Next Article in Journal
Olive Tree Derivatives and Hydroxytyrosol: Their Potential Effects on Human Health and Its Use as Functional Ingredient in Meat
Next Article in Special Issue
Real-Time PCR Assay for the Detection and Quantification of Roe Deer to Detect Food Adulteration—Interlaboratory Validation Involving Laboratories in Austria, Germany, and Switzerland
Previous Article in Journal
Strategies for Nitrite Replacement in Fermented Sausages and Effect of High Pressure Processing against Salmonella spp. and Listeria innocua
Previous Article in Special Issue
Microsatellite Markers in Olives (Olea europaea L.): Utility in the Cataloging of Germplasm, Food Authenticity and Traceability Studies
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of a DNA Metabarcoding Method for the Identification of Bivalve Species in Seafood Products

1
Austrian Competence Centre for Feed and Food Quality, Safety and Innovation, FFoQSI GmbH, Technopark 1, 3430 Tulln an der Donau, Austria
2
Austrian Agency for Health and Food Safety (AGES), Institute for Food Safety, Department of Molecular Biology and Microbiology, Spargelfeldstr. 191, 1220 Vienna, Austria
3
LVA GmbH, Magdeburggasse 10, 3400 Klosterneuburg, Austria
4
Department for Farm Animals and Veterinary Public Health, Institute of Milk Hygiene, University of Veterinary Medicine, Veterinärplatz 1, 1210 Vienna, Austria
5
Department of Analytical Chemistry, Faculty of Chemistry, University of Vienna, Währinger Straße 38, 1090 Vienna, Austria
*
Author to whom correspondence should be addressed.
Foods 2021, 10(11), 2618; https://doi.org/10.3390/foods10112618
Submission received: 28 September 2021 / Revised: 20 October 2021 / Accepted: 23 October 2021 / Published: 28 October 2021
(This article belongs to the Special Issue Techniques for Food Authentication: Trends and Emerging Approaches)

Abstract

The production of bivalve species has been increasing in the last decades. In spite of strict requirements for species declaration, incorrect labelling of bivalve products has repeatedly been detected. We present a DNA metabarcoding method allowing the identification of bivalve species belonging to the bivalve families Mytilidae (mussels), Pectinidae (scallops), and Ostreidae (oysters) in foodstuffs. The method, developed on Illumina instruments, targets a 150 bp fragment of mitochondrial 16S rDNA. We designed seven primers (three primers for mussel species, two primers for scallop species and a primer pair for oyster species) and combined them in a triplex PCR assay. In each of eleven reference samples, the bivalve species was identified correctly. In ten DNA extract mixtures, not only the main component (97.0–98.0%) but also the minor components (0.5–1.5%) were detected correctly, with only a few exceptions. The DNA metabarcoding method was found to be applicable to complex and processed foodstuffs, allowing the identification of bivalves in, e.g., marinated form, in sauces, in seafood mixes and even in instant noodle seafood. The method is highly suitable for food authentication in routine analysis, in particular in combination with a DNA metabarcoding method for mammalian and poultry species published recently.

1. Introduction

Bivalves, a class of molluscs, are distributed worldwide. Due to their high content of essential nutrients, their production has steadily been increased over the last three decades [1,2,3,4,5]. Mytilidae (mussels), Pectinidae (scallops), and Ostreidae (oysters) are the most important bivalve families for human consumption. Each of these bivalve families is divided into several genera comprising a high number of species [6]. In 2019, 1.03 million tons of mussels, scallops, and oysters were caught in nature and 10.25 million tons were cultivated in aquaculture, earning a profit of millions of US dollars [7].
In the EU, international and national regulations exist to ensure legal trade in seafood and seafood products. The EU directive 1379/2013 regulates market organization of fishery and aquaculture products, including correct declaration of seafood [8]. To comply with legal regulations, labels must include both the local trade name in the official language(s) and the correct scientific Latin name [8,9]. Correct labelling of seafood products is important for traceability issues, protection of endangered species, mitigation of illegal fishing, and for individual reasons of end consumers [10,11]. Regardless of clear and strict requirements for species declaration, incorrect labelling of bivalve products has repeatedly been detected in Europe [12,13,14,15,16,17]. In German and Swiss studies, more than half of the products declared to contain “Jakobsmuschel” (or “Jacobsmuschel“) were labelled incorrectly [15,18,19]. Although the German name “Jakobsmuschel” (or “Jacobsmuschel“) may only be used for scallop species belonging to the genus Pecten, species of other genera (particularly Placopecten and Mizuhopecten) were identified in these products.
For authentication of seafood products, laboratories may choose from a variety of methodologies. In the case of bivalves, morphological characteristics such as shell, color, and size may allow correct species classification. However, after shell removal or mechanical processing, classification by morphology may be hampered or even be impossible [16,20]. Recently, matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS) has been shown to be suitable for accurate species identification of scallops [19]. However, since MALDI-TOF MS instruments are rather expensive and do not allow high-throughput analysis, this methodology is less applicable for routine analyses.
To date, DNA-based methods are considered most suitable for the identification of seafood species, even in highly processed food products [21,22,23]. Due to its high copy number and robustness, mitochondrial DNA (mtDNA) is frequently preferred over genomic DNA [24,25]. The mtDNA regions most commonly used for species identification are cytochrome c oxidase subunit I (COI), cytochrome b (cyt b), and 16S ribosomal DNA (16S rDNA) [15,26,27,28,29,30,31,32,33]. Compared to other seafood, e.g., fish, crustaceans, and cephalopods, (real-time) polymerase chain reaction (PCR) assays for bivalve species are limited in number [18,32,34,35,36,37,38,39,40,41]. The disadvantage of (real-time) PCR is that for each target species, a specific primer (probe) system is required [18,31,33,36,39,40,41,42,43].
A powerful alternative is DNA barcoding, aiming at detecting a broader range of species by using universal primer systems [22,26,34,44]. DNA barcodes commonly contain conserved regions at both ends, serving as binding sites for universal primers, and a variable part in between the primer binding sites, for differentiation between the species of interest [34,45]. DNA barcodes of approximately 600 base pairs (bp) in length have been found to be suitable for the analysis of highly processed food products [22,26,27,34,44,46,47,48]. In conventional DNA barcoding, PCR products obtained by amplifying the selected DNA barcode region are then subjected to Sanger sequencing [22,34,44,49,50]. However, sample throughput of Sanger sequencing is limited since samples are sequenced one by one. A much more efficient approach is to combine DNA barcoding with next-generation sequencing (NGS) technologies [22,26,34]. So-called DNA metabarcoding allows the identification of multiple species in multiple food samples in one and the same sequencing run [45,46,51,52,53,54]. The suitability of DNA metabarcoding for the analysis of ultra-processed food products has already been demonstrated, e.g., for the detection of mammals in sausages or insects in bars [47,48].
In this study, we present a DNA metabarcoding method allowing the differentiation between species from three bivalve families, Pectinidae, Ostreidae, and Mytilidae, in raw and processed food products to detect food adulteration. The method was developed on the Illumina MiSeq® (San Diego, CA, USA) and iSeq® (San Diego, CA, USA) platforms due to their low error rates compared to other NGS platforms [55].

2. Materials and Methods

2.1. Sample Collection and Storage

A total of 86 commercial food products were collected from regional supermarkets, fish markets, and delicacy shops in Austria from summer 2018 until winter 2020 (Supplementary Table S1). Samples were either fresh, deep-frozen, or in processed condition. Each sample was given a specific ID number, with the letter “O” referring to oysters, “S” to scallops, “M” to mussels, and “Mi” to mixed-species seafood. Samples were stored at −20 °C until DNA extraction.
Eleven out of the 86 samples (“reference samples”), comprising three mussel, six scallop, and two oyster species (see Table 1), were used for method development. Identity of bivalve species in these reference samples (samples M12, M13 and M27 for mussels; samples S42, S46, S47, S49, S50, and S55 for scallops; samples O2 and O3 for oysters; Supplementary Table S1) was verified by subjecting DNA extracts to Sanger sequencing (Microsynth, Balgach, Switzerland) and matching the sequences against the public databases provided by the National Center for Biotechnology Information (NCBI, Bethesda, MD, USA). For Sanger sequencing, the forward and reverse primers listed in Table 2 were used.

2.2. DNA Extraction and Quantification

Raw material was cut into smaller pieces or homogenized. To 2.0 g of each sample, 10 mL of a hexadecyltrimethylammonium bromide (CTAB) buffer was added. After addition of 80 µL proteinase K, the mixture was incubated on an Intelli-MixerTM RM2 (LTF Labortechnik, Wasserburg, Germany) overnight at 50 °C.
For DNA isolation, a commercial kit (Maxwell® 16 FFS Nucleic Acid Extraction System Custom-Kit, Promega, Madison, WI, USA) was used according to the manufacturer’s instructions. DNA concentration was determined fluorometrically (Qubit® 2.0 fluorometer, Thermo Fisher Scientific, Waltham, MA, USA). For higher concentrations, the Qubit® dsDNA broad range assay kit (2 to 1000 ng) was used, and for lower concentrations, the Qubit® dsDNA high-sensitivity assay kit (0.2 to 100 ng) was used. DNA purity was assessed from the ratio of the absorbance at 260 and 280 nm (QIAxpert spectrophotometer, software version 2.2.0.21, Qiagen, Hilden, Germany). DNA extracts were stored at −20 °C until further use.

2.3. DNA Extract Mixtures

Ternary DNA extract mixtures were prepared by mixing DNA extracts (DNA concentration 5 ng/µL) from Pecten spp., Magallana gigas and Mytilus galloprovincialis, representing the three bivalve families Pectinidae, Ostreidae, and Mytilidae, respectively. Individual DNA extracts were mixed in a ratio of 98.0:1.5:0.5 (v/v/v).
In addition, DNA extract mixtures consisting of DNA from species belonging to one bivalve family were prepared. In these mixtures, DNA from one species was present as the main component, DNA from the other species as minor components (1.0% each). Since only two oyster species were available, the DNA extract mixture representing the bivalve family Ostreidae contained the closely related scallop (Placopecten magellanicus) as a major component (98.0%) and DNA from the two oyster species as minor components (1.0% each).
In addition to mixtures consisting of DNA from bivalve species only, a DNA extract mixture containing another mollusc species was prepared. DNA extract from a squid species (Sepiella inermis) was chosen as the main component (97.0%) and DNA from the bivalve species Placopecten magellanicus, Ostrea edulis and Perna canaliculus was present as minor components (1.0% each).

2.4. Reference Sequences

A 150 bp fragment of the mitochondrial 16S rDNA gene was used as a DNA barcode. Reference sequences for commonly consumed bivalve species and some exotic seafood species, that are permitted for consumption in Austria (“Codex Alimentarius Austriacus” chapter B35, [56]), were downloaded from the NCBI databases (Supplementary Table S2) by using CLC Genomics Workbench software (version 10.1.1, Qiagen, Hilden, Germany). If available, complete reference sequences from the RefSeq database were preferentially downloaded due to their reliability. In case complete reference sequences were not available, all DNA sequences of the mitochondrial 16S rDNA available for one and the same species, submitted by individual scientists, were aligned and checked for similarity and unidentified nucleotides. Subsequently, the DNA sequence with the highest quality (e.g., without unknown nucleotides, full-length of the DNA barcode) was chosen as a reference sequence.

2.5. Primer Systems

Primers were designed manually on a multiple DNA sequence alignment of the mitochondrial 16S rDNA of approximately 90 bivalve species using the CLC Genomics Workbench software (version 10.1.1, Qiagen, Hilden, Germany). The designed primers were checked for their physical and structural properties (e.g., formation of dimers, secondary structure, annealing temperature) using Oligo Calc, the OligoAnalyzer Tool provided by Integrated DNA Technologies (IDT, Coralville, IA, USA) and the online product descriptions from TIB Molbiol (Berlin, Germany). The primers, listed in Table 2, were synthesized by TIB Molbiol. Table 2 also shows the Illumina overhang adapter sequences which were linked to the target-specific primers.
All in-house-designed primers were tested in real-time PCR with DNA extracted from the eleven reference samples. During optimization, the following PCR conditions/parameters were kept constant and applied as published previously: DNA input amount of 12.5 ng, ‘ready-to-use’ HotStarTaq Master Mix Kit, annealing temperature (62 °C), 25 cycles [47]. Only one variable, the addition of magnesium chloride solution, was modified (addition of 1.5 or 3 mM MgCl2). Real-time PCR reactions were carried out using a fluorescent intercalating dye (EvaGreen® (20x in water)) in strip tubes or in 96-well plates, depending on the thermocycler used, the Rotor-Gene Q (Qiagen, Hilden, Germany) or the LightCycler® 480 System (Roche, Penzberg, Germany), respectively. The total volume of the PCR reactions was 25 µL, consisting of 22.5 µL reaction mix and 2.5 µL of template DNA (diluted DNA samples (5 ng/µL)) or water as negative control. In the reaction mix, the HotStarTaq Master Mix Kit (Qiagen, Hilden, Germany) was used at a final concentration of 1x and the final concentration of primers was 0.2 µM, except the forward primer for mussels (0.4 µM). PCR cycling conditions were 15 min initial denaturation at 95 °C, 25 cycles at 95 °C, 62 °C and 72 °C for 30 s each, and a final elongation for 10 min at 72 °C. The primer pairs for mussels, scallops, and oysters with and without Illumina overhang adapter sequences were first used in singleplex PCR assays. Then, the seven primers (three forward and four reverse primers) listed in Table 2 were combined in a triplex assay. The identity of the PCR products was confirmed by melting curve analysis and/or agarose gel electrophoresis.

2.6. Library Preparation and NGS

In general, samples were sequenced by using either the MiSeq® or the iSeq® platform (Illumina, San Diego, CA, USA). DNA extracts were diluted to a DNA concentration of 5 ng/μL. Extracts with a DNA concentration < 5 ng/μL were used undiluted.
DNA library preparation was performed according to Dobrovolny et al. [47] with minor modifications (excess of MgCl2, final concentration 3 mM; average library size: 278 bp; diluted libraries of the iSeq® system were denatured automatically on the instrument).
For the MiSeq® and iSeq® platform, the DNA library was adjusted to 4 and 1 nM, respectively, with 10 mM Tris-HCl, pH 8.6. After pooling individual DNA libraries (5 µL MiSeq®, 7 µL iSeq®), the DNA concentration was determined using Qubit® 2.0 fluorimeter.
All sequencing runs were performed using either the MiSeq® Reagent Kit v2 (300-cycles) or the iSeq® 100 i1 Reagent v2 (300-cycles) with a final loading concentration of 8 pM. The pooled DNA libraries contained a 5% PhiX spike-in.
Reference samples were sequenced in six replicates (three sequencing runs, two replicates per run), while DNA extract mixtures were sequenced in nine replicates (three sequencing runs, three replicates per run). Commercial food products were sequenced in triplicates (three sequencing runs, one replicate per run) and food products were sequenced at least once by using either the MiSeq® or the iSeq® platform.

2.7. NGS Data Analysis Using Galaxy

After paired-end sequencing, the resulting FastQ files, generated by the instrument control software, were used as input for data analysis. The sequencing output in FastQ format was then processed with an analysis pipeline as described previously by using Galaxy (version 19.01) [47]. The published amplicon analysis workflow was modified as follows: the target-specific primers were trimmed from both ends using the tool Cutadapt and reads were not clustered into Operational Taxonomic Units (OTUs) [57]. Completely identical sequences were collapsed into a single representative sequence with the tool Dereplicate to minimize the number of reads, and then compared against a customized database for bivalves (Supplementary Table S2) using BLASTn [58].

3. Results and Discussion

3.1. Barcode Region and Primer Systems

We aimed to develop a DNA metabarcoding method allowing the differentiation between species belonging to the bivalve families Pectinidae, Ostreidae, and Mytilidae. To be applicable in routine analysis, the method should allow identifying the economically most important bivalve species in raw and highly processed food products.
We started with searching for appropriate DNA barcode regions of about 150 bp in length, containing conserved parts at the ends and a variable part in between. Potential DNA barcode regions were found in the mitochondrial DNA, especially the mitochondrial 16S rDNA. Several metabarcoding studies have shown that the sequences of the 16S rDNA gene are suitable as barcodes for species identification. Since we have already used a barcode region of the mitochondrial 16S rDNA to identify mammals and poultry [47], this marker gene was chosen as the DNA barcode for our assay.
Since the DNA metabarcoding method for bivalves should be compatible with the DNA metabarcoding method for mammalian and poultry species published recently [47], the primers should anneal at the same temperature (62 °C). In addition, the PCR cycle number should be limited to 25 and DNA libraries should be sequenced with Illumina reagent kits in the 300-cycle format. Due to high sequence variability between closely related bivalve species, none of the primer sets designed enabled obtaining a PCR product for each of the bivalve species of interest. Thus, we continued by designing three primer sets, one for each of the three bivalve families, Pectinidae, Ostreidae, and Mytilidae. Primer pairs consisting of one forward and one reverse primer allowed amplifying the DNA barcode region in scallop and oyster species (Table 2). However, in the case of mussels, a primer set consisting of one forward primer and two reverse primers (Table 2) was necessary to obtain a PCR product for the mussel species listed in Table 1. Figure 1 shows an alignment of selected DNA barcode sequences for the commercially most relevant bivalve species. The alignment of the 90 bivalve species is shown in Supplementary Figure S1. Blue, green, and red bars indicate the binding sites of the primers for Pectinidae, Ostreidae and Mytilidae, respectively. With the three primer sets, PCR products differing in at least one base should be obtained for all bivalve species of interest.
Further sequence alignments indicated that the DNA barcode region selected does not allow distinguishing between all species of the following genera: Chlamys spp., Euvola spp., Pecten spp., Crassostrea spp., Magallana spp., Ostrea spp. and Saccostrea spp. These species cannot be distinguished: Chlamys rubida and Chlamys behringiana; Pecten albicans, Pecten fumatus, Pecten jacobaeus, Pecten keppelianus, Pecten novaezelandiae, Pecten sulcicostatus, Crassostrea hongkongensis, and Crassostrea rivularis; Ostrea angelica and Ostrea lurida; as well as Ostrea permollis and Ostrea puelchana; and Saccostrea echinata, Saccostrea glomerata, and Saccostrea mytiloides. In addition, two mussel species, Mytilus platensis and Mytilus chilensis, can also not be distinguished (for Mytilus platensis only one DNA sequence entry was in the public databases provided by NCBI). However, differentiation at the genus level (Chlamys spp., Pecten spp., Crassostrea spp., Ostrea spp., Mytilus spp.) is sufficient according to the “Codex Alimentarius Austriacus” chapter B35 [56].
When we tested the primers in singleplex PCR assays, for each of the reference samples a PCR product of about 150 bp in length was obtained by increasing the concentration of the forward primer for mussels to 0.4 µM and keeping the concentration of the other six primers at 0.2 µM. In addition, we tested whether the seven primers could be combined to a triplex system. PCR products for the bivalve species of interest were obtained in one and the same vial by increasing the MgCl2 concentration to a final concentration of 3 mM. Thus, we achieved our objective to perform the triplex PCR assay in combination with the previously published DNA metabarcoding assay for mammalian and poultry species [47].

3.2. Library Preparation, Pooling of Libraries, and Sequencing

Library preparation, pooling of 5 or 7 µL per normalized DNA library, and the sequencing process were performed as described previously [47]. However, in case of the pooling process, all DNA libraries were mixed in equal volumes as recommended by the manufacturer’s instruction. In our previous study, different volumes from individual DNA libraries were taken to achieve sufficient sequencing depth for minor components. For sample pooling to the maximum of 96 libraries, more than 100,000 NGS reads per sample were expected to be obtained using the 300-cycle MiSeq® Reagent Kit v2.
Sequencing runs were performed in triplicate and the average run metrics were as follows: cluster density (969 K/mm2) on the flow cell, cluster passing filter (70.22%) as well as the Q-scores (Q30) for read 1 and read 2 were 92.6% and 89.28%, respectively. A total of 5.02% of the total reads were identified as PhiX control sequences with an error rate of 1.49%.

3.3. Analysis of DNA Extracts from Reference Samples

PCR products were obtained for each of the reference samples and sequencing results for those samples are summarized in Table 3. The table shows mean values of the total number of raw reads, the total number of reads that passed the analysis pipeline in Galaxy as well as the total number and percentage of reads that were assigned correctly to the eleven species (based on six replicates).
No significant differences were observed in the total number of reads (before data analysis process) between these species, except Mytilus galloprovincialis (162843), Perna canaliculus (169631), and Mytilus edulis (134500). With the exception of Perna canaliculus, >70% of the reads passed the amplicon analysis workflow. All three mussel species, six scallop species and two oyster species could be identified with this workflow at a high rate (>97.5%), except Mytilus edulis.

3.4. Analysis of DNA Extract Mixtures

Six ternary DNA extract mixtures were analyzed containing the DNA of the three bivalve families Pectinidae, Ostreidae, and Mytilidae in ratios of 98.0:1.5:0.5 (v/v/v). The composition of the DNA extract mixtures and the results obtained by DNA metabarcoding are summarized in Table 4. The total number of raw reads ranged from 80856 to 159,737 and the reads that passed the workflow were in the range from 65961 to 147196. For the main components (98.0%), the number of reads assigned correctly ranged from 62434 to 140147. In addition, both minor components (1.5% and 0.5%) could be identified. The number of reads assigned correctly was in the range from 1710 to 4356 and 555 to 1478, respectively.
In addition, we analyzed three DNA extract mixtures consisting of DNA from species belonging to one bivalve family (Table 5). The mixtures contained DNA from a scallop or mussel species, respectively. DNA from other bivalve species was present in a proportion of 1.0% each. Both species being present as main components, Placopecten magellanicus and Perna canaliculus, could be identified, with the number of reads assigned correctly ranging from 58156 to 77483. However, quite different numbers of reads were correctly assigned to the minor components, ranging from 626 (Mizuhopecten yessoensis) to 50,391 (Mytilus galloprovincialis). Aequipecten opercularis was the only minor component that could not be detected.
We analyzed a further DNA extract mixture containing DNA from the squid species Sepiella inermis as main component (97.0%) and DNA from the bivalve species Placopecten magellanicus, Ostrea edulis, and Perna canaliculus as minor components (1.0% each). As expected, in this mixture, the main component could not be detected because the primers are not suitable for amplification of the target region for Sepiella inermis. 31424, 28162, and 806 reads, respectively, were assigned correctly to the three bivalve species.
In our previous metabarcoding study [47], individual DNA libraries were pooled in different ratios to achieve sufficient sequencing depth for minor components. The present study demonstrates, that minor components down to a proportion of 0.5% could be identified and differentiated although DNA libraries were pooled by mixing them in equal volumes. DNA extracts from reference samples and DNA extract mixtures most frequently resulted in less than 100,000 reads. However, for all samples on average > 75000 raw reads were obtained, which turned out to be sufficient for reliable species identification.

3.5. Analysis of Commercial Seafood Samples

In order to investigate the applicability of the DNA metabarcoding method to foodstuffs, DNA extracts from 75 commercial food products were analyzed. According to declaration, eight samples (O1 and O4–O10) contained oyster species, 27 samples (M11, M14–M26, and M28–M40) mussel species, 15 samples (S41, S43–45, S48, S51–S55, and S56–S61) scallop species and 25 samples (Mi62–Mi86) were mixed-species seafood products (Table 6). The ingredient list of 30 out of 75 food products did not give any information on the bivalve species. A total of 39 samples were declared to contain “Crassostrea gigas”, “Mytilus galloprovincialis”, “Mytilus chilensis”, “Mytilus edulis”, “Zygochlamys patagonica”, “Chlamys opercularis”, “Placopecten magellanicus”, “Pecten maximus”, or “Patinopecten yessoensis”. The remaining samples (n = 6) were labelled with “Mytilus spp.” or “Pecten spp.”.
Our results indicate that DNA metabarcoding by targeting the 16S rDNA barcode region of about 150 bp in length is applicable to complex and highly processed foodstuffs. The barcode region could be amplified and sequenced even in products such as Bouillabaisse, Paella, and instant noodle seafood. Oyster sauce was the only sample matrix for which PCR amplification and consequently sequencing failed. Failure of obtaining PCR products for oyster sauce has already been reported by Chin Chin et al. [50], most probably caused by excessive DNA fragmentation due to industrial processing.
Three oyster species (Saccostrea malabonensis, Magallana bilineata, Magallana gigas), three mussel species (Mytilus galloprovincialis, Mytilus edulis, Perna canaliculus), and three scallop species (Aequipecten opercularis, Placopecten magellanicus, Pecten spp.) were detected in food products (O4, O8, M17, M19, M23, M25, M26, M28, M31, M32, M35, M38–M40, S51, S56, S58–S60, Mi63, Mi65, Mi70, Mi71, Mi73–Mi76, Mi81, Mi83, Mi85, and Mi86) although they were not declared on the label.
In each of the six oyster products that could be subjected to sequencing (O1, O4–O8), Magallana gigas was identified. Magallana gigas is by far the predominant oyster species farmed in the EU [59].
In 21 products (M11, M16, M18, M21, M24, M33–M35, M37, M39, M40, Mi62, Mi64, Mi66, Mi69, Mi72, Mi77–Mi80, and Mi84), the mussel species Mytilus galloprovincialis was detected. In addition to Mytilus galloprovincialis, Mytilus edulis was identified (percentage of reads assigned correctly >1%) in 13 products (M24, M33, M34, M39, Mi62, Mi64, Mi66, Mi69, Mi72, Mi78–Mi80, and Mi84). In four products, Mytilus edulis could not be detected although it was declared on the label. Mytilus galloprovincialis and Mytilus edulis are the two mussel species most frequently cultivated in European mussel farms [59]. In none of the products declared to contain Mytilus chilensis, Mytilus chilensis was detected. Instead of Mytilus chilensis, imported to EU countries from Chile [60], Mytilus galloprovincialis and/or Mytilus edulis were identified. According to the multi-species sequence alignment shown in Figure 1, the barcode region should allow distinguishing the three Mytilus species.
Placopecten magellanicus and Patinopecten yessoensis were listed as ingredients in samples S41, S45, S54, and S57 and samples S48, S52, and S61, respectively. Our results confirmed the presence of these two species, except for sample S57. In sample S43, declared to contain Pecten maximus, the species Mizuhopecten yessoensis was detected. In sample S44 and S53, declared as Pecten spp., the species Mizuhopecten yessoensis was also identified. In line with previous studies, most products declared to contain “Jakobsmuschel” did not contain a species of the genus Pecten [15,18,19]. Instead, we identified Placopecten magellanicus or Mizuhopecten yessoensis.

4. Conclusions

The DNA metabarcoding method developed in this study allows the detection of species of Mytilidae (mussels), Pectinidae (scallops), and Ostreidae (oysters), the most important bivalve families for human consumption. By combining three forward and four reverse primers in a triplex PCR assay, the barcode region, a fragment of mitochondrial 16S rDNA, could be amplified in the species of interest.
The applicability of the novel DNA metabarcoding method was investigated by analyzing individual DNA extracts from eleven reference samples, ten DNA extract mixtures and DNA extracts from 75 commercial food products. In each of the eleven reference samples, the bivalve species was identified correctly. In DNA extract mixtures, not only the main component but also the minor components were detected correctly, with just a few exceptions. The analysis of commercial seafood products showed that the DNA metabarcoding method is applicable to complex and processed foodstuffs, allowing the identification of bivalves in, e.g., marinated form, in sauces, in seafood mixes and even in instant noodle seafood.
The DNA metabarcoding method runs on both the MiSeq® and iSeq® instrument of Illumina. Due to the compatibility of PCR and sequencing parameters, the DNA metabarcoding method can be combined with a DNA metabarcoding method for mammalian and poultry species published recently.

5. Patent

This manuscript has been submitted for grant of a European patent (application number: EP21204456.4).

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/foods10112618/s1, Supplementary Table S1: Declaration, origin and processing condition of the 86 food products, Supplementary Table S2: Sequences included into the reverence database, Supplementary Figure S1: Multi-species sequence alignment of the mitochondrial 16S rDNA barcoding region for the bivalve species of interest.

Author Contributions

Conceptualization, R.H. and S.D.; methodology, K.G., M.C.-M., M.W., R.H., S.D. and V.P.; software, S.D.; formal analysis, K.G. and S.D.; investigation, K.G. and S.D.; resources, K.G.; data curation, K.G. and S.D.; writing—original draft preparation, K.G.; writing—review and editing, A.L., M.C.-M., M.W., R.H., S.D. and V.P.; visualization, K.G.; supervision, M.C.-M., M.W., R.H., S.D. and V.P.; project administration, R.H. and S.D.; funding acquisition, A.L. and V.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded within a research project of the Austrian Competence Centre for Feed and Food Quality, Safety and Innovation (FFoQSI GmbH). The COMET-K1 competence centre FFoQSI is funded by the Austrian ministries BMK, BMDW and the Austrian provinces Lower Austria, Upper Austria and Vienna within the scope of COMET-Competence Centers for Excellent Technologies. The programme COMET is handled by the Austrian Research Promotion Agency FFG.

Data Availability Statement

The datasets generated for this study are available on request to the corresponding author.

Acknowledgments

This research was supported by the Austrian Agency for Health and Food Safety (AGES), Institute for Food Safety Vienna, Department for Molecular Biology and Microbiology and by LVA GmbH in cooperation with the University of Vienna and the University of Veterinary Medicine Vienna.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Telahigue, K.; Chetoui, I.; Rabeh, I.; Romdhane, M.S.; El Cafsi, M. Comparative fatty acid profiles in edible parts of wild scallops from the Tunisian coast. Food Chem. 2010, 122, 744–746. [Google Scholar] [CrossRef] [Scilit]
  2. Tan, K.; Ma, H.; Li, S.; Zheng, H. Bivalves as future source of sustainable natural omega-3 polyunsaturated fatty acids. Food Chem. 2020, 311, 125907. [Google Scholar] [CrossRef] [Scilit]
  3. Manthey-Karl, M.; Lehmann, I.; Ostermeyer, U.; Rehbein, H.; Schröder, U. Meat Composition and Quality Assessment of King Scallops (Pecten maximus) and Frozen Atlantic Sea Scallops (Placopecten magellanicus) on a Retail Level. Foods 2015, 4, 524–546. [Google Scholar] [CrossRef] [Scilit]
  4. Grienke, U.; Silke, J.; Tasdemir, D. Bioactive compounds from marine mussels and their effects on human health. Food Chem. 2014, 142, 48–60. [Google Scholar] [CrossRef] [Scilit]
  5. Willer, D.F.; Aldridge, D.C. Sustainable bivalve farming can deliver food security in the tropics. Nat. Food 2020, 1, 384–388. [Google Scholar] [CrossRef] [Scilit]
  6. World Register of Marine Species. Available online: http://www.marinespecies.org/index.php (accessed on 12 December 2020).
  7. Food and Agricultural Organization of the United Nations (FAO). Fishery and Aquaculture Statistics. In Global Aquaculture Production. Software for Fishery Statistical Time Series. Version FishStatJ v4.01.4. Available online: www.fao.org/fishery/statistics/software/fishstatj/en (accessed on 10 June 2021).
  8. European Parliament and of the Council. Regulation (EU) No. 1379/2013 of the European Parliament and of the Council of on the common organisation of the markets in fishery and aquaculture products, amending Council Regulations (EC) No 1184/2006 and (EC) No 1224/2009 and repealing Council Regulation (EC) No 104/2000. Off. J. Eur. Union 2013, L 354, 1–21. [Google Scholar]
  9. European Parliament and of the Council. Regulation (EU) No 1169/2011 of the European Parliament and of the Council of 25 October 2011 on the provision of food information to consumers, amending Regulations (EC) No 1924/2006 and (EC) No 1925/2006 of the European Parliament and of the Council, and repealing Commission Directive 87/250/EEC, Council Directive 90/496/EEC, Commission Directive 1999/10/EC, Directive 2000/13/EC of the European Parliament and of the Council, Commission Directives 2002/67/EC and 2008/5/EC and Commission Regulation (EC) No 608/2004. Off. J. Eur. Union 2011, L 30, 18–63. [Google Scholar]
  10. Oceana; Protectin the World´s Oceans. Available online: https://oceana.org/publications/reports/one-name-one-fish-why-seafood-names-matter (accessed on 30 April 2021).
  11. Rodríguez, E.M.; Ortea, I. Food authentication of seafood species. In Proteomics in Food Science: From Farm to Fork, 3rd ed.; Colgrave, M.L., Ed.; Academic Press: London, UK, 2017; pp. 331–342. ISBN 9780128040072. [Google Scholar]
  12. Parrondo, M.; López, S.; Aparicio-Valencia, A.; Fueyo, A.; Quintanilla-García, P.; Arias, A.; Borrell, Y.J. Almost never you get what you pay for: Widespread mislabeling of commercial “zamburiñas” in northern Spain. Food Control 2021, 120, 107541. [Google Scholar] [CrossRef] [Scilit]
  13. Giusti, A.; Tosi, F.; Tinacci, L.; Guardone, L.; Corti, I.; Arcangeli, G.; Armani, A. Mussels (Mytilus spp.) products authentication: A case study on the Italian market confirms issues in species identification and arises concern on commercial names attribution. Food Control 2020, 118, 107379. [Google Scholar] [CrossRef] [Scilit]
  14. Harris, D.J.; Rosado, D.; Xavier, R. DNA Barcoding Reveals Extensive Mislabeling in Seafood Sold in Portuguese Supermarkets. J. Aquat. Food Prod. Technol. 2016, 25, 1375–1380. [Google Scholar] [CrossRef] [Scilit]
  15. Näumann, G.; Stumme, B.; Rehbein, H. Differenzierung von Kammmuscheln durch DNA-Analyse. Inf. Aus Der Fischereiforschung-Inf. Fish. Res. 2012, 59, 1–7. [Google Scholar] [CrossRef] [Scilit]
  16. Espiñeira, M.; González-Lavín, N.; Vieites, J.M.; Santaclara, F.J. Development of a method for the genetic identification of commercial bivalve species based on mitochondrial 18S rRNA sequences. J. Agric. Food Chem. 2009, 57, 495–502. [Google Scholar] [CrossRef] [Scilit]
  17. Guardone, L.; Tinacci, L.; Costanzo, F.; Azzarelli, D.; D’Amico, P.; Tasselli, G.; Magni, A.; Guidi, A.; Nucera, D.; Armani, A. DNA barcoding as a tool for detecting mislabeling of fishery products imported from third countries: An official survey conducted at the Border Inspection Post of Livorno-Pisa (Italy). Food Control 2017, 80, 204–216. [Google Scholar] [CrossRef] [Scilit]
  18. Klapper, R.; Schröder, U. Verification of authenticity: A rapid identification method for commercial scallop species through multiplex real-time PCR. Food Control 2021, 121, 107574. [Google Scholar] [CrossRef] [Scilit]
  19. Stephan, R.; Johler, S.; Oesterle, N.; Näumann, G.; Vogel, G.; Pflüger, V. Rapid and reliable species identification of scallops by MALDI-TOF mass spectrometry. Food Control 2014, 46, 6–9. [Google Scholar] [CrossRef] [Scilit]
  20. Fernández, A.; García, T.; Asensio, L.; Rodríguez, M.Á.; González, I.; Céspedes, A.; Hernández, P.E.; Martín, R. Identification of the clam species Ruditapes decussatus (Grooved carpet shell), Venerupis pullastra (Pullet carpet shell), and Ruditapes philippinarum (Japanese carpet shell) by PCR-RFLP. J. Agric. Food Chem. 2000, 48, 3336–3341. [Google Scholar] [CrossRef] [Scilit]
  21. Galimberti, A.; de Mattia, F.; Losa, A.; Bruni, I.; Federici, S.; Casiraghi, M.; Martellos, S.; Labra, M. DNA barcoding as a new tool for food traceability. Food Res. Int. 2013, 50, 55–63. [Google Scholar] [CrossRef] [Scilit]
  22. Littlefair, J.E.; Clare, E.L. Barcoding the food chain: From Sanger to high-throughput sequencing. Genome 2016, 59, 946–958. [Google Scholar] [CrossRef] [Scilit]
  23. Böhme, K.; Calo-Mata, P.; Barros-Velázquez, J.; Ortea, I. Review of Recent DNA-Based Methods for Main Food-Authentication Topics. J. Agric. Food Chem. 2019, 67, 3854–3864. [Google Scholar] [CrossRef] [Scilit]
  24. Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; deWaard, J.R. Biological identifications through DNA barcodes. Proc. Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef] [Scilit]
  25. Teletchea, F.; Maudet, C.; Hänni, C. Food and forensic molecular identification: Update and challenges. Trends Biotechnol. 2005, 23, 359–366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Staats, M.; Arulandhu, A.J.; Gravendeel, B.; Holst-Jensen, A.; Scholtens, I.; Peelen, T.; Prins, T.W.; Kok, E. Advances in DNA metabarcoding for food and wildlife forensic species identification. Anal. Bioanal. Chem. 2016, 408, 4615–4630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Pollack, S.J.; Kawalek, M.D.; Williams-Hill, D.M.; Hellberg, R.S. Evaluation of DNA barcoding methodologies for the identification of fish species in cooked products. Food Control 2018, 84, 297–304. [Google Scholar] [CrossRef] [Scilit]
  28. Armani, A.; Tinacci, L.; Lorenzetti, R.; Benvenuti, A.; Susini, F.; Gasperetti, L.; Ricci, E.; Guarducci, M.; Guidi, A. Is raw better? A multiple DNA barcoding approach (full and mini) based on mitochondrial and nuclear markers reveals low rates of misdescription in sushi products sold on the Italian market. Food Control 2017, 79, 126–133. [Google Scholar] [CrossRef] [Scilit]
  29. Feng, Y.; Li, Q.; Kong, L.; Zheng, X. DNA barcoding and phylogenetic analysis of Pectinidae (Mollusca: Bivalvia) based on mitochondrial COI and 16S rRNA genes. Mol. Biol. Rep. 2011, 38, 291–299. [Google Scholar] [CrossRef] [Scilit]
  30. Saavedra, C.; Peña, J.B. Phylogenetics of American scallops (Bivalvia: Pectinidae) based on partial 16S and 12S ribosomal RNA gene sequences. Mar. Biol. 2006, 150, 111–119. [Google Scholar] [CrossRef] [Scilit]
  31. Fernandez, A.; García, T.; Gonzalez, I.; Asensio, L.; Rodriguez, M.Á.; Hernández, P.E.; Martin, R. Polymerase chain reaction-restriction fragment length polymorphism analysis of a 16S rRNA gene fragment for authentication of four clam species. J. Food Prot. 2002, 65, 692–695. [Google Scholar] [CrossRef] [Scilit]
  32. Bendezu, I.F.; Slater, J.W.; Carney, B.F. Identification of Mytilus spp. and Pecten maximus in Irish waters by standard PCR of the 18S rDNA gene and multiplex PCR of the 16S rDNA gene. Mar. Biotechnol. (NY) 2005, 7, 687–696. [Google Scholar] [CrossRef] [Scilit]
  33. Colombo, F.; Trezzi, I.; Bernardi, C.; Cantoni, C.; Renon, P. A case of identification of pectinid scallop (Pecten jacobaeus, Pecten maximus) in a frozen and seasoned food product with PCR technique. Food Control 2004, 15, 527–529. [Google Scholar] [CrossRef] [Scilit]
  34. Fernandes, T.J.R.; Amaral, J.S.; Mafra, I. DNA barcode markers applied to seafood authentication: An updated review. Crit. Rev. Food Sci. Nutr. 2020, 61, 1–32. [Google Scholar] [CrossRef] [Scilit]
  35. Mafra, I.; Ferreira, I.M.P.L.V.O.; Oliveira, M.B.P.P. Food authentication by PCR-based methods. Eur. Food Res. Technol. 2008, 227, 649–665. [Google Scholar] [CrossRef] [Scilit]
  36. Marín, A.; Fujimoto, T.; Arai, K. Rapid species identification of fresh and processed scallops by multiplex PCR. Food Control 2013, 32, 472–476. [Google Scholar] [CrossRef] [Scilit]
  37. Marshall, H.D.; Johnstone, K.A.; Carr, S.M. Species-specific oligonucleotides and multiplex PCR for forensic discrimination of two species of scallops, Placopecten magellanicus and Chlamys islandica. Forensic Sci. Int. 2007, 167, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Zhan, A.; Hu, J.; Hu, X.; Lu, W.; Wang, M.; Peng, W.; Hui, M.; Bao, Z. Fast identification of scallop adductor muscles using species-specific microsatellite markers. Eur. Food Res. Technol. 2008, 227, 353–359. [Google Scholar] [CrossRef] [Scilit]
  39. Meistertzheim, A.-L.; Héritier, L.; Lejart, M. High-Resolution Melting of 18S rDNA sequences (18S-HRM) for discrimination of bivalve’s species at early juvenile stage: Application to a spat survey. Mar. Biol. 2017, 164, 133–141. [Google Scholar] [CrossRef] [Scilit]
  40. Pereira, A.M.; Fernández-Tajes, J.; Gaspar, M.B.; Méndez, J. Identification of the wedge clam Donax trunculus by a simple PCR technique. Food Control 2012, 23, 268–270. [Google Scholar] [CrossRef] [Scilit]
  41. Jilberto, F.; Araneda, C.; Larraín, M.A. High resolution melting analysis for identification of commercially-important Mytilus species. Food Chem. 2017, 229, 716–720. [Google Scholar] [CrossRef] [Scilit]
  42. Rego, I.; Martínez, A.; González-Tizón, A.; Vieites, J.; Leira, F.; Méndez, J. PCR technique for identification of mussel species. J. Agric. Food Chem. 2002, 50, 1780–1784. [Google Scholar] [CrossRef] [Scilit]
  43. Jin, Y.; Li, Q.; Kong, L.; Yu, H.; Zhong, X. High-resolution melting (HRM) analysis: A highly sensitive alternative for the identification of commercially important Crassostrea oysters. J. Molluscan Stud. 2015, 81, 167–170. [Google Scholar] [CrossRef] [Scilit]
  44. Hellberg, R.S.; Pollack, S.J.; Hanner, R.H. Seafood species identification using DNA sequencing. In Seafood Authenticity and Traceability; Academic Press: London, UK, 2016; ISBN 9780128015926. [Google Scholar]
  45. Galimberti, A.; Casiraghi, M.; Bruni, I.; Guzzetti, L.; Cortis, P.; Berterame, N.M.; Labra, M. From DNA barcoding to personalized nutrition: The evolution of food traceability. Curr. Opin. Food Sci. 2019, 28, 41–48. [Google Scholar] [CrossRef] [Scilit]
  46. Günther, B.; Raupach, M.J.; Knebelsberger, T. Full-length and mini-length DNA barcoding for the identification of seafood commercially traded in Germany. Food Control 2017, 73, 922–929. [Google Scholar] [CrossRef] [Scilit]
  47. Dobrovolny, S.; Blaschitz, M.; Weinmaier, T.; Pechatschek, J.; Cichna-Markl, M.; Indra, A.; Hufnagl, P.; Hochegger, R. Development of a DNA metabarcoding method for the identification of fifteen mammalian and six poultry species in food. Food Chem. 2019, 272, 354–361. [Google Scholar] [CrossRef] [Scilit]
  48. Frigerio, J.; Agostinetto, G.; Sandionigi, A.; Mezzasalma, V.; Berterame, N.M.; Casiraghi, M.; Labra, M.; Galimberti, A. The hidden ‘plant side’ of insect novel foods: A DNA-based assessment. Food Res. Int. 2020, 128, 108751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Nicolè, S.; Negrisolo, E.; Eccher, G.; Mantovani, R.; Patarnello, T.; Erickson, D.L.; Kress, W.J.; Barcaccia, G. DNA Barcoding as a Reliable Method for the Authentication of Commercial Seafood Products. Food Technol. Biotechnol. 2012, 50(4), 387–398. [Google Scholar]
  50. Chin Chin, T.; Adibah, A.B.; Danial Hariz, Z.A.; Siti Azizah, M.N. Detection of mislabelled seafood products in Malaysia by DNA barcoding: Improving transparency in food market. Food Control 2016, 64, 247–256. [Google Scholar] [CrossRef] [Scilit]
  51. Giusti, A.; Armani, A.; Sotelo, C.G. Advances in the analysis of complex food matrices: Species identification in surimi-based products using Next Generation Sequencing technologies. PLoS ONE 2017, 12, e0185586. [Google Scholar] [CrossRef] [Scilit]
  52. Giusti, A.; Tinacci, L.; Sotelo, C.G.; Marchetti, M.; Guidi, A.; Zheng, W.; Armani, A. Seafood Identification in Multispecies Products: Assessment of 16SrRNA, cytb, and COI Universal Primers’ Efficiency as a Preliminary Analytical Step for Setting up Metabarcoding Next-Generation Sequencing Techniques. J. Agric. Food Chem. 2017, 65, 2902–2912. [Google Scholar] [CrossRef] [Scilit]
  53. Arulandhu, A.J.; Staats, M.; Hagelaar, R.; Voorhuijzen, M.M.; Prins, T.W.; Scholtens, I.; Costessi, A.; Duijsings, D.; Rechenmann, F.; Gaspar, F.B.; et al. Development and validation of a multi-locus DNA metabarcoding method to identify endangered species in complex samples. Gigascience 2017, 6, 1–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Carvalho, D.C.; Palhares, R.M.; Drummond, M.G.; Gadanho, M. Food metagenomics: Next generation sequencing identifies species mixtures and mislabeling within highly processed cod products. Food Control 2017, 80, 183–186. [Google Scholar] [CrossRef] [Scilit]
  55. Schirmer, M.; D’Amore, R.; Ijaz, U.Z.; Hall, N.; Quince, C. Illumina error profiles: Resolving fine-scale variation in metagenomic sequencing data. BMC Bioinform. 2016, 17, 125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Bundesministerium für Arbeit, Soziales, Gesundheit und Konsumentenschutz. Codexkapitel/B 35/Fische, Krebse, Weichtiere und dar-aus Hergestellte Erzeugnisse: BMGF-75210/0026-II/B/13/2017; Bundesministerium für Arbeit, Soziales, Gesundheit und Konsumentenschutz: Vienna, Austria, 2007. [Google Scholar]
  57. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10. [Google Scholar] [CrossRef] [Scilit]
  58. Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. European Commission. Directorate General for Maritime Affairs and Fisheries. In The EU Fish Market; Publications Office: Brussels, Belgium, 2019. [Google Scholar]
  60. Del Rio-Lavín, A.; Jiménez, E.; Pardo, M.Á. SYBR-Green real-time PCR assay with melting curve analysis for the rapid identification of Mytilus species in food samples. Food Control 2021, 130, 108257. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Multi-species sequence alignment of the mitochondrial 16S rDNA barcoding region for bivalve species. Colored bars indicate the binding sites of the primer sets for scallops (blue), oysters (green), and mussels (red, CLC Genomics Workbench software version 10.1.1, Qiagen, Hilden, Germany).
Figure 1. Multi-species sequence alignment of the mitochondrial 16S rDNA barcoding region for bivalve species. Colored bars indicate the binding sites of the primer sets for scallops (blue), oysters (green), and mussels (red, CLC Genomics Workbench software version 10.1.1, Qiagen, Hilden, Germany).
Foods 10 02618 g001
Table 1. Bivalve species used for development of the DNA metabarcoding method.
Table 1. Bivalve species used for development of the DNA metabarcoding method.
Scientific NameCommercial Name (German)Commercial Name (English)
MytilidaeMiesmuschelnMussels
Mytilus edulisGemeine MiesmuschelBlue mussel
Mytilus galloprovincialisMittelmeer-MiesmuschelMediterranean mussel
Perna canaliculusNeuseeland-MiesmuschelNew Zealand green-lipped mussel
PectinidaeKammmuschelnScallops
Placopecten magellanicusAtlantischer TiefseescallopAtlantic deep-sea scallop
Mizuhopecten yessoensisJapanische KammmuschelYesso scallop
Pecten jacobaeusJakobsmuschelGreat scallop
Zygochlamys patagonicaPatagonische KammmuschelPatagonian scallop
Argopecten purpuratusPurpur-KammmuschelPurple scallop
Aequipecten opercularisKleine PilgermuschelQueen scallop
OstreidaeAusternOysters
Magallana gigasPazifische FelsenausterPacific oyster
Ostrea edulisEuropäische AusterEuropean flat oyster
Table 2. Primers designed in this study.
Table 2. Primers designed in this study.
NameSequence 5′→3′
mussel
For_MuCCTTTTGCATAAGGGTTTTTCAAG
Rev1_MuCGAATAGTATCTAGCCGCCATTC
Rev2_MuGCAAATAGCATATCACTTTCACCTC
scallop
For_MuTGCTAAGGTAGCTAAATTATGGCC
Rev_MuCTTCACGGGGTCTTCTCGTC
oyster
For_MuGGTAGCGAAATTCCTTGCCTT
Rev_MuAAAGTTGCACGGGGTCTT
overhang
ForwardTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
ReverseGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
Table 3. Results for DNA extracts from reference samples. Numbers are mean values (n = 6, three sequencing runs, two replicates per run).
Table 3. Results for DNA extracts from reference samples. Numbers are mean values (n = 6, three sequencing runs, two replicates per run).
Sample IDDeclaration on the ProductSpecies
Identified
Total Number of Raw ReadsTotal NumberNumberPercentage
Scientific/Latin NameProduct Description [Eng]of Reads Passing the Workflowof Reads Assigned Correctlyof Reads Assigned Correctly (%)
O2Ostrea edulisOysterOstrea edulis78559634916187597.46
O3Crassostrea gigas *OysterMagallana gigas *76143653896412598.07
M12Mytilus
galloprovincialis
Blue MusselMytilus
galloprovincialis
16284315067814931599.09
M13Perna canaliculusNew Zealand green-lipped musselPerna canaliculus16963110486110335098.56
M27Mytilus edulisMussels in marinadeMytilus edulis13450012068610502487.02
S42Mizuhopecten yessoensisYesso scallopMizuhopecten yessoensis75927580695705898.26
S46Pecten jacobaeusGreat scallopPecten spp.79472614846051498.42
S47Zygochlamys patagonicaScallop “á la Bretonne”Zygochlamys
patagonica
77747592455842998.62
S49Placopecten magellanicusGreat scallopPlacopecten
magellanicus
79131615316088698.95
S50Argopecten purpuratusPacific scallopArgopecten
purpuratus
77383554555458898.44
S55Aequipecten opercularisScallop in sauceAequipecten
opercularis
79141560645580099.53
* former nomenclature, synonym for Magallana gigas.
Table 4. Results for ternary DNA extract mixtures representing the three bivalve families of interest. DNA extracts (5 ng/µL) were mixed in a ratio of 98.0:1.5:0.5 (v/v/v). Numbers are mean values (n = 9, three sequencing runs, three replicates per run).
Table 4. Results for ternary DNA extract mixtures representing the three bivalve families of interest. DNA extracts (5 ng/µL) were mixed in a ratio of 98.0:1.5:0.5 (v/v/v). Numbers are mean values (n = 9, three sequencing runs, three replicates per run).
Proportion Total Number
of Raw Reads
Total Number
of Reads
Passing the Workflow
Reads Assigned Correctly
Species 1 (98%)Species 2
(1.5%)
Species 3 (0.5%)Species 1(%)Species 2(%)Species 3(%)
Magallana
gigas
Mytilus
galloprovincialis
Pecten spp.80856695066643095.5719852.866580.95
Magallana
gigas
Pecten spp.Mytilus
galloprovincialis
89552766697311495.3621822.858941.17
Pecten spp.Magallana
gigas
Mytilus
galloprovincialis
88971696826629195.1317102.459221.32
Pecten spp.Mytilus
galloprovincialis
Magallana
gigas
84085659616243494.6522813.465550.84
Mytilus
galloprovincialis
Pecten spp.Magallana
gigas
15973714719614014795.2143562.9614781.00
Mytilus
galloprovincialis
Magallana
gigas
Pecten spp.14744313662913098695.8733042.4211560.85
Table 5. Results for DNA extract mixtures representing one bivalve family. DNA from minor components was present in a proportion of 1% each. In addition, results for a DNA extract mixture containing DNA from a squid species (Sepiella inermis) as main component (97.0%) and DNA from three bivalve species (1% each) is shown. Numbers are mean values (n = 9, three sequencing runs, three replicates per run).
Table 5. Results for DNA extract mixtures representing one bivalve family. DNA from minor components was present in a proportion of 1% each. In addition, results for a DNA extract mixture containing DNA from a squid species (Sepiella inermis) as main component (97.0%) and DNA from three bivalve species (1% each) is shown. Numbers are mean values (n = 9, three sequencing runs, three replicates per run).
Main ComponentMinor Component
(1.0% Each)
Total Number of Raw ReadsTotal Number of Reads Passed the WorkflowReads
Assigned Correctly
Percentage of Reads Assigned Correctly (%)
Placopecten magellanicus 83526 *654465815688.86
Mizuhopecten yessoensis6260.96
Pecten spp.8171.25
Zygochlamys patagonica45346.93
Argopecten purpuratus6631.01
Aequipecten opercularis350.05
Placopecten magellanicus 84282 *666916362895.41
Magallana gigas12981.95
Ostrea edulis10881.63
Perna canaliculus 179227 *1288827748360.12
Mytilus galloprovincialis5039139.10
Mytilus edulis8240.64
Sepiella inermis 7846761415
Placopecten magellanicus3142451.17
Ostrea edulis2816245.86
Perna canaliculus8061.31
* Number of values (n = 6, three sequencing runs, two replicates per run).
Table 6. Results obtained for commercial seafood samples. Samples listed above the double line were sequenced with the MiSeq® (three sequencing runs, one replicate per run, numbers are mean values); samples listed below the double line were sequenced either with the MiSeq® or the iSeq®.
Table 6. Results obtained for commercial seafood samples. Samples listed above the double line were sequenced with the MiSeq® (three sequencing runs, one replicate per run, numbers are mean values); samples listed below the double line were sequenced either with the MiSeq® or the iSeq®.
Sample IDDeclaration on the ProductSpecies IdentifiedTotal Number of Raw ReadsTotal Number of Reads Passed the WorkflowReads Assigned CorrectlyPercentage of Reads Assigned Correctly (%)
Scientific/Latin NameProduct
Description [Eng]
O5Crassostrea gigas4Oyster in
sunflower oil
Magallana gigas476930 1657286436997.93
O6Crassostrea gigas4Oyster in
sunflower oil
Magallana gigas444848 1385473761097.57
O7Crassostrea gigas4Oyster in waterMagallana gigas476247649176370098.13
O8not declaredOyster sauceSaccostrea malabonensis1447011658544246.68
Magallana bilineata465239.91
M23not declaredMussel with
sherry vinegar
Mytilus galloprovincialis33517307943035898.58
M25not declaredMussel in
marinade sauce
Mytilus galloprovincialis16318815168815070099.35
M26not declaredGrilled blue
mussel
Mytilus galloprovincialis16310615160815043399.23
M29Mytilus galloprovincialisBlue mussel inMytilus galloprovincialis15343514047513235494.22
tomato sauceMytilus edulis79375.65
M30Mytilus galloprovincialisBlue musselMytilus galloprovincialis18547917189017062499.26
A la mariniereMytilus edulis11560.67
M31not declaredBlue mussel inMytilus galloprovincialis17030315837915701599.14
organic marinadeMytilus edulis12670.80
M32not declaredMarinated blueMytilus galloprovincialis15918114478814339999.04
musselMytilus edulis13080.90
M33Mytilus chilensisMussel inMytilus galloprovincialis16790315121911887978.61
EscabecheMytilus edulis3173720.99
M34Mytilus chilensisMusselMytilus galloprovincialis1521121387688796463.39
Mytilus edulis4960135.74
M36Mytilus galloprovincialisBlue mussel
marinated
Mytilus galloprovincialis
Mytilus edulis
17696316372116222499.09
13230.81
M37Mytilus edulisMussel in honey
mustard sauce
Mytilus galloprovincialis
Mytilus edulis
14936413686813524998.82
14001.02
M38not declaredBlue musselMytilus galloprovincialis13880112724412598099.01
in marinadeMytilus edulis10560.83
S58not declaredRillettes deAequipecten opercularis62787443074271696.41
Saint-JacquesMytilus galloprovincialis13303.00
S59not declaredSmall scallop in
galician sauce
Aequipecten opercularis82550597225829697.61
Mi62Mytilus chilensisSeafood mixMytilus galloprovincialis61832456981543343976.07
Mytilus edulis13454323.61
Mi63not declaredSauce withMytilus edulis1521701393067355052.80
seafoodMytilus galloprovincialis6472946.47
Mi64Mytilus chilensis
Mytilus edulis
Seafood mixMytilus galloprovincialis
Mytilus edulis
1312851193508159068.36
3721131.18
Mi65not declaredBouillabaisse
Marseille
Mytilus galloprovincialisMytilus edulis15731114347913853596.55
47773.33
Mi66Mytilus chilensisSeafood mixMytilus galloprovincialis1525351400479202465.71
Mytilus edulis4741533.86
Mi67Mytilus spp.Seafood mixMytilus galloprovincialis76544690814827569.88
Mytilus edulis2045929.62
Mi68Mytilus galloprovincialisSea fruit salad in
sunflower oil
Mytilus galloprovincialis
Mytilus edulis
15786114567114446899.17
10460.72
Mi69Mytilus chilensisSeafood mixMytilus galloprovincialis
Mytilus edulis
1402271280078567966.93
4168632.57
Mi70not declaredSea fruit salad
fantasy
Mytilus galloprovincialis
Mytilus edulis
12067710667410112194.80
54135.07
Mi71not declaredSeafood mixMytilus galloprovincialis1605461472787968054.10
Mytilus edulis6667545.27
Mi72Mytilus chilensisSeafood mixMytilus galloprovincialis1600591465399155762.48
Mytilus edulis5427137.03
Mi73not declaredSeafood mixMytilus edulis1505001376347894257.36
Mytilus galloprovincialis5760841.86
Mi74not declaredSeafood mixMytilus galloprovincialis1688411557017903550.76
Mytilus edulis7561248.56
Mi75not declaredPizza Frutti diMytilus galloprovincialis181822 11726209518455.14
mareMytilus edulis7144041.39
Mi76not declaredPaellaMytilus galloprovincialis15043113951113833599.16
Mytilus edulis10700.77
Mi77Mytilus edulis,PaellaMytilus galloprovincialis14181613209213076899.00
Mytilus chilensisMytilus edulis12420.94
Mi78Mytilus chilensisSeafood all’OlioMytilus galloprovincialis1347171229067348259.79
Mytilus edulis4877439.68
Mi79Mytilus chilensisSeafood mixMytilus galloprovincialis1487731371227303553.26
Mytilus edulis6324946.13
Mi80Mytilus chilensisSeafood mixMytilus galloprovincialis1366951266088813069.61
Mytilus edulis3797029.99
Mi81not declaredSea fruit saladMytilus galloprovincialis15349914273614157899.19
Mytilus edulis10220.72
Mi82Zygochlamys patagonica
Chlamys opercularis
Scallop terrineZygochlamys patagonica76554591815732996.87
Mi83not declaredTerrine of salmon
and great scallop
Pecten spp.96596 1768347547698,23
Mi84Mytilus chilensisSeafood mixMytilus galloprovincialis16388515085212446882.51
Mytilus edulis2591617.18
Mi85not declaredInstant noodle
seafood, mild
Mytilus galloprovincialis15409141181375097.39
Mi86not declaredInstant noodle
seafood, spicy
Mytilus galloprovincialis97878892847395.29
O1Crassostrea gigas4OysterMagallana gigas4139319 213407313349399.57
O4not declaredOysterMagallana gigas46089 2409914027998.26
O9not declaredOyster sauce not evaluable 3
O10not declaredOyster sauce not evaluable 3
M11Mytilus edulisMusselMytilus galloprovincialis23766 2225462214798.23
M14Mytilus spp.Blue musselMytilus galloprovincialis126880 21197177952266.42
Mytilus edulis3955533.04
M15Mytilus sppBlue musselMytilus galloprovincialis22767822069922022699.79
M16Mytilus edulisBouchot musselMytilus galloprovincialis51292 2496044883298.44
M17not declaredGrilled blueMytilus galloprovincialis9888 26750395658.61
musselMytilus edulis199829.60
M18Mytilus chilensisBlue musselMytilus galloprovincialis53710 2516705073398.19
M19not declaredBlue musselMytilus galloprovincialis57238 2548225382998.19
M20Mytilus spp.Blue musselMytilus galloprovincialis72113 2695766896999.13
M21Mytilus edulisMusselMytilus galloprovincialis51328 2499084945999.10
M22Mytilus galloprovincialisBlue musselMytilus galloprovincialis115950211077710926298.63
Mytilus edulis14661.32
M24Mytilus chilensisBlue mussel inMytilus galloprovincialis113942 21071509444988.15
tomato sauceMytilus edulis1250511.67
M28not declaredDry cat foodPecten spp.128693 31263807976463.11
with greenMytilus galloprovincialis4045032.01
lipped musselPerna canaliculus47123.73
M35Mytilus chilensisMussel in
tomato sauce
Mytilus galloprovincialis197899 319077118954099.35
M39Mytilus chilensisBlue musselMytilus galloprovincialis182612 31759829650254.84
Mytilus edulis7520442.73
M40Mytilus edulisBlue musselMytilus galloprovincialis182958 317939917802499.23
S41Placopecten magellanicusDeep-sea scallopPlacopecten magellanicus143794 213214013158399.58
S43Pecten maximusGreat scallopMizuhopecten yessoensis122156 211370611312899.49
S44Pecten spp.Great scallopMizuhopecten yessoensis2873135 22718126271742699.97
S45Placopecten magellanicusDeep-sea scallopPlacopecten magellanicus111673 210711910663299.55
S48Patinopecten yessoensisGreat scallop/
Yesso scallop
Mizuhopecten yessoensis47397 24107640787399.51
S51not declaredGreat scallopPlacopecten magellanicus51565 2450074491599.80
S52Patinopecten yessoensisGreat scallopMizuhopecten yessoensis46673 2397693962799.64
S53Pecten spp.Great scallopMizuhopecten yessoensis42857 2364433526596.77
S54Placopecten magellanicusGreat scallopPlacopecten magellanicus55475 2487034791598.38
S56not declaredGreat scallopPlacopecten magellanicus1268169 31061137106065399.95
S57Placopecten magellanicusGreat scallopPecten spp.174497 317129917040499.48
S60not declaredDeep-sea scallopPlacopecten magellanicus364474 335095335086999.98
S61Patinopecten yessoensisGreat scallopMizuhopecten yessoensis159145 315293015284999.95
1 Mean of two replicates; 2 samples were analyzed with the MiSeq® instrument; 3 samples were analyzed with the iSeq® instrument; 4 former nomenclature, synonym for Magallana gigas.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Gense, K.; Peterseil, V.; Licina, A.; Wagner, M.; Cichna-Markl, M.; Dobrovolny, S.; Hochegger, R. Development of a DNA Metabarcoding Method for the Identification of Bivalve Species in Seafood Products. Foods 2021, 10, 2618. https://doi.org/10.3390/foods10112618

AMA Style

Gense K, Peterseil V, Licina A, Wagner M, Cichna-Markl M, Dobrovolny S, Hochegger R. Development of a DNA Metabarcoding Method for the Identification of Bivalve Species in Seafood Products. Foods. 2021; 10(11):2618. https://doi.org/10.3390/foods10112618

Chicago/Turabian Style

Gense, Kristina, Verena Peterseil, Alma Licina, Martin Wagner, Margit Cichna-Markl, Stefanie Dobrovolny, and Rupert Hochegger. 2021. "Development of a DNA Metabarcoding Method for the Identification of Bivalve Species in Seafood Products" Foods 10, no. 11: 2618. https://doi.org/10.3390/foods10112618

APA Style

Gense, K., Peterseil, V., Licina, A., Wagner, M., Cichna-Markl, M., Dobrovolny, S., & Hochegger, R. (2021). Development of a DNA Metabarcoding Method for the Identification of Bivalve Species in Seafood Products. Foods, 10(11), 2618. https://doi.org/10.3390/foods10112618

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop