Genetic and Epigenetic Profiles of Polycystic Ovarian Syndrome and In Vitro Bisphenol Exposure in a Human Granulosa Cell Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Approval and Patient Criteria
2.2. Cell Retrieval
2.3. Cell Culture and Bisphenol Treatment
2.4. RNA Extraction and cDNA Synthesis
2.5. Quantitative Polymerase Chain Reaction (qPCR)
2.6. Statistical Analysis
3. Results
3.1. Gene Expression Profiles Differ in Women with PCOS and Control Women
3.2. BPA and Analogs Disrupt Normal Gene Expression of Genes Associated with PCOS
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Goodarzi, M.O.; Dumesic, D.A.; Chazenbalk, G.; Azziz, R. Polycystic Ovary Syndrome: Etiology, Pathogenesis and Diagnosis. Nat. Rev. Endocrinol. 2011, 7, 219–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lujan, M.E.; Chizen, D.R.; Pierson, R.A. Diagnostic Criteria for Polycystic Ovary Syndrome: Pitfalls and Controversies. J. Obstet. Gynaecol. Can. 2008, 30, 671–679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cavalcanti, G.S.; Carvalho, K.C.; da Silva Ferreira, C.; Alvarez, P.A.C.; Monteleone, P.A.A.; Baracat, E.C.; Júnior, J.M.S. Granulosa Cells and Follicular Development: A Brief Review. Rev. Assoc. Med. Bras. 2023, 69, 20230175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marques, P.; Skorupskaite, K.; Rozario, K.S.; Anderson, R.A.; George, J.T. Physiology of GnRH and Gonadotropin Secretion. In Endotext; MDText.com, Inc.: South Dartmouth, MA, USA, 2022. [Google Scholar]
- Chaudhari, N.; Dawalbhakta, M.; Nampoothiri, L. GnRH Dysregulation in Polycystic Ovarian Syndrome (PCOS) Is a Manifestation of an Altered Neurotransmitter Profile. Reprod. Biol. Endocrinol. 2018, 16, 37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosenfield, R.L.; Ehrmann, D.A. The Pathogenesis of Polycystic Ovary Syndrome (PCOS): The Hypothesis of PCOS as Functional Ovarian Hyperandrogenism Revisited. Endocr. Rev. 2016, 37, 467–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dadachanji, R.; Shaikh, N.; Mukherjee, S. Genetic Variants Associated with Hyperandrogenemia in PCOS Pathophysiology. Genet. Res. Int. 2018, 2018, 7624932. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schiffer, L.; Barnard, L.; Baranowski, E.S.; Gilligan, L.C.; Taylor, A.E.; Arlt, W.; Shackleton, C.H.L.; Storbeck, K.H. Human Steroid Biosynthesis, Metabolism and Excretion Are Differentially Reflected by Serum and Urine Steroid Metabolomes: A Comprehensive Review. J. Steroid Biochem. Mol. Biol. 2019, 194, 105439. [Google Scholar] [CrossRef] [Scilit]
- Michael, A.E.; Glenn, C.; Wood, P.J.; Webb, R.J.; Pellatt, L.; Mason, H.D. Ovarian 11β-Hydroxysteroid Dehydrogenase (11βHSD) Activity Is Suppressed in Women with Anovulatory Polycystic Ovary Syndrome (PCOS): Apparent Role for Ovarian Androgens. J. Clin. Endocrinol. Metab. 2013, 98, 3375–3383. [Google Scholar] [CrossRef] [Scilit]
- Ajmal, N.; Khan, S.Z.; Shaikh, R. Polycystic Ovary Syndrome (PCOS) and Genetic Predisposition: A Review Article. Eur. J. Obstet. Gynecol. Reprod. Biol. X 2019, 3, 100060. [Google Scholar] [CrossRef] [Scilit]
- Heidarzadehpilehrood, R.; Pirhoushiaran, M.; Abdollahzadeh, R.; Osman, M.B.; Sakinah, M.; Nordin, N.; Hamid, H.A. A Review on CYP11A1, CYP17A1, and CYP19A1 Polymorphism Studies: Candidate Susceptibility Genes for Polycystic Ovary Syndrome (PCOS) and Infertility. Genes 2022, 13, 302. [Google Scholar] [CrossRef] [Scilit]
- Sørensen, A.E.; Wissing, M.L.; Salö, S.; Englund, A.L.M.; Dalgaard, L.T. MicroRNAs Related to Polycystic Ovary Syndrome (PCOS). Genes 2014, 5, 684–708. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, Y.; Cui, C.; Han, X.; Wang, Q.; Zhang, C. The Role of MiRNAs in Polycystic Ovary Syndrome with Insulin Resistance. J. Assist. Reprod. Genet. 2021, 38, 289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, H.; Zhao, Y. MiR-155 Is High-Expressed in Polycystic Ovarian Syndrome and Promotes Cell Proliferation and Migration through Targeting PDCD4 in KGN Cells. Artif. Cells Nanomed. Biotechnol. 2020, 48, 197–205. [Google Scholar] [CrossRef] [Scilit]
- Srnovršnik, T.; Virant-Klun, I.; Pinter, B. Polycystic Ovary Syndrome and Endocrine Disruptors (Bisphenols, Parabens, and Triclosan)-A Systematic Review. Life 2023, 13, 138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lazúrová, Z.; Figurová, J.; Hubková, B.; Mašlanková, J.; Lazúrová, I. Urinary Bisphenol A in Women with Polycystic Ovary Syndrome—A Possible Suppressive Effect on Steroidogenesis? Horm. Mol. Biol. Clin. Investig. 2021, 42, 303–309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jurewicz, J.; Majewska, J.; Berg, A.; Owczarek, K.; Zajdel, R.; Kaleta, D.; Wasik, A.; Rachoń, D. Serum Bisphenol A Analogues in Women Diagnosed with the Polycystic Ovary Syndrome—Is There an Association? Environ. Pollut. 2021, 272. [Google Scholar] [CrossRef] [Scilit]
- Ollila, M.M.; Arffman, R.K.; Korhonen, E.; Morin-Papunen, L.; Franks, S.; Junttila, J.; Piltonen, T.T. Women with PCOS Have an Increased Risk for Cardiovascular Disease Regardless of Diagnostic Criteria-a Prospective Population-Based Cohort Study. Eur. J. Endocrinol. 2023, 189, 96–105. [Google Scholar] [CrossRef] [Scilit]
- Peretz, J.; Craig, Z.R.; Flaws, J.A. Bisphenol A Inhibits Follicle Growth and Induces Atresia in Cultured Mouse Antral Follicles Independently of the Genomic Estrogenic Pathway. Biol. Reprod. 2012, 87, 63–64. [Google Scholar] [CrossRef] [Scilit]
- Ikezuki, Y.; Tsutsumi, O.; Takai, Y.; Kamei, Y.; Taketani, Y. Determination of Bisphenol A Concentrations in Human Biological Fluids Reveals Significant Early Prenatal Exposure. Hum. Reprod. 2002, 17, 2839–2841. [Google Scholar] [CrossRef] [Scilit]
- Mansur, A.; Israel, A.; Combelles, C.M.H.; Adir, M.; Racowsky, C.; Hauser, R.; Baccarelli, A.A.; Machtinger, R. Bisphenol-A Exposure and Gene Expression in Human Luteinized Membrana Cells in Vitro. Hum. Reprod. 2017, 32, 409. [Google Scholar] [CrossRef] [Scilit]
- Sabry, R.; Saleh, A.C.; Stalker, L.; LaMarre, J.; Favetta, L.A. Effects of Bisphenol A and Bisphenol S on MicroRNA Expression during Bovine (Bos Taurus) Oocyte Maturation and Early Embryo Development. Reprod. Toxicol. 2021, 99, 96–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hooper, A.L. MicroRNA Regulation of Ovarian Angiogenesis and Folliculogenesis in Bovine Cystic Ovarian Disease; University of Guelph: Guelph, ON, Canada, 2018. [Google Scholar]
- Gu, Z.; Eleswarapu, S.; Jiang, H. Identification and Characterization of MicroRNAs from the Bovine Adipose Tissue and Mammary Gland. FEBS Lett. 2007, 581, 981–988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guan, J.; Long, K.; Ma, J.; Zhang, J.; He, D.; Jin, L.; Tang, Q.; Jiang, A.; Wang, X.; Hu, Y.; et al. Comparative Analysis of the MicroRNA Transcriptome between Yak and Cattle Provides Insight into High-Altitude Adaptation. PeerJ 2017, 2017, e3959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lawless, N.; Vegh, P.; O’Farrelly, C.; Lynn, D.J. The Role of MicroRNAs in Bovine Infection and Immunity. Front. Immunol. 2014, 5, 611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lv, Y.; Zhao, S.G.; Lu, G.; Leung, C.K.; Xiong, Z.Q.; Su, X.W.; Ma, J.L.; Chan, W.Y.; Liu, H. Bin Identification of Reference Genes for QRT-PCR in Granulosa Cells of Healthy Women and Polycystic Ovarian Syndrome Patients. Sci. Rep. 2017, 7, 6961. [Google Scholar] [CrossRef] [Scilit]
- Emami, N.; Moini, A.; Yaghmaei, P.; Akbarinejad, V.; Shahhoseini, M.; Alizadeh, A.R. Differences in Expression of Genes Related to Steroidgenesis in Abdominal Subcutaneous Adipose Tissue of Pregnant Women with and without PCOS; a Case Control Study. BMC Pregnancy Childbirth 2021, 21, 490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalidhindi, R.S.R.; Katragadda, R.; Beauchamp, K.L.; Pabelick, C.M.; Prakash, Y.S.; Sathish, V. Androgen Receptor-Mediated Regulation of Intracellular Calcium in Human Airway Smooth Muscle Cells. Cell. Physiol. Biochem. 2019, 53, 215–228. [Google Scholar] [CrossRef] [Scilit]
- Zeng, X.; Xie, Y.J.; Liu, Y.T.; Long, S.L.; Mo, Z. cheng Polycystic Ovarian Syndrome: Correlation between Hyperandrogenism, Insulin Resistance and Obesity. Clin. Chim. Acta 2020, 502, 214–221. [Google Scholar] [CrossRef] [Scilit]
- Owens, L.A.; Kristensen, S.G.; Lerner, A.; Christopoulos, G.; Lavery, S.; Hanyaloglu, A.C.; Hardy, K.; Andersen, C.Y.; Franks, S. Gene Expression in Granulosa Cells From Small Antral Follicles From Women With or Without Polycystic Ovaries. J. Clin. Endocrinol. Metab. 2019, 104, 6182. [Google Scholar] [CrossRef] [Scilit]
- Aldakheel, F.M.; Abuderman, A.A.; Alduraywish, S.A.; Xiao, Y.; Guo, W.W. MicroRNA-21 Inhibits Ovarian Granulosa Cell Proliferation by Targeting SNHG7 in Premature Ovarian Failure with Polycystic Ovary Syndrome. J. Reprod. Immunol. 2021, 146, 103328. [Google Scholar] [CrossRef] [Scilit]
- Butler, A.E.; Ramachandran, V.; Cunningham, T.K.; David, R.; Gooderham, N.J.; Benurwar, M.; Dargham, S.R.; Hayat, S.; Sathyapalan, T.; Najafi-Shoushtari, S.H.; et al. Increased MicroRNA Levels in Women With Polycystic Ovarian Syndrome but Without Insulin Resistance: A Pilot Prospective Study. Front. Endocrinol. 2020, 11, 571357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, L.; Li, W.; Wu, M.; Cao, S. Ciculating MiRNA-21 as a Biomarker Predicts Polycystic Ovary Syndrome (PCOS) in Patients. Clin. Lab. 2015, 61, 1009–1015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naji, M.; Aleyasin, A.; Nekoonam, S.; Arefian, E.; Mahdian, R.; Amidi, F. Differential Expression of MiR-93 and MiR-21 in Granulosa Cells and Follicular Fluid of Polycystic Ovary Syndrome Associating with Different Phenotypes. Sci. Rep. 2017, 7, 14671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dehghan, Z.; Mohammadi-Yeganeh, S.; Rezaee, D.; Salehi, M. MicroRNA-21 Is Involved in Oocyte Maturation, Blastocyst Formation, and Pre-Implantation Embryo Development. Dev. Biol. 2021, 480, 69–77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jenabi, M.; Khodarahmi, P.; Tafvizi, F.; Bostanabad, S.Z. Evaluation of the Potential of MiR-21 as a Diagnostic Marker for Oocyte Maturity and Embryo Quality in Women Undergoing ICSI. Sci. Rep. 2023, 13, 1440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, G.; Liang, M.; Liang, N.; Yin, M.; Lü, M.; Lian, J.; Wang, Y.; Sun, F. MicroRNA-224 Is Involved in the Regulation of Mouse Cumulus Expansion by Targeting Ptx3. Mol. Cell Endocrinol. 2014, 382, 244–253. [Google Scholar] [CrossRef] [Scilit]
- Richter, C.A.; Taylor, J.A.; Ruhlen, R.L.; Welshons, W.V.; vom Saal, F.S. Estradiol and Bisphenol A Stimulate Androgen Receptor and Estrogen Receptor Gene Expression in Fetal Mouse Prostate Mesenchyme Cells. Environ. Health Perspect. 2007, 115, 902. [Google Scholar] [CrossRef] [Scilit]
- Oldenburg, J.; Fürhacker, M.; Hartmann, C.; Steinbichl, P.; Banaderakhshan, R.; Haslberger, A. Different Bisphenols Induce Non-Monotonous Changes in MiRNA Expression and LINE-1 Methylation in Two Cell Lines. Environ. Epigenet 2021, 7, dvab011. [Google Scholar] [CrossRef] [Scilit]
- Winkler, J.; Liu, P.; Phong, K.; Hinrichs, J.H.; Ataii, N.; Williams, K.; Hadler-Olsen, E.; Samson, S.; Gartner, Z.J.; Fisher, S.; et al. Bisphenol A Replacement Chemicals, BPF and BPS, Induce Protumorigenic Changes in Human Mammary Gland Organoid Morphology and Proteome. Proc. Natl. Acad. Sci. USA 2022, 119, e2115308119. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Zhu, Q.; Dang, X.; He, Y.; Li, X.; Sun, Y. Local Effect of Bisphenol A on the Estradiol Synthesis of Ovarian Granulosa Cells from PCOS. Gynecol. Endocrinol. 2017, 33, 21–25. [Google Scholar] [CrossRef] [Scilit]
- Vahedi, M.; Saeedi, A.; Poorbaghi, S.L.; Sepehrimanesh, M.; Fattahi, M. Metabolic and Endocrine Effects of Bisphenol A Exposure in Market Seller Women with Polycystic Ovary Syndrome. Environ. Sci. Pollut. Res. 2016, 23, 23546–23550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Urbanetz, L.A.M.L.; Junior, J.M.S.; Maciel, G.A.R.; Simões, R.d.S.; Baracat, M.C.P.; Baracat, E.C. Does Bisphenol A (BPA) Participates in the Pathogenesis of Polycystic Ovary Syndrome (PCOS)? Clinics 2023, 78, 100310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mukhopadhyay, R.; Prabhu, N.B.; Kabekkodu, S.P.; Rai, P.S. Review on Bisphenol A and the Risk of Polycystic Ovarian Syndrome: An Insight from Endocrine and Gene Expression. Environ. Sci. Pollut. Res. 2022, 29, 32631–32650. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| MicroRNA | Primer ID | Accession # | Sequence (5′-3′) | E (%) | Source |
|---|---|---|---|---|---|
| miR-191 | hsa-miR-191-5p | MIMAT0000440 | AACGGAATCCCAAAAGCAG | 99.7 | [23] |
| miR-106a | hsa-miR-106a-5p | MIMAT0000103 | CGCCAAAAGTGCTTACAGTGC | 92.4 | |
| miR-21 | bta-miR-21-5p | MIMAT0003528 | TAGCTTATCAGACTGATGTTGACT | 96.7 | [24] |
| miR-34c | bta-miR-34c | MIMAT0003854 | AGGCAGTGTAGTTAGCTGATTGC | 99.6 | [25] |
| miR-155 | hsa-miR-155-5p | MIMAT0000646 | TGCTAATCGTGATAGGGGTAAA | 100 | [26] |
| Gene Symbol | Gene Name | Product Size (bp) | Accession # | Primer Sequence Sets (5′-3′) | E (%) | Source |
|---|---|---|---|---|---|---|
| YWHAZ | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | 245 | NM_001135699.1 | F: ACTTTTGGTACATTGTGGCTTCAA R: CCGCCAGGACAAACCAGTAT | 100.1 | [27] |
| RPLP0 | Ribosomal protein lateral stalk subunit P0 | 240 | NM_001002.3 | F: AGCCCAGAACACTGGTCTC R: ACTCAGGATTTCAATGGTGCC | 100.7 | |
| 11β-HSD1 | 11 Beta-hydroxysteroid dehydrogenase type I | 180 | NM:001,206,741.1 | F: GCATTGTTGTCGTCTCCTCT R: TGGCTGTTTCTGTGTCTATGAG | 100.9 | [28] |
| 11β-HSD2 | 11 Beta-hydroxysteroid dehydrogenase type 2 | 162 | NM:000,196.3 | F: GCTGTGAACTCCTTCCCT R: CGATGTAGTCCTTGCCGT | 99.3 | |
| CYP17A1 | Cytochrome P450 17A1 | 154 | NM:000,102.3 | F: GATAACCACATTCTCACCACC R: GGCTGAAACCCACATTCTG | 100.9 | |
| CYP11A1 | Cytochrome P450 11A1 | 169 | NM:000,781.2 | F: CTTCCTTTCTGTCTCAATTCCC R: TCTACCAGATGTTCCACACC | 100.3 | |
| AR | Androgen receptor | 155 | NM_000044.6 | F: GCCTTGCTCTCTAGCCTCAA R: GGTCGTCCACGTGTAAGTTG | 100.9 | [29] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sabry, R.; Gallo, J.F.; Rooney, C.; Scandlan, O.L.M.; Davis, O.S.; Amin, S.; Faghih, M.; Karnis, M.; Neal, M.S.; Favetta, L.A. Genetic and Epigenetic Profiles of Polycystic Ovarian Syndrome and In Vitro Bisphenol Exposure in a Human Granulosa Cell Model. Biomedicines 2024, 12, 237. https://doi.org/10.3390/biomedicines12010237
Sabry R, Gallo JF, Rooney C, Scandlan OLM, Davis OS, Amin S, Faghih M, Karnis M, Neal MS, Favetta LA. Genetic and Epigenetic Profiles of Polycystic Ovarian Syndrome and In Vitro Bisphenol Exposure in a Human Granulosa Cell Model. Biomedicines. 2024; 12(1):237. https://doi.org/10.3390/biomedicines12010237
Chicago/Turabian StyleSabry, Reem, Jenna F. Gallo, Charlie Rooney, Olivia L. M. Scandlan, Ola S. Davis, Shilpa Amin, Mehrnoosh Faghih, Megan Karnis, Michael S. Neal, and Laura A. Favetta. 2024. "Genetic and Epigenetic Profiles of Polycystic Ovarian Syndrome and In Vitro Bisphenol Exposure in a Human Granulosa Cell Model" Biomedicines 12, no. 1: 237. https://doi.org/10.3390/biomedicines12010237
APA StyleSabry, R., Gallo, J. F., Rooney, C., Scandlan, O. L. M., Davis, O. S., Amin, S., Faghih, M., Karnis, M., Neal, M. S., & Favetta, L. A. (2024). Genetic and Epigenetic Profiles of Polycystic Ovarian Syndrome and In Vitro Bisphenol Exposure in a Human Granulosa Cell Model. Biomedicines, 12(1), 237. https://doi.org/10.3390/biomedicines12010237

