Phenotypic and Genotypic Analysis of Antimicrobial Resistance of Commensal Escherichia coli from Dairy Cows’ Feces
Abstract
:1. Introduction
2. Materials and Methods
2.1. Farm Selection and Sample Collection
2.2. Identification of Commensal E. coli
2.3. Isolation and Identification of Presumptive ESBL/AmpC- and Carbapenemase-Producing Commensal E. coli
2.4. Antimicrobial Susceptibility Test (AST) Determination by Broth Microdilution
2.5. Detection of Antibiotic Resistance Genes of Commensal E. coli Isolates
2.5.1. DNA Extraction
2.5.2. PCR Protocol
3. Results
3.1. Identification of Presumptive ESBL/AmpC and Carbapenemase Producing Commensal E. coli
3.2. Categorization of the Isolates
3.3. Phenotypic Resistance Profiles of the Isolates
3.4. Detection of Antimicrobial Resistant Genes with Conventional PCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Regulation (EC) No 1831/2003 of the European Parliament and of the Council of 22 September 2003 on Additives for Use in Animal Nutrition (Text with EEA Relevance) 2003R1831-EN-30.12.2015-006.001-2. Available online: https://eur-lex.europa.eu/legal-content/en/TXT/PDF/?uri=CELEX:02003R1831-20151230&qid=1564058228107&from=en (accessed on 25 May 2023).
- Munita, J.M.; Arias, C.A. Mechanisms of Antibiotic Resistance. Microbiol. Spectr. 2016, 4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Messele, Y.E.; Alkhallawi, M.; Veltman, T.; Trott, D.J.; McMeniman, J.P.; Kidd, S.P.; Low, W.Y.; Petrovski, K.R. Phenotypic and Genotypic Analysis of Antimicrobial Resistance in Escherichia coli Recovered from Feedlot Beef Cattle in Australia. Animals 2022, 12, 2256. [Google Scholar] [CrossRef] [PubMed]
- Kimera, Z.I.; Mshana, S.E.; Rweyemamu, M.M.; Mboera, L.E.G.; Matee, M.I.N. Antimicrobial use and resistance in food-producing animals and the environment: An African perspective. Antimicrob. Resist. Infect. Control 2020, 9, 37. [Google Scholar] [CrossRef] [Green Version]
- Thanner, S.; Drissner, D.; Walsh, F. Antimicrobial Resistance in Agriculture. ASM J. mBio 2016, 7, e02227-15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szmolka, A.; Nagy, B. Multidrug resistant commensal Escherichia coli in animals and its impact for public health. Front. Microbiol. 2013, 4, 258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ny, S.; Edquist, P.; Dumpis, U.; Gröndahl-Yli-Hannuksela, K.; Hermes, J.; Kling, A.M.; Klingeberg, A.; Kozlov, R.; Källman, O.; Lis, D.O.; et al. Antimicrobial resistance of Escherichia coli isolates from outpatient urinary tract infections in women in six European countries including Russia. J. Glob. Antimicrob. Resist. 2019, 17, 25–34. [Google Scholar] [CrossRef] [PubMed]
- Samtiya, M.; Matthews, K.R.; Dhewa, T.; Puniya, A.K. Antimicrobial Resistance in the Food Chain: Trends, Mechanisms, Pathways, and Possible Regulation Strategies. Foods 2022, 11, 2966. [Google Scholar] [CrossRef]
- Jeamsripong, S.; Li, X.; Aly, S.S.; Su, Z.; Pereira, R.V.; Atwill, E.R. Antibiotic Resistance Genes and Associated Phenotypes in Escherichia coli and Enterococcus from Cattle at Different Production Stages on a Dairy Farm in Central California. Antibiotics 2021, 10, 1042. [Google Scholar] [CrossRef]
- Srinivasan, V.; Gillespie, B.E.; Lewis, J.M.; Nguyen, L.T.; Headrick, S.I.; Schukken, Y.H.; Oliver, S.P. Phenotypic and genotypic antimicrobial resistance patterns of Escherichia coli isolated from dairy cows with mastitis. Vet. Microbiol. 2007, 124, 319–328. [Google Scholar] [CrossRef]
- Haley, B.J.; Kim, S.W.; Salaheen, S.; Hovingh, E.; Van Kessel, J.A.S. Virulome and genome analyses identify associations between antimicrobial resistance genes and virulence factors in highly drug-resistant Escherichia coli isolated from veal calves. PLoS ONE 2022, 17, e0265445. [Google Scholar] [CrossRef]
- Laboratory Protocol Isolation of ESBL-, AmpC- and Carbapenemase-Producing E. coli from Caecal Samples December 2019 Version 7, Version 7 was Reviewed and Updated by: Rene S. Hendriksen and Valeria Bortolaia, Authors of the Document: Henrik Hasman, Yvonne Agersø, Rene Hendriksen, Lina M. Cavaco (DTU Food) and Beatriz Guerra-Roman. Available online: https://www.eurl-ar.eu/CustomerData/Files/Folders/21-protocols/530_esbl-ampc-cpeprotocol-version-caecal-v7-09-12-19.pdf (accessed on 20 May 2023).
- Commission Implementing Decision of 12 November 2013 on the Monitoring and Reporting of Antimicrobial Resistance in Zoonotic and Commensal Bacteria (Notified under Document C(2013) 7145) (Text with EEA Relevance) (2013/652/EU). Available online: https://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2013:303:0026:0039:EN:PDF (accessed on 20 May 2023).
- EUCAST. EUCAST Guidelines for Detection of Resistance Mechanisms and Specific Resistances of Clinical and/or Epidemiological Importance, Version 2.0. July 2017. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Resistance_mechanisms/EUCAST_detection_of_resistance_mechanisms_170711.pdf (accessed on 17 May 2023).
- Sjölund-Karlsson, M.; Joyce, K.; Blickenstaff, K.; Ball, T.; Haro, J.; Medalla, F.M.; Fedorka-Cray, P.; Zhao, S.; Crump, J.A.; Whichard, J.M. Antimicrobial susceptibility to azithromycin among Salmonella enterica isolates from the United States. Antimicrob. Agents Chemother. 2011, 55, 3985–3989. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cho, S.; Nguyen, H.A.T.; McDonald, J.M.; Woodley, T.A.; Hiott, L.M.; Barrett, J.B.; Jackson, C.R.; Frye, J.G. Genetic Characterization of Antimicrobial-Resistant Escherichia coli Isolated from a Mixed-Use Watershed in Northeast Georgia, USA. Int. J. Environ. Res. Public Health 2019, 16, 3761. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cattoir, V.; Weill, F.X.; Poirel, L.; Fabre, L.; Soussy, C.J.; Nordmann, P. Prevalence of qnr genes in Salmonella in France. J. Antimicrob. Chemother. 2007, 59, 751–754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hendriksen, R.S.; Bangtrakulnonth, A.; Pulsrikarn, C.; Pornreongwong, S.; Hasman, H.; Song, S.W.; Aarestrup, F.M. Antimicrobial resistance and molecular epidemiology of Salmonella Rissen from animals, food products, and patients in Thailand and Denmark. Foodborne Pathog. Dis. 2008, 5, 605–619. [Google Scholar] [CrossRef]
- Maynard, C.; Fairbrother, J.M.; Bekal, S.; Sanschagrin, F.; Levesque, R.C.; Brousseau, R.; Masson, L.; Larivière, S.; Harel., J. Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrob. Agents Chemother. 2003, 47, 3214–3221. [Google Scholar] [CrossRef] [Green Version]
- Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Euro Surveill 2018, 23, 17-00672. [Google Scholar] [CrossRef] [Green Version]
- Fu, Y.; Liu, D.; Song, H.; Liu, Z.; Jiang, H.; Wang, Y. Development of a Multiplex Real-Time PCR Assay for Rapid Detection of Tigecycline Resistance Gene tet(X) Variants from Bacterial, Fecal, and Environmental Samples. Antimicrob. Agents Chemother. 2020, 64, e02292-19. [Google Scholar] [CrossRef]
- Tello, M.; Ocejo, M.; Oporto, B.; Hurtado, A. Prevalence of Cefotaxime-Resistant Escherichia coli Isolates from Healthy Cattle and Sheep in Northern Spain: Phenotypic and Genome-Based Characterization of Antimicrobial Susceptibility. Appl. Environ. Microbiol. 2020, 86, e00742-20. [Google Scholar] [CrossRef]
- European Food Safety Authority; European Centre for Disease Prevention and Control. The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2017/2018. EFSA J. 2020, 18, e06007. [Google Scholar]
- Kerluku, M.; Jankuloski, D.; Ratkova Manovska, M.; Prodanov, M.; Blagoevska, K. Prevalence of β-lactamase genes (blaCTX-M, blaSHV, blaTEM, blaOXA1 and blaOXA2) and phylogenetic groups in ESBL producing commensal Escherichia coli isolated from fecal samples on dairy farm in the Municipality of Debar. Mac. Vet. Rev. 2023, 46, 89–97. [Google Scholar] [CrossRef]
- Sobur, M.A.; Sabuj, A.A.M.; Sarker, R.; Rahman, A.M.M.T.; Kabir, S.M.L.; Rahman, M.T. Antibiotic-resistant Escherichia coli and Salmonella spp. associated with dairy cattle and farm environment having public health significance. Vet. World 2019, 12, 984–993. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Navajas-Benito, E.V.; Alonso, C.A.; Sanz, S.; Olarte, C.; Martínez-Olarte, R.; Hidalgo-Sanz, S.; Somalo, S.; Torres, C. Molecular characterization of antibiotic resistance in Escherichia coli strains from a dairy cattle farm and its surroundings. J. Sci. Food Agr. 2017, 97, 362–365. [Google Scholar] [CrossRef] [PubMed]
- Jia, Y.; Mao, W.; Liu, B.; Zhang, S.; Cao, J.; Xu, X. Study on the drug resistance and pathogenicity of Escherichia coli isolated from calf diarrhea and the distribution of virulence genes and antimicrobial resistance genes. Front. Microbiol. 2022, 13, 992111. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, Y.; Hiroki, H.; Xie, H.; Nishiyama, M.; Sakamoto, S.H.; Uemura, R.; Nukazawa, K.; Ogura, Y.; Watanabe, T.; Kobayashi, I. Antibiotic-resistant Escherichia coli isolated from dairy cows and their surrounding environment on a livestock farm practicing prudent antimicrobial use. Int. J. Hyg. Environ. Health 2022, 240, 113930. [Google Scholar] [CrossRef]
- Cheney, T.E.; Smith, R.P.; Hutchinson, J.P.; Brunton, L.A.; Pritchard, G.; Teale, C.J. Cross-sectional survey of antibiotic resistance in Escherichia coli isolated from diseased farm livestock in England and Wales. Epidemiol. Infect. 2015, 143, 2653–2659. [Google Scholar] [CrossRef] [Green Version]
- Hennessey, M.; Whatford, L.; Payne-Gifford, S.; Johnson, K.F.; Van Winden, S.; Barling, D.; Häsler, B. Antimicrobial & antiparasitic use and resistance in British sheep and cattle: A systematic review. Prev. Vet. Med. 2020, 185, 105174. [Google Scholar]
- Azabo, R.R.; Mshana, S.E.; Matee, M.I.; Kimera, S.I. Antimicrobial Resistance Pattern of Escherichia coli Isolates from Small Scale Dairy Cattle in Dar es Salaam, Tanzania. Animals 2022, 12, 1853. [Google Scholar] [CrossRef]
- Chopra, I.; Roberts, M. Tetracycline antibiotics: Mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 2001, 65, 232–260. [Google Scholar] [CrossRef] [Green Version]
- Knothe, H.; Shah, P.; Krcmery, V.; Antal, M.; Mitsuhashi, S. Transferable resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of Klebsiella pneumoniae and Serratia marcescens. Infection 1983, 11, 315–317. [Google Scholar] [CrossRef]
- Hailu, W.; Helmy, Y.A.; Carney-Knisely, G.; Kauffman, M.; Fraga, D.; Rajashekara, G. Prevalence and Antimicrobial Resistance Profiles of Foodborne Pathogens Isolated from Dairy Cattle and Poultry Manure Amended Farms in Northeastern Ohio, the United States. Antibiotics 2021, 10, 1450. [Google Scholar] [CrossRef]
- Abbassi, M.S.; Kilani, H.; Zouari, M.; Mansouri, R.; Oussama, E.F.; Hammami, S.; Chehida, N.B. Antimicrobial Resistance in Escherichia Coli Isolates from Healthy Poultry, Bovine and Ovine in Tunisia: A Real Animal and Human Health Threat. J. Clin. Microbiol. Biochem. Technol. 2017, 3, 19–23. [Google Scholar] [CrossRef] [Green Version]
- Song, H.J.; Kim, S.J.; Moon, D.C.; Mechesso, A.F.; Choi, J.-H.; Kang, H.Y.; Boby, N.; Yoon, S.-S.; Lim, S.-K. Antimicrobial Resistance in Escherichia coli Isolates from Healthy Food Animals in South Korea, 2010–2020. Microorganisms 2022, 10, 524. [Google Scholar] [CrossRef] [PubMed]
- Van Boeckel, T.P.; Pires, J.; Silvester, R.; Zhao, C.; Song, J.; Criscuolo, N.G.; Gilbert, M.; Bonhoeffer, S.; Laxminarayan, R. Global trends in antimicrobial resistance in animals in low-and middle-income countries. Science 2019, 365, eaaw1944. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shivakumaraswamy, S.K.; Deekshit, V.K.; Vittal, R.; Akhila, D.S.; Mundanda, D.M.; Mohan Raj, J.R.; Chakraborty, A.; Karunasagar, I. Phenotypic and genotypic study of antimicrobial profile of bacteria isolates from environmental samples. Indian J. Med. Res. 2019, 149, 232–239. [Google Scholar] [PubMed]
- Köck, R.; Daniels-Haardt, I.; Becker, K.; Mellmann, A.; Friedrich, A.W.; Mevius, D.; Schwarz, S.; Jurke, A. Carbapenem-resistant Enterobacteriaceae in wildlife, food-producing, and companion animals: A systematic review. Clin. Microbiol. Infect. 2018, 24, 1241–1250. [Google Scholar] [CrossRef] [Green Version]
Antimicrobial(s) /Integron | Target Gene | F Primer Sequence (5′ to 3′) | R Primer Sequence (5′ to 3′) | Amplicon Size (bp) | Ref. |
---|---|---|---|---|---|
β-lactam | blaCTX-M | CACACGTGGAATTTAGGGACT | GAATGAGTTTCCCCATTCCGT | 970 | [16] |
blaTEM | TTCTTGAAGACGAAAGGGC | ACGCTCAGTGGAACGAAAAC | 1150 | ||
blaSHV | TTATCTCCCTGTTAGCCACC | GATTTGCTGATTTCGCTCGG | 796 | ||
blaOXA1 | TGAAAAACACAATACATATCAACTTCGC | GTGTGTTTAAATGGTGATCGCATT | 820 | ||
blaOXA2 | ACGAT AGTGGTGAGTATCCGACAG | ATCTGTTTGGCGTATCRATATTC | 601 | ||
blaVIM1 | AGTGGTGAGTATCCGACAG | ATGAAAGTGCGTGGAGAC | 261 | ||
tetracycline | tetA | GCGCCTTTCCTTTGGGTTCT | CCACCCGTTCCACGTTGTTA | 831 | |
tetB | CCCAGTGCTGTTGTTGTCAT | CCACCACCAGCCAATAAAAT | 723 | [16] | |
tetC | TTGCGGGATATCGTCCATTC | CATGCCAACCCGTTCCATGT | 1019 | ||
trimethoprim | dhfr1 | CGGTCGTAACACGTTCAAGT | CTGGGGATTTCAGGAAAGTA | 220 | |
dhfr5 | CTGCAAAAGCGAAAAACGG | AGCAATAGTTAATGTTTGAGCTAAAG | 432 | ||
dhfr12 | AAATTCCGGGTGAGCAGAAG | CCCGTTGACGGAATGGTTAG | 429 | [16] | |
dhfr13 | GCAGTCGCCCTAAAACAAAG | GATACGTGTGACAGCGTTGA | 294 | ||
sulfisoxazole | sul1 | TCACCGAGGACTCCTTCTTC | CAGTCCGCCTCAGCAATATC | 331 | [16] |
sul2 | CCTGTTTCGTCCGACACAGA | GAAGCGCAGCCGCAATTCAT | 435 | ||
azithromycin | mph(A) | GTGAGGAGGAGCTTCGCGAG | TGCCGCAGGACTCGGAGGTC | 403 | [16] |
ciprofloxacin | gyrA | CGACCTTGCGAGAGAAAT | GTTCCATCAGCCCTTCAA | 626 | [16] |
nalidixic acid | qnrA | GGGTATGGATATTATTGATAAAG | CTAATCCGGCAGCACTATTA | 660 | [17] |
chloramphenicol | cmlA | TAC TCG GAT CCA TGC TGG CC | TCC TCG AAG AGC GCC ATT GG | 578 | [18] |
gentamicin | aac(3)-IV | AGTTGACCCAGGGCTGTCGC | GTGTGCTGCTGGTCCACA GC | 627 | [19] |
colistin | mcr-1 | AGTCCGTTTGTTCTTGTGGC | AGATCCTTGGTCTCGGCTTG | 320 | [20] |
tigecyclin | tet (X3) | GTGGATGCTTTGCTATTGTCTGA | TCTGTTGATTCGTCCTGCGTAT | 125 | [21] |
Antimicrobial Concentration in mg/L | |||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AMS | 0.015 | 0.03 | 0.064 | 0.125 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | 32 | 64 | 128 | 256 | 512 | 1024 |
AMP | 39 (100) | ||||||||||||||||
AZI | 5 (12.8) | 5 (12) | 8 (20.5) | 7 (18) | 2 (5.1) | 12 (30.7) | |||||||||||
FOT | 1 (2.5) | 38 (97.4) | |||||||||||||||
CHL | 27 (69.2) | 1 (2.5) | 1 (2.5) | 10 (25.6) | |||||||||||||
CIP | 13 (33.3) | 4 (10.2) | 1 (2.56) | 7 (17.9) | 5 (12.8) | 1 (2.56) | 8 (20.5) | ||||||||||
COL | 39 (100) | ||||||||||||||||
GEN | 3 (7.7) | 18 (46.1) | 11 (28.2) | 1 (2.56) | 6 (15.3) | ||||||||||||
MERO | 39 (100) | ||||||||||||||||
NAL | 21 (53.8) | 6 (15.38) | 1 (2.5) | 1 (2.5) | 10 (25.6) | ||||||||||||
SMX | 3 (7.7) | 4 (10.2) | 2 (5.1) | 1 (2.5) | 29 (4.3) | ||||||||||||
TAZ | 1 (2.56) | 6 (15.3) | 8 (20.5) | 10 (25.6) | 14 (35.8) | ||||||||||||
TET | 10 (25.6) | 1 (2.5) | 1 (2.5) | 2 (5.1) | 25 (64.1) | ||||||||||||
TGC | 26 (66.6) | 13 (33.3) | |||||||||||||||
TMP | 13 (33.3) | 4 (10.2) | 1 (2.5) | 21 (53.8) |
No. | Isolates | Total Number of Isolates | % of Resistance for Each Group of Isolates | No. of Generations | Resistant vs. MDR |
---|---|---|---|---|---|
1. | 4 | 10 | 40 | I | 25.64 |
2. | 6 | 60 | II | ||
3. | 2 | 29 | 6.9 | III | 74.35 |
4. | 11 | 37.9 | IV | ||
5. | 7 | 24.1 | V | ||
6. | 1 | 3.4 | VI | ||
7. | 8 | 27.5 | VII |
Resistant Genes | Antimicrobial Substance | Class | Number (%) of Isolates |
---|---|---|---|
sul1 | sulfisoxazole | sulphonamides | 8 (20.51%) |
sul2 | 21 (53.84%) | ||
tetA | tetracycline | tetracyclines | 28 (71.79%) |
tetB | 20 (51.28%) | ||
tetC | 1 (2.56%) | ||
dhfr1 | trimethoprim | folic acid blocators | 9 (23.07%) |
dhfr5 | 4 (10.25%) | ||
dhfr12 | 5 (12.82%) | ||
dhfr13 | 3 (7.07%) | ||
gyrA | ciprofloxacin | fluoroquinolones | 27 (69.23%) |
qnrA | nalidixic acid | quinolones | 15 (38.46%) |
cmlA | chloramphenicol | phenicoles | 14 (35.89%) |
aac (3)- IV | gentamicin | aminoglycosides | 7 (17.94%) |
mphA | azithromycin | macrolides | 12 (30.76%) |
Number of Genes | Genotype Profile | Number of Antimicrobial Classes | Farm ID |
---|---|---|---|
3 | gyrA, CTX-M, TEM | 2 | 1 |
sul2, tetA, gyrA | 3 | 2 | |
gyrA, CTX-M, TEM | 2 | 1 | |
sul2, aac(3)-IV, CTX-M | 3 | 10 | |
4 | gyrA, aac(3)-IV, CTX-M, TEM | 3 | 10 |
tetA, gyrA, CTX-M, TEM | 3 | 1 | |
tetA, gyrA, cmlA, TEM | 4 | 1 | |
sul2, tetA, gyrA, TEM | 4 | 2 | |
tetA, tetB, dhfr12, CTX-M | 3 | 11 | |
5 | tetB, qnrA, cmlA, CTX-M, TEM | 4 | 5 |
sul1, sul2, gyrA, CTX-M, TEM | 3 | 2 | |
sul2, tetA, tetB, gyrA, TEM | 4 | 1 | |
sul2, tetA, tetB, gyrA, CTX-M | 4 | 6 | |
sul2, tetA, gyrA, CTX-M, TEM | 4 | 1 | |
6 | tetA, tetB, dhfr12, qnrA, cmlA, CTX-M | 5 | 7 |
sul2, dhfr1, dhfr12, gyrA, mphA, CTX-M | 5 | 5 | |
su1l, sul2, dhfr1, dhfr12, CTX-M, TEM | 3 | 1 | |
tetA, tetB, dhfr12, cmlA, qnrA, TEM | 5 | 7 | |
tetA, tetB, gyrA, qnrA, aac(3)-IV, TEM | 5 | 1 | |
teteA, tetB, gyrA, qnrA, cmlA, CTX-M | 5 | 5 | |
tetA, gyrA, qnrA, cmlA, CTX-M, TEM | 5 | 5 | |
tetA, dhfr1, dhfr13, qnrA, mphA, TEM | 5 | 6 | |
tetA, dhfr1, gyrA, mphA, CTX-M, TEM | 5 | 9 | |
sul2, tetB, mphA, CTX-M, TEM, OXA1 | 4 | 4 | |
7 | sul1, sul2, tetB, gyrA, mphA, CTX-M, TEM | 5 | 8 |
sul1, sul2, tetA, dhfr5, gyrA, CTX-M, TEM | 5 | 2 | |
tetA, dhfr1, dhfr13, gyrA, qnrA, cmla, CTX-M | 6 | 7 | |
sul2, tetA, tetB, dhfr1, gyrA, mphA, TEM | 6 | 8 | |
sul2, tetA, tetB, gyrA, mphA, CTX-M, TEM | 5 | 6 | |
tetA, tetB, dhfr5, qnrA, cmlA, mphA, CTX-M | 6 | 1 | |
sul2, tetA, tetB, gyrA, aac(3)-IV, mphA, CTX-M | 6 | 6 | |
8 | sul1, sul2, tetA, tetB, qnrA, cmlA, CTX-M, TEM | 5 | 7 |
sul1, tetA, tetB, dhfr5, cmlA, mphA, CTX-M, TEM | 6 | 5 | |
sul2, tetA, tetB, qnrA, cmlA, mphA, CTX-M, OXA1 | 6 | 7 | |
sul1, sul2, tetA, tetB, dhfr1, gyrA, CTX-M, TEM | 5 | 5 | |
sul2, tetA, dhfr1, gyrA, aac(3)-IV, mphA, CTX-M, TEM | 6 | 6 | |
9 | sul2, tetA, tetC, dhfr1, gyrA, cmlA, aac (3)-IV, CTX-M, TEM | 7 | 2 |
tetA, tetB, dhfr5, gyrA, cmlA, qnrA, aac(3)-IV, TEM, SHV | 6 | 2 | |
sul1, sul2, tetB, dhfr13, gyrA, qnrA, cmlA, CTX-M, TEM | 7 | 3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kerluku, M.; Ratkova Manovska, M.; Prodanov, M.; Stojanovska-Dimzoska, B.; Hajrulai-Musliu, Z.; Jankuloski, D.; Blagoevska, K. Phenotypic and Genotypic Analysis of Antimicrobial Resistance of Commensal Escherichia coli from Dairy Cows’ Feces. Processes 2023, 11, 1929. https://doi.org/10.3390/pr11071929
Kerluku M, Ratkova Manovska M, Prodanov M, Stojanovska-Dimzoska B, Hajrulai-Musliu Z, Jankuloski D, Blagoevska K. Phenotypic and Genotypic Analysis of Antimicrobial Resistance of Commensal Escherichia coli from Dairy Cows’ Feces. Processes. 2023; 11(7):1929. https://doi.org/10.3390/pr11071929
Chicago/Turabian StyleKerluku, Maksud, Marija Ratkova Manovska, Mirko Prodanov, Biljana Stojanovska-Dimzoska, Zehra Hajrulai-Musliu, Dean Jankuloski, and Katerina Blagoevska. 2023. "Phenotypic and Genotypic Analysis of Antimicrobial Resistance of Commensal Escherichia coli from Dairy Cows’ Feces" Processes 11, no. 7: 1929. https://doi.org/10.3390/pr11071929