Development of a DNA Metabarcoding Method for the Identification of Bivalve Species in Seafood Products
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Storage
2.2. DNA Extraction and Quantification
2.3. DNA Extract Mixtures
2.4. Reference Sequences
2.5. Primer Systems
2.6. Library Preparation and NGS
2.7. NGS Data Analysis Using Galaxy
3. Results and Discussion
3.1. Barcode Region and Primer Systems
3.2. Library Preparation, Pooling of Libraries, and Sequencing
3.3. Analysis of DNA Extracts from Reference Samples
3.4. Analysis of DNA Extract Mixtures
3.5. Analysis of Commercial Seafood Samples
4. Conclusions
5. Patent
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Telahigue, K.; Chetoui, I.; Rabeh, I.; Romdhane, M.S.; El Cafsi, M. Comparative fatty acid profiles in edible parts of wild scallops from the Tunisian coast. Food Chem. 2010, 122, 744–746. [Google Scholar] [CrossRef] [Scilit]
- Tan, K.; Ma, H.; Li, S.; Zheng, H. Bivalves as future source of sustainable natural omega-3 polyunsaturated fatty acids. Food Chem. 2020, 311, 125907. [Google Scholar] [CrossRef] [Scilit]
- Manthey-Karl, M.; Lehmann, I.; Ostermeyer, U.; Rehbein, H.; Schröder, U. Meat Composition and Quality Assessment of King Scallops (Pecten maximus) and Frozen Atlantic Sea Scallops (Placopecten magellanicus) on a Retail Level. Foods 2015, 4, 524–546. [Google Scholar] [CrossRef] [Scilit]
- Grienke, U.; Silke, J.; Tasdemir, D. Bioactive compounds from marine mussels and their effects on human health. Food Chem. 2014, 142, 48–60. [Google Scholar] [CrossRef] [Scilit]
- Willer, D.F.; Aldridge, D.C. Sustainable bivalve farming can deliver food security in the tropics. Nat. Food 2020, 1, 384–388. [Google Scholar] [CrossRef] [Scilit]
- World Register of Marine Species. Available online: http://www.marinespecies.org/index.php (accessed on 12 December 2020).
- Food and Agricultural Organization of the United Nations (FAO). Fishery and Aquaculture Statistics. In Global Aquaculture Production. Software for Fishery Statistical Time Series. Version FishStatJ v4.01.4. Available online: www.fao.org/fishery/statistics/software/fishstatj/en (accessed on 10 June 2021).
- European Parliament and of the Council. Regulation (EU) No. 1379/2013 of the European Parliament and of the Council of on the common organisation of the markets in fishery and aquaculture products, amending Council Regulations (EC) No 1184/2006 and (EC) No 1224/2009 and repealing Council Regulation (EC) No 104/2000. Off. J. Eur. Union 2013, L 354, 1–21. [Google Scholar]
- European Parliament and of the Council. Regulation (EU) No 1169/2011 of the European Parliament and of the Council of 25 October 2011 on the provision of food information to consumers, amending Regulations (EC) No 1924/2006 and (EC) No 1925/2006 of the European Parliament and of the Council, and repealing Commission Directive 87/250/EEC, Council Directive 90/496/EEC, Commission Directive 1999/10/EC, Directive 2000/13/EC of the European Parliament and of the Council, Commission Directives 2002/67/EC and 2008/5/EC and Commission Regulation (EC) No 608/2004. Off. J. Eur. Union 2011, L 30, 18–63. [Google Scholar]
- Oceana; Protectin the World´s Oceans. Available online: https://oceana.org/publications/reports/one-name-one-fish-why-seafood-names-matter (accessed on 30 April 2021).
- Rodríguez, E.M.; Ortea, I. Food authentication of seafood species. In Proteomics in Food Science: From Farm to Fork, 3rd ed.; Colgrave, M.L., Ed.; Academic Press: London, UK, 2017; pp. 331–342. ISBN 9780128040072. [Google Scholar]
- Parrondo, M.; López, S.; Aparicio-Valencia, A.; Fueyo, A.; Quintanilla-García, P.; Arias, A.; Borrell, Y.J. Almost never you get what you pay for: Widespread mislabeling of commercial “zamburiñas” in northern Spain. Food Control 2021, 120, 107541. [Google Scholar] [CrossRef] [Scilit]
- Giusti, A.; Tosi, F.; Tinacci, L.; Guardone, L.; Corti, I.; Arcangeli, G.; Armani, A. Mussels (Mytilus spp.) products authentication: A case study on the Italian market confirms issues in species identification and arises concern on commercial names attribution. Food Control 2020, 118, 107379. [Google Scholar] [CrossRef] [Scilit]
- Harris, D.J.; Rosado, D.; Xavier, R. DNA Barcoding Reveals Extensive Mislabeling in Seafood Sold in Portuguese Supermarkets. J. Aquat. Food Prod. Technol. 2016, 25, 1375–1380. [Google Scholar] [CrossRef] [Scilit]
- Näumann, G.; Stumme, B.; Rehbein, H. Differenzierung von Kammmuscheln durch DNA-Analyse. Inf. Aus Der Fischereiforschung-Inf. Fish. Res. 2012, 59, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Espiñeira, M.; González-Lavín, N.; Vieites, J.M.; Santaclara, F.J. Development of a method for the genetic identification of commercial bivalve species based on mitochondrial 18S rRNA sequences. J. Agric. Food Chem. 2009, 57, 495–502. [Google Scholar] [CrossRef] [Scilit]
- Guardone, L.; Tinacci, L.; Costanzo, F.; Azzarelli, D.; D’Amico, P.; Tasselli, G.; Magni, A.; Guidi, A.; Nucera, D.; Armani, A. DNA barcoding as a tool for detecting mislabeling of fishery products imported from third countries: An official survey conducted at the Border Inspection Post of Livorno-Pisa (Italy). Food Control 2017, 80, 204–216. [Google Scholar] [CrossRef] [Scilit]
- Klapper, R.; Schröder, U. Verification of authenticity: A rapid identification method for commercial scallop species through multiplex real-time PCR. Food Control 2021, 121, 107574. [Google Scholar] [CrossRef] [Scilit]
- Stephan, R.; Johler, S.; Oesterle, N.; Näumann, G.; Vogel, G.; Pflüger, V. Rapid and reliable species identification of scallops by MALDI-TOF mass spectrometry. Food Control 2014, 46, 6–9. [Google Scholar] [CrossRef] [Scilit]
- Fernández, A.; García, T.; Asensio, L.; Rodríguez, M.Á.; González, I.; Céspedes, A.; Hernández, P.E.; Martín, R. Identification of the clam species Ruditapes decussatus (Grooved carpet shell), Venerupis pullastra (Pullet carpet shell), and Ruditapes philippinarum (Japanese carpet shell) by PCR-RFLP. J. Agric. Food Chem. 2000, 48, 3336–3341. [Google Scholar] [CrossRef] [Scilit]
- Galimberti, A.; de Mattia, F.; Losa, A.; Bruni, I.; Federici, S.; Casiraghi, M.; Martellos, S.; Labra, M. DNA barcoding as a new tool for food traceability. Food Res. Int. 2013, 50, 55–63. [Google Scholar] [CrossRef] [Scilit]
- Littlefair, J.E.; Clare, E.L. Barcoding the food chain: From Sanger to high-throughput sequencing. Genome 2016, 59, 946–958. [Google Scholar] [CrossRef] [Scilit]
- Böhme, K.; Calo-Mata, P.; Barros-Velázquez, J.; Ortea, I. Review of Recent DNA-Based Methods for Main Food-Authentication Topics. J. Agric. Food Chem. 2019, 67, 3854–3864. [Google Scholar] [CrossRef] [Scilit]
- Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; deWaard, J.R. Biological identifications through DNA barcodes. Proc. Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef] [Scilit]
- Teletchea, F.; Maudet, C.; Hänni, C. Food and forensic molecular identification: Update and challenges. Trends Biotechnol. 2005, 23, 359–366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Staats, M.; Arulandhu, A.J.; Gravendeel, B.; Holst-Jensen, A.; Scholtens, I.; Peelen, T.; Prins, T.W.; Kok, E. Advances in DNA metabarcoding for food and wildlife forensic species identification. Anal. Bioanal. Chem. 2016, 408, 4615–4630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pollack, S.J.; Kawalek, M.D.; Williams-Hill, D.M.; Hellberg, R.S. Evaluation of DNA barcoding methodologies for the identification of fish species in cooked products. Food Control 2018, 84, 297–304. [Google Scholar] [CrossRef] [Scilit]
- Armani, A.; Tinacci, L.; Lorenzetti, R.; Benvenuti, A.; Susini, F.; Gasperetti, L.; Ricci, E.; Guarducci, M.; Guidi, A. Is raw better? A multiple DNA barcoding approach (full and mini) based on mitochondrial and nuclear markers reveals low rates of misdescription in sushi products sold on the Italian market. Food Control 2017, 79, 126–133. [Google Scholar] [CrossRef] [Scilit]
- Feng, Y.; Li, Q.; Kong, L.; Zheng, X. DNA barcoding and phylogenetic analysis of Pectinidae (Mollusca: Bivalvia) based on mitochondrial COI and 16S rRNA genes. Mol. Biol. Rep. 2011, 38, 291–299. [Google Scholar] [CrossRef] [Scilit]
- Saavedra, C.; Peña, J.B. Phylogenetics of American scallops (Bivalvia: Pectinidae) based on partial 16S and 12S ribosomal RNA gene sequences. Mar. Biol. 2006, 150, 111–119. [Google Scholar] [CrossRef] [Scilit]
- Fernandez, A.; García, T.; Gonzalez, I.; Asensio, L.; Rodriguez, M.Á.; Hernández, P.E.; Martin, R. Polymerase chain reaction-restriction fragment length polymorphism analysis of a 16S rRNA gene fragment for authentication of four clam species. J. Food Prot. 2002, 65, 692–695. [Google Scholar] [CrossRef] [Scilit]
- Bendezu, I.F.; Slater, J.W.; Carney, B.F. Identification of Mytilus spp. and Pecten maximus in Irish waters by standard PCR of the 18S rDNA gene and multiplex PCR of the 16S rDNA gene. Mar. Biotechnol. (NY) 2005, 7, 687–696. [Google Scholar] [CrossRef] [Scilit]
- Colombo, F.; Trezzi, I.; Bernardi, C.; Cantoni, C.; Renon, P. A case of identification of pectinid scallop (Pecten jacobaeus, Pecten maximus) in a frozen and seasoned food product with PCR technique. Food Control 2004, 15, 527–529. [Google Scholar] [CrossRef] [Scilit]
- Fernandes, T.J.R.; Amaral, J.S.; Mafra, I. DNA barcode markers applied to seafood authentication: An updated review. Crit. Rev. Food Sci. Nutr. 2020, 61, 1–32. [Google Scholar] [CrossRef] [Scilit]
- Mafra, I.; Ferreira, I.M.P.L.V.O.; Oliveira, M.B.P.P. Food authentication by PCR-based methods. Eur. Food Res. Technol. 2008, 227, 649–665. [Google Scholar] [CrossRef] [Scilit]
- Marín, A.; Fujimoto, T.; Arai, K. Rapid species identification of fresh and processed scallops by multiplex PCR. Food Control 2013, 32, 472–476. [Google Scholar] [CrossRef] [Scilit]
- Marshall, H.D.; Johnstone, K.A.; Carr, S.M. Species-specific oligonucleotides and multiplex PCR for forensic discrimination of two species of scallops, Placopecten magellanicus and Chlamys islandica. Forensic Sci. Int. 2007, 167, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhan, A.; Hu, J.; Hu, X.; Lu, W.; Wang, M.; Peng, W.; Hui, M.; Bao, Z. Fast identification of scallop adductor muscles using species-specific microsatellite markers. Eur. Food Res. Technol. 2008, 227, 353–359. [Google Scholar] [CrossRef] [Scilit]
- Meistertzheim, A.-L.; Héritier, L.; Lejart, M. High-Resolution Melting of 18S rDNA sequences (18S-HRM) for discrimination of bivalve’s species at early juvenile stage: Application to a spat survey. Mar. Biol. 2017, 164, 133–141. [Google Scholar] [CrossRef] [Scilit]
- Pereira, A.M.; Fernández-Tajes, J.; Gaspar, M.B.; Méndez, J. Identification of the wedge clam Donax trunculus by a simple PCR technique. Food Control 2012, 23, 268–270. [Google Scholar] [CrossRef] [Scilit]
- Jilberto, F.; Araneda, C.; Larraín, M.A. High resolution melting analysis for identification of commercially-important Mytilus species. Food Chem. 2017, 229, 716–720. [Google Scholar] [CrossRef] [Scilit]
- Rego, I.; Martínez, A.; González-Tizón, A.; Vieites, J.; Leira, F.; Méndez, J. PCR technique for identification of mussel species. J. Agric. Food Chem. 2002, 50, 1780–1784. [Google Scholar] [CrossRef] [Scilit]
- Jin, Y.; Li, Q.; Kong, L.; Yu, H.; Zhong, X. High-resolution melting (HRM) analysis: A highly sensitive alternative for the identification of commercially important Crassostrea oysters. J. Molluscan Stud. 2015, 81, 167–170. [Google Scholar] [CrossRef] [Scilit]
- Hellberg, R.S.; Pollack, S.J.; Hanner, R.H. Seafood species identification using DNA sequencing. In Seafood Authenticity and Traceability; Academic Press: London, UK, 2016; ISBN 9780128015926. [Google Scholar]
- Galimberti, A.; Casiraghi, M.; Bruni, I.; Guzzetti, L.; Cortis, P.; Berterame, N.M.; Labra, M. From DNA barcoding to personalized nutrition: The evolution of food traceability. Curr. Opin. Food Sci. 2019, 28, 41–48. [Google Scholar] [CrossRef] [Scilit]
- Günther, B.; Raupach, M.J.; Knebelsberger, T. Full-length and mini-length DNA barcoding for the identification of seafood commercially traded in Germany. Food Control 2017, 73, 922–929. [Google Scholar] [CrossRef] [Scilit]
- Dobrovolny, S.; Blaschitz, M.; Weinmaier, T.; Pechatschek, J.; Cichna-Markl, M.; Indra, A.; Hufnagl, P.; Hochegger, R. Development of a DNA metabarcoding method for the identification of fifteen mammalian and six poultry species in food. Food Chem. 2019, 272, 354–361. [Google Scholar] [CrossRef] [Scilit]
- Frigerio, J.; Agostinetto, G.; Sandionigi, A.; Mezzasalma, V.; Berterame, N.M.; Casiraghi, M.; Labra, M.; Galimberti, A. The hidden ‘plant side’ of insect novel foods: A DNA-based assessment. Food Res. Int. 2020, 128, 108751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nicolè, S.; Negrisolo, E.; Eccher, G.; Mantovani, R.; Patarnello, T.; Erickson, D.L.; Kress, W.J.; Barcaccia, G. DNA Barcoding as a Reliable Method for the Authentication of Commercial Seafood Products. Food Technol. Biotechnol. 2012, 50(4), 387–398. [Google Scholar]
- Chin Chin, T.; Adibah, A.B.; Danial Hariz, Z.A.; Siti Azizah, M.N. Detection of mislabelled seafood products in Malaysia by DNA barcoding: Improving transparency in food market. Food Control 2016, 64, 247–256. [Google Scholar] [CrossRef] [Scilit]
- Giusti, A.; Armani, A.; Sotelo, C.G. Advances in the analysis of complex food matrices: Species identification in surimi-based products using Next Generation Sequencing technologies. PLoS ONE 2017, 12, e0185586. [Google Scholar] [CrossRef] [Scilit]
- Giusti, A.; Tinacci, L.; Sotelo, C.G.; Marchetti, M.; Guidi, A.; Zheng, W.; Armani, A. Seafood Identification in Multispecies Products: Assessment of 16SrRNA, cytb, and COI Universal Primers’ Efficiency as a Preliminary Analytical Step for Setting up Metabarcoding Next-Generation Sequencing Techniques. J. Agric. Food Chem. 2017, 65, 2902–2912. [Google Scholar] [CrossRef] [Scilit]
- Arulandhu, A.J.; Staats, M.; Hagelaar, R.; Voorhuijzen, M.M.; Prins, T.W.; Scholtens, I.; Costessi, A.; Duijsings, D.; Rechenmann, F.; Gaspar, F.B.; et al. Development and validation of a multi-locus DNA metabarcoding method to identify endangered species in complex samples. Gigascience 2017, 6, 1–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carvalho, D.C.; Palhares, R.M.; Drummond, M.G.; Gadanho, M. Food metagenomics: Next generation sequencing identifies species mixtures and mislabeling within highly processed cod products. Food Control 2017, 80, 183–186. [Google Scholar] [CrossRef] [Scilit]
- Schirmer, M.; D’Amore, R.; Ijaz, U.Z.; Hall, N.; Quince, C. Illumina error profiles: Resolving fine-scale variation in metagenomic sequencing data. BMC Bioinform. 2016, 17, 125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bundesministerium für Arbeit, Soziales, Gesundheit und Konsumentenschutz. Codexkapitel/B 35/Fische, Krebse, Weichtiere und dar-aus Hergestellte Erzeugnisse: BMGF-75210/0026-II/B/13/2017; Bundesministerium für Arbeit, Soziales, Gesundheit und Konsumentenschutz: Vienna, Austria, 2007. [Google Scholar]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10. [Google Scholar] [CrossRef] [Scilit]
- Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- European Commission. Directorate General for Maritime Affairs and Fisheries. In The EU Fish Market; Publications Office: Brussels, Belgium, 2019. [Google Scholar]
- Del Rio-Lavín, A.; Jiménez, E.; Pardo, M.Á. SYBR-Green real-time PCR assay with melting curve analysis for the rapid identification of Mytilus species in food samples. Food Control 2021, 130, 108257. [Google Scholar] [CrossRef] [Scilit]

| Scientific Name | Commercial Name (German) | Commercial Name (English) |
|---|---|---|
| Mytilidae | Miesmuscheln | Mussels |
| Mytilus edulis | Gemeine Miesmuschel | Blue mussel |
| Mytilus galloprovincialis | Mittelmeer-Miesmuschel | Mediterranean mussel |
| Perna canaliculus | Neuseeland-Miesmuschel | New Zealand green-lipped mussel |
| Pectinidae | Kammmuscheln | Scallops |
| Placopecten magellanicus | Atlantischer Tiefseescallop | Atlantic deep-sea scallop |
| Mizuhopecten yessoensis | Japanische Kammmuschel | Yesso scallop |
| Pecten jacobaeus | Jakobsmuschel | Great scallop |
| Zygochlamys patagonica | Patagonische Kammmuschel | Patagonian scallop |
| Argopecten purpuratus | Purpur-Kammmuschel | Purple scallop |
| Aequipecten opercularis | Kleine Pilgermuschel | Queen scallop |
| Ostreidae | Austern | Oysters |
| Magallana gigas | Pazifische Felsenauster | Pacific oyster |
| Ostrea edulis | Europäische Auster | European flat oyster |
| Name | Sequence 5′→3′ |
|---|---|
| mussel | |
| For_Mu | CCTTTTGCATAAGGGTTTTTCAAG |
| Rev1_Mu | CGAATAGTATCTAGCCGCCATTC |
| Rev2_Mu | GCAAATAGCATATCACTTTCACCTC |
| scallop | |
| For_Mu | TGCTAAGGTAGCTAAATTATGGCC |
| Rev_Mu | CTTCACGGGGTCTTCTCGTC |
| oyster | |
| For_Mu | GGTAGCGAAATTCCTTGCCTT |
| Rev_Mu | AAAGTTGCACGGGGTCTT |
| overhang | |
| Forward | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG |
| Reverse | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG |
| Sample ID | Declaration on the Product | Species Identified | Total Number of Raw Reads | Total Number | Number | Percentage | |
|---|---|---|---|---|---|---|---|
| Scientific/Latin Name | Product Description [Eng] | of Reads Passing the Workflow | of Reads Assigned Correctly | of Reads Assigned Correctly (%) | |||
| O2 | Ostrea edulis | Oyster | Ostrea edulis | 78559 | 63491 | 61875 | 97.46 |
| O3 | Crassostrea gigas * | Oyster | Magallana gigas * | 76143 | 65389 | 64125 | 98.07 |
| M12 | Mytilus galloprovincialis | Blue Mussel | Mytilus galloprovincialis | 162843 | 150678 | 149315 | 99.09 |
| M13 | Perna canaliculus | New Zealand green-lipped mussel | Perna canaliculus | 169631 | 104861 | 103350 | 98.56 |
| M27 | Mytilus edulis | Mussels in marinade | Mytilus edulis | 134500 | 120686 | 105024 | 87.02 |
| S42 | Mizuhopecten yessoensis | Yesso scallop | Mizuhopecten yessoensis | 75927 | 58069 | 57058 | 98.26 |
| S46 | Pecten jacobaeus | Great scallop | Pecten spp. | 79472 | 61484 | 60514 | 98.42 |
| S47 | Zygochlamys patagonica | Scallop “á la Bretonne” | Zygochlamys patagonica | 77747 | 59245 | 58429 | 98.62 |
| S49 | Placopecten magellanicus | Great scallop | Placopecten magellanicus | 79131 | 61531 | 60886 | 98.95 |
| S50 | Argopecten purpuratus | Pacific scallop | Argopecten purpuratus | 77383 | 55455 | 54588 | 98.44 |
| S55 | Aequipecten opercularis | Scallop in sauce | Aequipecten opercularis | 79141 | 56064 | 55800 | 99.53 |
| Proportion | Total Number of Raw Reads | Total Number of Reads Passing the Workflow | Reads Assigned Correctly | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Species 1 (98%) | Species 2 (1.5%) | Species 3 (0.5%) | Species 1 | (%) | Species 2 | (%) | Species 3 | (%) | ||
| Magallana gigas | Mytilus galloprovincialis | Pecten spp. | 80856 | 69506 | 66430 | 95.57 | 1985 | 2.86 | 658 | 0.95 |
| Magallana gigas | Pecten spp. | Mytilus galloprovincialis | 89552 | 76669 | 73114 | 95.36 | 2182 | 2.85 | 894 | 1.17 |
| Pecten spp. | Magallana gigas | Mytilus galloprovincialis | 88971 | 69682 | 66291 | 95.13 | 1710 | 2.45 | 922 | 1.32 |
| Pecten spp. | Mytilus galloprovincialis | Magallana gigas | 84085 | 65961 | 62434 | 94.65 | 2281 | 3.46 | 555 | 0.84 |
| Mytilus galloprovincialis | Pecten spp. | Magallana gigas | 159737 | 147196 | 140147 | 95.21 | 4356 | 2.96 | 1478 | 1.00 |
| Mytilus galloprovincialis | Magallana gigas | Pecten spp. | 147443 | 136629 | 130986 | 95.87 | 3304 | 2.42 | 1156 | 0.85 |
| Main Component | Minor Component (1.0% Each) | Total Number of Raw Reads | Total Number of Reads Passed the Workflow | Reads Assigned Correctly | Percentage of Reads Assigned Correctly (%) |
|---|---|---|---|---|---|
| Placopecten magellanicus | 83526 * | 65446 | 58156 | 88.86 | |
| Mizuhopecten yessoensis | 626 | 0.96 | |||
| Pecten spp. | 817 | 1.25 | |||
| Zygochlamys patagonica | 4534 | 6.93 | |||
| Argopecten purpuratus | 663 | 1.01 | |||
| Aequipecten opercularis | 35 | 0.05 | |||
| Placopecten magellanicus | 84282 * | 66691 | 63628 | 95.41 | |
| Magallana gigas | 1298 | 1.95 | |||
| Ostrea edulis | 1088 | 1.63 | |||
| Perna canaliculus | 179227 * | 128882 | 77483 | 60.12 | |
| Mytilus galloprovincialis | 50391 | 39.10 | |||
| Mytilus edulis | 824 | 0.64 | |||
| Sepiella inermis | 78467 | 61415 | |||
| Placopecten magellanicus | 31424 | 51.17 | |||
| Ostrea edulis | 28162 | 45.86 | |||
| Perna canaliculus | 806 | 1.31 |
| Sample ID | Declaration on the Product | Species Identified | Total Number of Raw Reads | Total Number of Reads Passed the Workflow | Reads Assigned Correctly | Percentage of Reads Assigned Correctly (%) | |
|---|---|---|---|---|---|---|---|
| Scientific/Latin Name | Product Description [Eng] | ||||||
| O5 | Crassostrea gigas4 | Oyster in sunflower oil | Magallana gigas4 | 76930 1 | 65728 | 64369 | 97.93 |
| O6 | Crassostrea gigas4 | Oyster in sunflower oil | Magallana gigas4 | 44848 1 | 38547 | 37610 | 97.57 |
| O7 | Crassostrea gigas4 | Oyster in water | Magallana gigas4 | 76247 | 64917 | 63700 | 98.13 |
| O8 | not declared | Oyster sauce | Saccostrea malabonensis | 14470 | 11658 | 5442 | 46.68 |
| Magallana bilineata | 4652 | 39.91 | |||||
| M23 | not declared | Mussel with sherry vinegar | Mytilus galloprovincialis | 33517 | 30794 | 30358 | 98.58 |
| M25 | not declared | Mussel in marinade sauce | Mytilus galloprovincialis | 163188 | 151688 | 150700 | 99.35 |
| M26 | not declared | Grilled blue mussel | Mytilus galloprovincialis | 163106 | 151608 | 150433 | 99.23 |
| M29 | Mytilus galloprovincialis | Blue mussel in | Mytilus galloprovincialis | 153435 | 140475 | 132354 | 94.22 |
| tomato sauce | Mytilus edulis | 7937 | 5.65 | ||||
| M30 | Mytilus galloprovincialis | Blue mussel | Mytilus galloprovincialis | 185479 | 171890 | 170624 | 99.26 |
| A la mariniere | Mytilus edulis | 1156 | 0.67 | ||||
| M31 | not declared | Blue mussel in | Mytilus galloprovincialis | 170303 | 158379 | 157015 | 99.14 |
| organic marinade | Mytilus edulis | 1267 | 0.80 | ||||
| M32 | not declared | Marinated blue | Mytilus galloprovincialis | 159181 | 144788 | 143399 | 99.04 |
| mussel | Mytilus edulis | 1308 | 0.90 | ||||
| M33 | Mytilus chilensis | Mussel in | Mytilus galloprovincialis | 167903 | 151219 | 118879 | 78.61 |
| Escabeche | Mytilus edulis | 31737 | 20.99 | ||||
| M34 | Mytilus chilensis | Mussel | Mytilus galloprovincialis | 152112 | 138768 | 87964 | 63.39 |
| Mytilus edulis | 49601 | 35.74 | |||||
| M36 | Mytilus galloprovincialis | Blue mussel marinated | Mytilus galloprovincialis Mytilus edulis | 176963 | 163721 | 162224 | 99.09 |
| 1323 | 0.81 | ||||||
| M37 | Mytilus edulis | Mussel in honey mustard sauce | Mytilus galloprovincialis Mytilus edulis | 149364 | 136868 | 135249 | 98.82 |
| 1400 | 1.02 | ||||||
| M38 | not declared | Blue mussel | Mytilus galloprovincialis | 138801 | 127244 | 125980 | 99.01 |
| in marinade | Mytilus edulis | 1056 | 0.83 | ||||
| S58 | not declared | Rillettes de | Aequipecten opercularis | 62787 | 44307 | 42716 | 96.41 |
| Saint-Jacques | Mytilus galloprovincialis | 1330 | 3.00 | ||||
| S59 | not declared | Small scallop in galician sauce | Aequipecten opercularis | 82550 | 59722 | 58296 | 97.61 |
| Mi62 | Mytilus chilensis | Seafood mix | Mytilus galloprovincialis | 618324 | 569815 | 433439 | 76.07 |
| Mytilus edulis | 134543 | 23.61 | |||||
| Mi63 | not declared | Sauce with | Mytilus edulis | 152170 | 139306 | 73550 | 52.80 |
| seafood | Mytilus galloprovincialis | 64729 | 46.47 | ||||
| Mi64 | Mytilus chilensis Mytilus edulis | Seafood mix | Mytilus galloprovincialis Mytilus edulis | 131285 | 119350 | 81590 | 68.36 |
| 37211 | 31.18 | ||||||
| Mi65 | not declared | Bouillabaisse Marseille | Mytilus galloprovincialisMytilus edulis | 157311 | 143479 | 138535 | 96.55 |
| 4777 | 3.33 | ||||||
| Mi66 | Mytilus chilensis | Seafood mix | Mytilus galloprovincialis | 152535 | 140047 | 92024 | 65.71 |
| Mytilus edulis | 47415 | 33.86 | |||||
| Mi67 | Mytilus spp. | Seafood mix | Mytilus galloprovincialis | 76544 | 69081 | 48275 | 69.88 |
| Mytilus edulis | 20459 | 29.62 | |||||
| Mi68 | Mytilus galloprovincialis | Sea fruit salad in sunflower oil | Mytilus galloprovincialis Mytilus edulis | 157861 | 145671 | 144468 | 99.17 |
| 1046 | 0.72 | ||||||
| Mi69 | Mytilus chilensis | Seafood mix | Mytilus galloprovincialis Mytilus edulis | 140227 | 128007 | 85679 | 66.93 |
| 41686 | 32.57 | ||||||
| Mi70 | not declared | Sea fruit salad fantasy | Mytilus galloprovincialis Mytilus edulis | 120677 | 106674 | 101121 | 94.80 |
| 5413 | 5.07 | ||||||
| Mi71 | not declared | Seafood mix | Mytilus galloprovincialis | 160546 | 147278 | 79680 | 54.10 |
| Mytilus edulis | 66675 | 45.27 | |||||
| Mi72 | Mytilus chilensis | Seafood mix | Mytilus galloprovincialis | 160059 | 146539 | 91557 | 62.48 |
| Mytilus edulis | 54271 | 37.03 | |||||
| Mi73 | not declared | Seafood mix | Mytilus edulis | 150500 | 137634 | 78942 | 57.36 |
| Mytilus galloprovincialis | 57608 | 41.86 | |||||
| Mi74 | not declared | Seafood mix | Mytilus galloprovincialis | 168841 | 155701 | 79035 | 50.76 |
| Mytilus edulis | 75612 | 48.56 | |||||
| Mi75 | not declared | Pizza Frutti di | Mytilus galloprovincialis | 181822 1 | 172620 | 95184 | 55.14 |
| mare | Mytilus edulis | 71440 | 41.39 | ||||
| Mi76 | not declared | Paella | Mytilus galloprovincialis | 150431 | 139511 | 138335 | 99.16 |
| Mytilus edulis | 1070 | 0.77 | |||||
| Mi77 | Mytilus edulis, | Paella | Mytilus galloprovincialis | 141816 | 132092 | 130768 | 99.00 |
| Mytilus chilensis | Mytilus edulis | 1242 | 0.94 | ||||
| Mi78 | Mytilus chilensis | Seafood all’Olio | Mytilus galloprovincialis | 134717 | 122906 | 73482 | 59.79 |
| Mytilus edulis | 48774 | 39.68 | |||||
| Mi79 | Mytilus chilensis | Seafood mix | Mytilus galloprovincialis | 148773 | 137122 | 73035 | 53.26 |
| Mytilus edulis | 63249 | 46.13 | |||||
| Mi80 | Mytilus chilensis | Seafood mix | Mytilus galloprovincialis | 136695 | 126608 | 88130 | 69.61 |
| Mytilus edulis | 37970 | 29.99 | |||||
| Mi81 | not declared | Sea fruit salad | Mytilus galloprovincialis | 153499 | 142736 | 141578 | 99.19 |
| Mytilus edulis | 1022 | 0.72 | |||||
| Mi82 | Zygochlamys patagonica Chlamys opercularis | Scallop terrine | Zygochlamys patagonica | 76554 | 59181 | 57329 | 96.87 |
| Mi83 | not declared | Terrine of salmon and great scallop | Pecten spp. | 96596 1 | 76834 | 75476 | 98,23 |
| Mi84 | Mytilus chilensis | Seafood mix | Mytilus galloprovincialis | 163885 | 150852 | 124468 | 82.51 |
| Mytilus edulis | 25916 | 17.18 | |||||
| Mi85 | not declared | Instant noodle seafood, mild | Mytilus galloprovincialis | 15409 | 14118 | 13750 | 97.39 |
| Mi86 | not declared | Instant noodle seafood, spicy | Mytilus galloprovincialis | 9787 | 8892 | 8473 | 95.29 |
| O1 | Crassostrea gigas4 | Oyster | Magallana gigas4 | 139319 2 | 134073 | 133493 | 99.57 |
| O4 | not declared | Oyster | Magallana gigas | 46089 2 | 40991 | 40279 | 98.26 |
| O9 | not declared | Oyster sauce | not evaluable 3 | ||||
| O10 | not declared | Oyster sauce | not evaluable 3 | ||||
| M11 | Mytilus edulis | Mussel | Mytilus galloprovincialis | 23766 2 | 22546 | 22147 | 98.23 |
| M14 | Mytilus spp. | Blue mussel | Mytilus galloprovincialis | 126880 2 | 119717 | 79522 | 66.42 |
| Mytilus edulis | 39555 | 33.04 | |||||
| M15 | Mytilus spp | Blue mussel | Mytilus galloprovincialis | 227678 | 220699 | 220226 | 99.79 |
| M16 | Mytilus edulis | Bouchot mussel | Mytilus galloprovincialis | 51292 2 | 49604 | 48832 | 98.44 |
| M17 | not declared | Grilled blue | Mytilus galloprovincialis | 9888 2 | 6750 | 3956 | 58.61 |
| mussel | Mytilus edulis | 1998 | 29.60 | ||||
| M18 | Mytilus chilensis | Blue mussel | Mytilus galloprovincialis | 53710 2 | 51670 | 50733 | 98.19 |
| M19 | not declared | Blue mussel | Mytilus galloprovincialis | 57238 2 | 54822 | 53829 | 98.19 |
| M20 | Mytilus spp. | Blue mussel | Mytilus galloprovincialis | 72113 2 | 69576 | 68969 | 99.13 |
| M21 | Mytilus edulis | Mussel | Mytilus galloprovincialis | 51328 2 | 49908 | 49459 | 99.10 |
| M22 | Mytilus galloprovincialis | Blue mussel | Mytilus galloprovincialis | 1159502 | 110777 | 109262 | 98.63 |
| Mytilus edulis | 1466 | 1.32 | |||||
| M24 | Mytilus chilensis | Blue mussel in | Mytilus galloprovincialis | 113942 2 | 107150 | 94449 | 88.15 |
| tomato sauce | Mytilus edulis | 12505 | 11.67 | ||||
| M28 | not declared | Dry cat food | Pecten spp. | 128693 3 | 126380 | 79764 | 63.11 |
| with green | Mytilus galloprovincialis | 40450 | 32.01 | ||||
| lipped mussel | Perna canaliculus | 4712 | 3.73 | ||||
| M35 | Mytilus chilensis | Mussel in tomato sauce | Mytilus galloprovincialis | 197899 3 | 190771 | 189540 | 99.35 |
| M39 | Mytilus chilensis | Blue mussel | Mytilus galloprovincialis | 182612 3 | 175982 | 96502 | 54.84 |
| Mytilus edulis | 75204 | 42.73 | |||||
| M40 | Mytilus edulis | Blue mussel | Mytilus galloprovincialis | 182958 3 | 179399 | 178024 | 99.23 |
| S41 | Placopecten magellanicus | Deep-sea scallop | Placopecten magellanicus | 143794 2 | 132140 | 131583 | 99.58 |
| S43 | Pecten maximus | Great scallop | Mizuhopecten yessoensis | 122156 2 | 113706 | 113128 | 99.49 |
| S44 | Pecten spp. | Great scallop | Mizuhopecten yessoensis | 2873135 2 | 2718126 | 2717426 | 99.97 |
| S45 | Placopecten magellanicus | Deep-sea scallop | Placopecten magellanicus | 111673 2 | 107119 | 106632 | 99.55 |
| S48 | Patinopecten yessoensis | Great scallop/ Yesso scallop | Mizuhopecten yessoensis | 47397 2 | 41076 | 407873 | 99.51 |
| S51 | not declared | Great scallop | Placopecten magellanicus | 51565 2 | 45007 | 44915 | 99.80 |
| S52 | Patinopecten yessoensis | Great scallop | Mizuhopecten yessoensis | 46673 2 | 39769 | 39627 | 99.64 |
| S53 | Pecten spp. | Great scallop | Mizuhopecten yessoensis | 42857 2 | 36443 | 35265 | 96.77 |
| S54 | Placopecten magellanicus | Great scallop | Placopecten magellanicus | 55475 2 | 48703 | 47915 | 98.38 |
| S56 | not declared | Great scallop | Placopecten magellanicus | 1268169 3 | 1061137 | 1060653 | 99.95 |
| S57 | Placopecten magellanicus | Great scallop | Pecten spp. | 174497 3 | 171299 | 170404 | 99.48 |
| S60 | not declared | Deep-sea scallop | Placopecten magellanicus | 364474 3 | 350953 | 350869 | 99.98 |
| S61 | Patinopecten yessoensis | Great scallop | Mizuhopecten yessoensis | 159145 3 | 152930 | 152849 | 99.95 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gense, K.; Peterseil, V.; Licina, A.; Wagner, M.; Cichna-Markl, M.; Dobrovolny, S.; Hochegger, R. Development of a DNA Metabarcoding Method for the Identification of Bivalve Species in Seafood Products. Foods 2021, 10, 2618. https://doi.org/10.3390/foods10112618
Gense K, Peterseil V, Licina A, Wagner M, Cichna-Markl M, Dobrovolny S, Hochegger R. Development of a DNA Metabarcoding Method for the Identification of Bivalve Species in Seafood Products. Foods. 2021; 10(11):2618. https://doi.org/10.3390/foods10112618
Chicago/Turabian StyleGense, Kristina, Verena Peterseil, Alma Licina, Martin Wagner, Margit Cichna-Markl, Stefanie Dobrovolny, and Rupert Hochegger. 2021. "Development of a DNA Metabarcoding Method for the Identification of Bivalve Species in Seafood Products" Foods 10, no. 11: 2618. https://doi.org/10.3390/foods10112618
APA StyleGense, K., Peterseil, V., Licina, A., Wagner, M., Cichna-Markl, M., Dobrovolny, S., & Hochegger, R. (2021). Development of a DNA Metabarcoding Method for the Identification of Bivalve Species in Seafood Products. Foods, 10(11), 2618. https://doi.org/10.3390/foods10112618

