Characterization and Anti-Inflammatory Effects on Periodontal Ligament Cells of Citrus limon-Derived Exosome-like Nanovesicles Under Different Storage Temperatures
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation of LELNs
2.2. Cell Culture
2.3. LELNs Uptake Assay
2.4. Transmission Electron Microscopy (TEM)
2.5. Nanoparticle Tracking Analysis (NTA)
2.6. Micro Bicinchoninic Acid Assay (BCA) Analysis
2.7. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.8. Enzyme Linked Immunosorbent Assay (ELISA)
2.9. Cell Viability Assay
2.10. Statistical Analysis
3. Results
3.1. Isolation and Characterization of LELNs
3.2. Effects of Different Storage Temperatures on the Characterization of LELNs
3.3. LELNs Stored at Different Temperatures Retmain In Vitro Anti-Inflammatory Effects
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| EVs | Extracellular vesicles |
| PELNs | Plant-derived exosome-like nanoparticles |
| LELNs | Lemon-derived exosome-like nanovesicles |
| hPDLCs | Human periodontal ligament cells |
| PBS | Phosphate-buffered saline |
| LPS | Lipopolysaccharide |
| TEM | Transmission electron microscopy |
| NTA | Nanoparticle tracking analysis |
| BCA | Micro bicinchoninic acid assay |
| qRT-PCR | Quantitative real-time polymerase chain reaction |
| ELISA | Enzyme linked immunosorbent assay |
| IL-6 | Interleukin-6 |
| IL-1β | Interleukin-1 beta |
| TNF-α | Tumor necrosis factor-alpha |
References
- Yang, B.; Chen, Y.; Shi, J. Exosome Biochemistry and Advanced Nanotechnology for Next-Generation Theranostic Platforms. Adv. Mater. 2019, 31, 1802896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, X.; Lai, Y.; Hua, Z.-C. Apoptosis and Apoptotic Body: Disease Message and Therapeutic Target Potentials. Biosci. Rep. 2019, 39, BSR20180992. [Google Scholar] [CrossRef] [Scilit]
- Van Niel, G.; D’Angelo, G.; Raposo, G. Shedding Light on the Cell Biology of Extracellular Vesicles. Nat. Rev. Mol. Cell Biol. 2018, 19, 213–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El Andaloussi, S.; Mäger, I.; Breakefield, X.O.; Wood, M.J.A. Extracellular Vesicles: Biology and Emerging Therapeutic Opportunities. Nat. Rev. Drug Discov. 2013, 12, 347–357. [Google Scholar] [CrossRef] [Scilit]
- Lai, J.J.; Chau, Z.L.; Chen, S.; Hill, J.J.; Korpany, K.V.; Liang, N.; Lin, L.; Lin, Y.; Liu, J.K.; Liu, Y.; et al. Exosome Processing and Characterization Approaches for Research and Technology Development. Adv. Sci. 2022, 9, 2103222. [Google Scholar] [CrossRef] [Scilit]
- Dad, H.A.; Gu, T.-W.; Zhu, A.-Q.; Huang, L.-Q.; Peng, L.-H. Plant Exosome-like Nanovesicles: Emerging Therapeutics and Drug Delivery Nanoplatforms. Mol. Ther. 2021, 29, 13–31. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Yu, Y.; Zhu, G.; Zeng, L.; Xu, S.; Cheng, H.; Ouyang, Z.; Chen, J.; Pathak, J.L.; Wu, L.; et al. The Emerging Role of Plant-Derived Exosomes-Like Nanoparticles in Immune Regulation and Periodontitis Treatment. Front. Immunol. 2022, 13, 896745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garaeva, L.; Kamyshinsky, R.; Kil, Y.; Varfolomeeva, E.; Verlov, N.; Komarova, E.; Garmay, Y.; Landa, S.; Burdakov, V.; Myasnikov, A.; et al. Delivery of Functional Exogenous Proteins by Plant-Derived Vesicles to Human Cells in Vitro. Sci. Rep. 2021, 11, 6489. [Google Scholar] [CrossRef] [Scilit]
- Gao, C.; Zhou, Y.; Chen, Z.; Li, H.; Xiao, Y.; Hao, W.; Zhu, Y.; Vong, C.T.; Farag, M.A.; Wang, Y.; et al. Turmeric-Derived Nanovesicles as Novel Nanobiologics for Targeted Therapy of Ulcerative Colitis. Theranostics 2022, 12, 5596–5614. [Google Scholar] [CrossRef] [Scilit]
- You, J.Y.; Kang, S.J.; Rhee, W.J. Isolation of Cabbage Exosome-like Nanovesicles and Investigation of Their Biological Activities in Human Cells. Bioact. Mater. 2021, 6, 4321–4332. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Li, Q.; Liang, Y.; Zu, M.; Chen, N.; Canup, B.S.B.; Luo, L.; Wang, C.; Zeng, L.; Xiao, B. Natural Exosome-like Nanovesicles from Edible Tea Flowers Suppress Metastatic Breast Cancer via ROS Generation and Microbiota Modulation. Acta Pharm. Sin. B 2022, 12, 907–923. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Chen, J.; Chen, W.; Ming, Y.; Guo, J.; Wang, Q.; Xu, S.; Kang, Y.; Huang, Y.; Jia, B. Grape-Derived Exosome-Like Nanovesicles Effectively Ameliorate Skin Photoaging by Protecting Epithelial Cells. J. Food Sci. 2025, 90, e70309. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.; Zhang, Z.; Zhou, X.; Liao, Y.; Peng, Z.; Meng, Z.; Nüssler, A.K.; Ma, L.; Xia, H.; Liu, L.; et al. Gouqi-Derived Nanovesicles (GqDNVs) Promoted MC3T3-E1 Cells Proliferation and Improve Fracture Healing. Phytomedicine 2025, 142, 156755. [Google Scholar] [CrossRef] [Scilit]
- Raimondo, S.; Urzì, O.; Meraviglia, S.; Di Simone, M.; Corsale, A.M.; Rabienezhad Ganji, N.; Palumbo Piccionello, A.; Polito, G.; Lo Presti, E.; Dieli, F.; et al. Anti-inflammatory Properties of Lemon-derived Extracellular Vesicles Are Achieved through the Inhibition of ERK/NF-κB Signalling Pathways. J. Cell. Mol. Med. 2022, 26, 4195–4209. [Google Scholar] [CrossRef] [Scilit]
- Baldini, N.; Torreggiani, E.; Roncuzzi, L.; Perut, F.; Zini, N.; Avnet, S. Exosome-like Nanovesicles Isolated from Citrus limon L. Exert Antioxidative Effect. Curr. Pharm. Biotechnol. 2018, 19, 877–885. [Google Scholar] [CrossRef] [Scilit]
- Logozzi, M.; Di Raimo, R.; Mizzoni, D.; Fais, S. Nanovesicles from Organic Agriculture-Derived Fruits and Vegetables: Characterization and Functional Antioxidant Content. Int. J. Mol. Sci. 2021, 22, 8170. [Google Scholar] [CrossRef] [Scilit]
- Raimondo, S.; Naselli, F.; Fontana, S.; Monteleone, F.; Lo Dico, A.; Saieva, L.; Zito, G.; Flugy, A.; Manno, M.; Di Bella, M.A.; et al. Citrus limon-Derived Nanovesicles Inhibit Cancer Cell Proliferation and Suppress CML Xenograft Growth by Inducing TRAIL-Mediated Cell Death. Oncotarget 2015, 6, 19514–19527. [Google Scholar] [CrossRef] [Scilit]
- Takakura, H.; Nakao, T.; Narita, T.; Horinaka, M.; Nakao-Ise, Y.; Yamamoto, T.; Iizumi, Y.; Watanabe, M.; Sowa, Y.; Oda, K.; et al. Citrus limon L.-Derived Nanovesicles Show an Inhibitory Effect on Cell Growth in P53-Inactivated Colorectal Cancer Cells via the Macropinocytosis Pathway. Biomedicines 2022, 10, 1352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lei, C.; Mu, J.; Teng, Y.; He, L.; Xu, F.; Zhang, X.; Sundaram, K.; Kumar, A.; Sriwastva, M.K.; Lawrenz, M.B.; et al. Lemon Exosome-like Nanoparticles-Manipulated Probiotics Protect Mice from C. diff Infection. iScience 2020, 23, 101571. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lei, C.; Teng, Y.; He, L.; Sayed, M.; Mu, J.; Xu, F.; Zhang, X.; Kumar, A.; Sundaram, K.; Sriwastva, M.K.; et al. Lemon Exosome-like Nanoparticles Enhance Stress Survival of Gut Bacteria by RNase P-Mediated Specific tRNA Decay. iScience 2021, 24, 102511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, Q.; Zhao, W.; Wu, C.; Wang, X.; Chen, J.; Shi, X.; Sha, S.; Li, J.; Liang, X.; Yang, Y.; et al. Lemon-Derived Extracellular Vesicles Nanodrugs Enable to Efficiently Overcome Cancer Multidrug Resistance by Endocytosis-Triggered Energy Dissipation and Energy Production Reduction. Adv. Sci. 2022, 9, 2105274. [Google Scholar] [CrossRef] [Scilit]
- Ahmadian, S.; Jafari, N.; Tamadon, A.; Ghaffarzadeh, A.; Rahbarghazi, R.; Mahdipour, M. Different Storage and Freezing Protocols for Extracellular Vesicles: A Systematic Review. Stem Cell Res. Ther. 2024, 15, 453. [Google Scholar] [CrossRef] [Scilit]
- Gelibter, S.; Marostica, G.; Mandelli, A.; Siciliani, S.; Podini, P.; Finardi, A.; Furlan, R. The Impact of Storage on Extracellular Vesicles: A Systematic Study. J. Extracell. Vesicles 2022, 11, e12162. [Google Scholar] [CrossRef] [Scilit]
- Jeyaram, A.; Jay, S.M. Preservation and Storage Stability of Extracellular Vesicles for Therapeutic Applications. AAPS J. 2018, 20, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levy, D.; Jeyaram, A.; Born, L.J.; Chang, K.-H.; Abadchi, S.N.; Hsu, A.T.W.; Solomon, T.; Aranda, A.; Stewart, S.; He, X.; et al. Impact of Storage Conditions and Duration on Function of Native and Cargo-Loaded Mesenchymal Stromal Cell Extracellular Vesicles. Cytotherapy 2023, 25, 502–509. [Google Scholar] [CrossRef] [Scilit]
- Shen, S.; Shen, Z.; Wang, C.; Wu, X.; Wang, L.; Ye, L.; Zhang, S.; Cheng, X. Effects of Lysate/Tissue Storage at −80 °C on Subsequently Extracted EVs of Epithelial Ovarian Cancer Tissue Origins. iScience 2023, 26, 106521. [Google Scholar] [CrossRef] [Scilit]
- Wright, A.; Snyder, O.L.; Christenson, L.K.; He, H.; Weiss, M.L. Effect of Pre-Processing Storage Condition of Cell Culture-Conditioned Medium on Extracellular Vesicles Derived from Human Umbilical Cord-Derived Mesenchymal Stromal Cells. Int. J. Mol. Sci. 2022, 23, 7716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van De Wakker, S.I.; Van Oudheusden, J.; Mol, E.A.; Roefs, M.T.; Zheng, W.; Görgens, A.; El Andaloussi, S.; Sluijter, J.P.G.; Vader, P. Influence of Short Term Storage Conditions, Concentration Methods and Excipients on Extracellular Vesicle Recovery and Function. Eur. J. Pharm. Biopharm. 2022, 170, 59–69. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.; Han, J.; Liu, H.; He, Y.; Zhang, Z.; Liu, X.; Waqas, F.; Zhang, L.; Duan, H.; He, J.; et al. Storage of Plasma-Derived Exosomes: Evaluation of Anticoagulant Use and Preserving Temperatures. Platelets 2024, 35, 2337255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buntsma, N.C.; Gąsecka, A.; Roos, Y.B.W.E.M.; Van Leeuwen, T.G.; Van Der Pol, E.; Nieuwland, R. EDTA Stabilizes the Concentration of Platelet-Derived Extracellular Vesicles during Blood Collection and Handling. Platelets 2022, 33, 764–771. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reinsalu, O.; Samel, A.; Niemeister, E.; Kurg, R. MAGEA4 Coated Extracellular Vesicles Are Stable and Can Be Assembled In Vitro. Int. J. Mol. Sci. 2021, 22, 5208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.-Y.; Li, Y.-J.; Hu, X.-B.; Huang, S.; Xiang, D.-X. Preservation of Small Extracellular Vesicles for Functional Analysis and Therapeutic Applications: A Comparative Evaluation of Storage Conditions. Drug Deliv. 2021, 28, 162–170. [Google Scholar] [CrossRef] [Scilit]
- Bosch, S.; De Beaurepaire, L.; Allard, M.; Mosser, M.; Heichette, C.; Chrétien, D.; Jegou, D.; Bach, J.-M. Trehalose Prevents Aggregation of Exosomes and Cryodamage. Sci. Rep. 2016, 6, 36162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Charoenviriyakul, C.; Takahashi, Y.; Nishikawa, M.; Takakura, Y. Preservation of Exosomes at Room Temperature Using Lyophilization. Int. J. Pharm. 2018, 553, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Evtushenko, E.G.; Bagrov, D.V.; Lazarev, V.N.; Livshits, M.A.; Khomyakova, E. Adsorption of Extracellular Vesicles onto the Tube Walls during Storage in Solution. PLoS ONE 2020, 15, e0243738. [Google Scholar] [CrossRef] [Scilit]
- Sivanantham, A.; Jin, Y. Impact of Storage Conditions on EV Integrity/Surface Markers and Cargos. Life 2022, 12, 697. [Google Scholar] [CrossRef] [Scilit]
- Tessier, S.N.; Bookstaver, L.D.; Angpraseuth, C.; Stannard, C.J.; Marques, B.; Ho, U.K.; Muzikansky, A.; Aldikacti, B.; Reátegui, E.; Rabe, D.C.; et al. Isolation of Intact Extracellular Vesicles from Cryopreserved Samples. PLoS ONE 2021, 16, e0251290. [Google Scholar] [CrossRef] [Scilit]
- Karabay, A.Z.; Barar, J.; Hekmatshoar, Y.; Rahbar Saadat, Y. Multifaceted Therapeutic Potential of Plant-Derived Exosomes: Immunomodulation, Anticancer, Anti-Aging, Anti-Melanogenesis, Detoxification, and Drug Delivery. Biomolecules 2025, 15, 394. [Google Scholar] [CrossRef] [Scilit]
- Langellotto, M.D.; Rassu, G.; Serri, C.; Demartis, S.; Giunchedi, P.; Gavini, E. Plant-Derived Extracellular Vesicles: A Synergetic Combination of a Drug Delivery System and a Source of Natural Bioactive Compounds. Drug Deliv. Transl. Res. 2025, 15, 831–845. [Google Scholar] [CrossRef] [Scilit]
- Rawat, S.; Arora, S.; Dhondale, M.R.; Khadilkar, M.; Kumar, S.; Agrawal, A.K. Stability Dynamics of Plant-Based Extracellular Vesicles Drug Delivery. J. Xenobiotics 2025, 15, 55. [Google Scholar] [CrossRef] [Scilit]
- Nemidkanam, V.; Chaichanawongsaroj, N. Characterizing Kaempferia Parviflora Extracellular Vesicles, a Nanomedicine Candidate. PLoS ONE 2022, 17, e0262884. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.; Park, J.; Sohn, Y.; Oh, C.-E.; Park, J.-H.; Yuk, J.-M.; Yeon, J.-H. Stability of Plant Leaf-Derived Extracellular Vesicles According to Preservative and Storage Temperature. Pharmaceutics 2022, 14, 457. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.; Wang, X.; Han, M.K.; Collins, J.F.; Merlin, D. Oral Administration of Ginger-Derived Nanolipids Loaded With siRNA As a Novel Approach for Efficient siRNA Drug Delivery to Treat Ulcerative Colitis. Nanomedicine 2017, 12, 1927–1943. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, C.; Liu, Y.; Yu, X.; Liu, J.; Cao, P.; Liu, G.; Cai, Y.; Zhang, Y.; Luan, Q. Garlic-Derived Exosome-Like Nanovesicles: A Promising Natural Nanotherapy for Periodontitis via PHGDH/PI3K/AKT-Mediated Metabolic and Inflammatory Regulation. Int. J. Nanomed. 2025, 20, 5551–5572. [Google Scholar] [CrossRef] [Scilit]
- Barreiro, K.; Dwivedi, O.P.; Valkonen, S.; Groop, P.; Tuomi, T.; Holthofer, H.; Rannikko, A.; Yliperttula, M.; Siljander, P.; Laitinen, S.; et al. Urinary Extracellular Vesicles: Assessment of Pre-analytical Variables and Development of a Quality Control with Focus on Transcriptomic Biomarker Research. J. Extracell. Vesicles 2021, 10, e12158. [Google Scholar] [CrossRef] [Scilit]
- Dong, X.; Li, M.; Li, Q.; Gao, Y.; Liu, L.; Chen, X.; Zhou, Z.; Rong, H.; Zhang, J.; Tian, Y. Effects of Cryopreservation on Microparticles Concentration, Procoagulant Function, Size Distribution, and Morphology. Med. Sci. Monit. 2019, 25, 6675–6690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, S.J.; Jeon, H.; Yoo, S.-M.; Lee, M.-S. The Effect of Storage Temperature on the Biological Activity of Extracellular Vesicles for the Complement System. Vitro Cell. Dev. Biol. Anim. 2018, 54, 423–429. [Google Scholar] [CrossRef] [Scilit]
- Görgens, A.; Corso, G.; Hagey, D.W.; Jawad Wiklander, R.; Gustafsson, M.O.; Felldin, U.; Lee, Y.; Bostancioglu, R.B.; Sork, H.; Liang, X.; et al. Identification of Storage Conditions Stabilizing Extracellular Vesicles Preparations. J. Extracell. Vesicles 2022, 11, e12238. [Google Scholar] [CrossRef] [Scilit]
- Kumeda, N.; Ogawa, Y.; Akimoto, Y.; Kawakami, H.; Tsujimoto, M.; Yanoshita, R. Characterization of Membrane Integrity and Morphological Stability of Human Salivary Exosomes. Biol. Pharm. Bull. 2017, 40, 1183–1191. [Google Scholar] [CrossRef] [Scilit]




| Primers | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| GAPDH | TCATTGACCTCAACTACATG | TCGCTCCTGGAAGATGGTGAT |
| IL-6 | GTAGCCGCCCCACACAGA | CATGTCTCCTTTCTCAGGGCTG |
| IL-1β | GCCAGTGAAATGATGGCTTATT | AGGAGCACTTCATCTGTTTAGG |
| TNF-α | CTCATCTACTCCCAGGTCCTCTTC | CGATGCGGCTGATGGTGTG |
| Fresh | −80 °C | −20 °C | 4 °C | |
|---|---|---|---|---|
| Concentration (particles/mL) | 2.8 × 1012 | 2.6 × 1012 | 2.0 × 1012 | 1.8 × 1012 |
| Average particle size (nm) | 142.5 ± 2.4 | 142.8 ± 1.8 | 151.7 ± 3.9 | 131.0 ± 2.3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Ma, Y.; Yu, C.; Liu, G.; Liu, J.; Luan, Q. Characterization and Anti-Inflammatory Effects on Periodontal Ligament Cells of Citrus limon-Derived Exosome-like Nanovesicles Under Different Storage Temperatures. Biomedicines 2026, 14, 99. https://doi.org/10.3390/biomedicines14010099
Ma Y, Yu C, Liu G, Liu J, Luan Q. Characterization and Anti-Inflammatory Effects on Periodontal Ligament Cells of Citrus limon-Derived Exosome-like Nanovesicles Under Different Storage Temperatures. Biomedicines. 2026; 14(1):99. https://doi.org/10.3390/biomedicines14010099
Chicago/Turabian StyleMa, Yiming, Chenhao Yu, Guojing Liu, Jia Liu, and Qingxian Luan. 2026. "Characterization and Anti-Inflammatory Effects on Periodontal Ligament Cells of Citrus limon-Derived Exosome-like Nanovesicles Under Different Storage Temperatures" Biomedicines 14, no. 1: 99. https://doi.org/10.3390/biomedicines14010099
APA StyleMa, Y., Yu, C., Liu, G., Liu, J., & Luan, Q. (2026). Characterization and Anti-Inflammatory Effects on Periodontal Ligament Cells of Citrus limon-Derived Exosome-like Nanovesicles Under Different Storage Temperatures. Biomedicines, 14(1), 99. https://doi.org/10.3390/biomedicines14010099

