 ± 0.00 | 0.04 ± 0.00 | 0.02 ± 0.00 |
| Stearic acid | 0.9 ± 0.06 | 1.0 ± 0.17 | 1.2 ± 0.01 | 0.7 ± 0.00 |
| Arachidic acid | 0.1 ± 0.01 | 0.2 ± 0.03 | 0.2 ± 0.02 | 0.1 ± 0.00 |
| Behenic acid | ND | 0.1 ± 0.02 | 0.1 ± 0.01 | 0.1 ± 0.00 |
| Lignoceric acid | ND | 0.01 ± 0.01 | 0.03 ± 0.00 | 0.1 ± 0.01 |
| Subtotal | 5.6 ± 0.71 a | 6.2 ± 0.21 a | 5.4 ± 0.05 a | 5.4 ± 0.42 a |
| Monounsaturated Fatty Acids | ||||
| Myristoleic acid | 0.02 ± 0.01 | ND | ND | 0.03 ± 0.01 |
| Palmitoleic acid | 0.4 ± 0.10 | 0.2 ± 0.05 | 0.1 ± 0.00 | 0.4 ± 0.06 |
| cis-10-Heptadecenoic acid | 0.01 ± 0.02 | ND | ND | 0.01 ± 0.00 |
| Oleic acid | 4.1 ± 0.44 b | 5.6 ± 0.55 a | 5.3 ± 0.29 a | 4.1 ± 0.28 b |
| cis-11-Eocosenic acid | ND | 0.1 ± 0.06 | 0.14 ± 0.027 | 0.5 ± 0.01 |
| Subtotal | 4.6 ± 0.56 a | 5.9 ± 0.56 a | 5.6 ± 0.31 a | 5.1 ± 0.37 a |
| Polyunsaturated Fatty Acids | ||||
| Linoleic acid | 0.6 ± 0.11 b | 6.8 ± 3.09 a | 9.5 ± 1.96 a | 0.6 ± 0.02 b |
| Linolenic acid | 0.8 ± 0.11 | 1.2 ± 0.30 | 1.8 ± 0.01 | ND |
| Arachidonic acid | 0.04 ± 0.03 | ND | ND | 0.02 ± 0.00 |
| cis-5,8,11,14,17-Eicosapentaenoic acid | 0.03 ± 0.02 | ND | ND | ND |
| Subtotal | 1.4 ± 0.05 b | 8.1 ± 3.39 a | 11.2 ± 1.98 a | 0.6 ± 0.04 b |
| Total | 11.5 ± 1.31 b | 20.1 ± 3.75 a | 22.2 ± 2.25 a | 11.1 ± 0.82 b |
| China | Korea | RDA 1 | PRI/AI 2 | Satisfying the Requirement as per PRI/AI2 by 100 g of Consumption of Respective Vespa Brood (in %) 3 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Vespa velutina | Vespa mandarinia | Vespa basalis | Vespa velutina | |||||||||||||
| Vespa velutina | Vespa mandarinia | Vespa basalis | Vespa velutina | M | F | M | F | M | F | M | F | M | F | M | F | |
| Ca | 38.8 ± 0.04 b | 27.4 ± 0.20 c | 31.8 ± 0.34 bc | 46.3 ± 5.22 a | 1000 | 950 | 4.1 | 2.9 | 3.3 | 4.9 | ||||||
| Mg | 63.9 ± 0.01 a | 33.0 ± 0.44 c | 38.2 ± 0.24 b | 66.3 ± 2.16 a | 400 | 310 | 350 † | 300 † | 18.3 | 21.3 | 9.4 | 11.0 | 10.9 | 12.7 | 18.9 | 22.1 |
| Na | 10.4 ± 0.02 c | 30.8 ± 0.40 b | 8.9 ± 0.09 c | 61.5 ± 5.44 a | 1500 * | 3800 * | -- | -- | 0.7 | 0.3 | 2.1 | 0.8 | 0.6 | 0.2 | 4.1 | 1.6 |
| K | 751.6 ± 0.87 a | 422.7 ± 6.58 b | 404.4 ± 0.01 b | 718.6 ± 69.87 a | 3400 * | 2600 * | 3500 † | 21.5 | 12.1 | 11.6 | 20.5 | |||||
| P | 561.2 ± 1.18 a | 322.5 ± 2.93 b | 318.4 ± 4.90 b | 641.9 ± 71.37 a | 700 | 550 † | 102.0 | 58.6 | 57.9 | 116.7 | ||||||
| Fe | 10.0 ± 0.12 a | 7.2 ± 0.41 b | 5.0 ± 0.18 c | 9.1 ± 0.89 a | 8 | 18 | 11 | 16 | 90.9 | 62.5 | 65.5 | 45.0 | 45.5 | 31.3 | 82.7 | 56.9 |
| Zn | 7.2 ± 0.02 a | 4.7 ± 0.01 c | 5.1 ± 0.04 c | 6.1 ± 0.71 b | 11 | 8 | 9.4 | 7.5 | 76.6 | 96.0 | 50.0 | 62.7 | 54.3 | 68.0 | 64.9 | 81.3 |
| Mn | 0.6 ± 0.02 ab | 0.1 ± 0.01 b | 1.2 ± 0.68 ab | 2.8 ± 1.49 a | 2.3 * | 1.8 * | 3 † | 20.0 | 3.3 | 40.0 | 93.3 | |||||
| Cu | 2.2 ± 0.04 a | 0.9 ± 0.01 d | 1.1 ± 0.04 c | 1.3 ± 0.04 b | 900 | 1.6 † | 1.3 † | 137.5 | 169.2 | 56.3 | 69.2 | 68.8 | 84.6 | 81.3 | 100.0 | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ghosh, S.; Namin, S.M.; Meyer-Rochow, V.B.; Jung, C. Chemical Composition and Nutritional Value of Different Species of Vespa Hornets. Foods 2021, 10, 418. https://doi.org/10.3390/foods10020418
Ghosh S, Namin SM, Meyer-Rochow VB, Jung C. Chemical Composition and Nutritional Value of Different Species of Vespa Hornets. Foods. 2021; 10(2):418. https://doi.org/10.3390/foods10020418
Chicago/Turabian StyleGhosh, Sampat, Saeed Mahamadzade Namin, Victor Benno Meyer-Rochow, and Chuleui Jung. 2021. "Chemical Composition and Nutritional Value of Different Species of Vespa Hornets" Foods 10, no. 2: 418. https://doi.org/10.3390/foods10020418
APA StyleGhosh, S., Namin, S. M., Meyer-Rochow, V. B., & Jung, C. (2021). Chemical Composition and Nutritional Value of Different Species of Vespa Hornets. Foods, 10(2), 418. https://doi.org/10.3390/foods10020418

