Analysis of Small RNAs of Barley Genotypes Associated with Resistance to Barley Yellow Dwarf Virus
Abstract
1. Introduction
2. Material and Methods
2.1. Experimental Conditions
2.2. RNA Isolation
2.3. qPCR Conditions
2.4. Library Preparation and sRNA-Seq
2.5. Bioinformatic Analyses of sRNA-Seq Data
2.6. siRNA Analysis
2.7. Statistical Analyses
3. Results
3.1. qPCR Analyses of BYDV Titer
3.2. Small RNA Deep Sequencing
3.3. Identification of Known and Novel miRNAs in Barley
3.4. miRNAs Expression Profiles after BYDV Infection
3.5. miRNAs’ Expression Profiles in Relation to the Resistance Levels
3.6. Target Gene Prediction for Barley miRNAs
3.7. Functional Classification of Known and Novel MiRNAs
3.8. Functional Domain Architecture Analysis of miRNAs Targets
3.9. RT-qPCR Validation of the Expression of 20 miRNAs
3.10. siRNA Analysis in Barley Cultivars
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Adams, M.J.; Lefkowitz, E.J.; King, A.M.Q.; Harrach, B.; Harrison, R.L.; Knowles, N.J.; Kropinski, A.M.; Krupovic, M.; Kuhn, J.H.; Mushegian, A.R. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses. Arch. Virol. 2016, 161, 2921–2949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- D’Arcy, C.J.; Burnett, P.A. Barley Yellow Dwarf: 40 Years of Progress; APS Press: St Paul, MN, USA, 1995; 374p. [Google Scholar]
- Pike, K.S. A review of barley yellow dwarf virus grain losses. In World Perspectives on Barley Yellow Dwarf Virus; Burnett, P.A., Ed.; International Maize and Wheat Improvement Center: Mexico City, Mexico, 1990; pp. 356–359. [Google Scholar]
- Perry, K.L.; Kolb, F.L.; Sammons, B.; Lawson, C.; Cisar, G.; Ohm, H. Yield effects of barley yellow dwarf virus in soft red winter wheat. Phytopathology 2000, 90, 1043–1048. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henry, M.; Posadas, G.; Segura, J.; Rajaram, S. Evaluating resistance to BYDV-PAV, BYDV-MAV, and CYDV-RPV in Thinopyrum intermedium-derived wheat lines. In Proceedings of the International Symposium, Texcoco, Mexico, 1–5 September 2002; pp. 64–66. [Google Scholar]
- Jarošová, J.; Beoni, E.; Kundu, J.K. Barley yellow dwarf virus resistance in cereals: Approaches, strategies and prospects. Field Crops Res. 2016, 198, 200–214. [Google Scholar] [CrossRef] [Scilit]
- Kosová, K.; Chrpová, J. Recent Advances in Breeding of Cereals for Resistance to Barley Yellow Dwarf Virus—A Review. Czech J. Genet. Plant Breed. 2008, 44, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Kamitani, M.; Nagano, A.J.; Honjo, M.N.; Kudoh, H. RNA-Seq reveals virus–virus and virus–plant interactions in nature. FEMS Microbiol. Ecol. 2016, 92, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dunoyer, P.; Voinnet, O. The complex interplay between plant viruses and host RNA-silencing pathways. Curr. Opin. Plant Biol. 2005, 8, 415–423. [Google Scholar] [CrossRef] [Scilit]
- Xia, Z.; Zhao, Z.; Chen, L.; Li, M.; Zhou, T.; Deng, C.; Zhou, Q.; Fan, Z. Synergistic infection of two viruses MCMV and SCMV increases the accumulations of both MCMV and MCMV-derived siRNAs in maize. Sci. Rep. 2016, 6, 20520. [Google Scholar] [CrossRef] [Scilit]
- Baulcombe, D. RNA silencing in plants. Nature 2004, 431, 356–363. [Google Scholar] [CrossRef] [Scilit]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [Scilit]
- Axtell, M.J. Classification and comparison of small RNAs from plants. Annu. Rev. Plant Biol. 2013, 64, 137–159. [Google Scholar] [CrossRef] [Scilit]
- Voinnet, O. Origin, biogenesis, and activity of plant microRNAs. Cell 2009, 136, 669–687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dugas, D.V.; Bartel, B. MicroRNA regulation of gene expression in plants. Curr. Opin. Plant Biol. 2004, 7, 512–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kasschau, K.D.; Xie, Z.; Allen, E.; Llave, C.; Chapman, E.J.; Krizan, K.A.; Carrington, J.C. P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA function. Dev. Cell 2003, 4, 205–217. [Google Scholar] [CrossRef] [Scilit]
- Khraiwesh, B.; Zhu, J.-K.; Zhu, J. Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochim. Biophys. Acta BBA Gene Regul. Mech. 2012, 1819, 137–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, Z.; Murawska, Z.; Xie, F.; Pawełkowicz, M.; Michalak, K.; Zhang, B.; Lebecka, R. microRNA response in potato virus Y infected tobacco shows strain-specificity depending on host and symptom severity. Virus Res. 2019, 260, 20–32. [Google Scholar] [CrossRef] [Scilit]
- Li, F.; Pignatta, D.; Bendix, C.; Brunkard, J.O.; Cohn, M.M.; Tung, J.; Sun, H.; Kumar, P.; Baker, B. MicroRNA regulation of plant innate immune receptors. Proc. Natl. Acad. Sci. USA 2012, 109, 1790–1795. [Google Scholar] [CrossRef] [Scilit]
- Du, P.; Wu, J.; Zhang, J.; Zhao, S.; Zheng, H.; Gao, G.; Wei, L.; Li, Y. Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors. PLoS Pathog. 2011, 7, e1002176. [Google Scholar] [CrossRef] [Scilit]
- Tousi, N.; Eini, O.; Ahmadvand, R.; Carra, A.; Miozzi, L.; Noris, E.; Accotto, G.P. In silico prediction of miRNAs targeting ToLCV and their regulation in susceptible and resistant tomato plants. Australas. Plant Pathol. 2017, 46, 379–386. [Google Scholar] [CrossRef] [Scilit]
- The Czech National Programme on Conservation and Utilization of Microbial Genetic Resources Important for Agriculture. Available online: https://www.vurv.cz/microbes/Phytopathogenic%20Viruses.html (accessed on 20 October 2019).
- Jarosová, J.; Kundu, J.K. Validation of reference genes as internal control for studying viral infections in cereals by quantitative real-time RT-PCR. BMC Plant Biol. 2010, 10, 146. [Google Scholar] [CrossRef] [Scilit]
- Varkonyi-Gasic, E.; Wu, R.; Wood, M.; Walton, E.F.; Hellens, R.P. Protocol: A highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods 2007, 3, 12. [Google Scholar] [CrossRef] [Scilit]
- Turner, M.; Adhikari, S.; Subramanian, S. Optimizing stem-loop qPCR assays through multiplexed cDNA synthesis of U6 and miRNAs. Plant Signal. Behav. 2013, 8, e24918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferdous, J.; Li, Y.; Reid, N.; Langridge, P.; Shi, B.-J.; Tricker, P.J. Identification of reference genes for quantitative expression analysis of MicroRNAs and mRNAs in barley under various stress conditions. PLoS ONE 2015, 10, e0118503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ewels, P.; Magnusson, M.; Lundin, S.; Käller, M. MultiQC: Summarize analysis results for multiple tools and samples in a single report. Bioinformatics 2016, 32, 3047–3048. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef] [Scilit]
- Griffiths-Jones, S. The microRNA registry. Nucleic Acids Res. 2004, 32, D109–D111. [Google Scholar] [CrossRef] [Scilit]
- An, J.; Lai, J.; Sajjanhar, A.; Lehman, M.L.; Nelson, C.C. miRPlant: An integrated tool for identification of plant miRNA from RNA sequencing data. BMC Bioinform. 2014, 15, 275. [Google Scholar] [CrossRef] [Scilit]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Scilit]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Scilit]
- Singh, K.; Zouhar, M.; Mazakova, J.; Ryšánek, P. Genome Wide Identification of the Immunophilin Gene Family in Leptosphaeria maculans: A Causal Agent of Blackleg Disease in Oilseed Rape (Brassica napus). Omics A J. Integr. Biol. 2014, 18, 645–657. [Google Scholar] [CrossRef] [Scilit]
- Garrison, E.; Marth, G. Haplotype-based variant detection from short-read sequencing. ArXiv 2012, arXiv:1207.3907. [Google Scholar]
- Wang, W.; Galili, G. Tuning the Orchestra: miRNAs in Plant Immunity. Trends Plant Sci. 2019, 24, 189–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Curaba, J.; Talbot, M.; Li, Z.; Helliwell, C. Over-expression of microRNA171 affects phase transitions and floral meristem determinancy in barley. BMC Plant Biol. 2013, 13, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Curaba, J.; Spriggs, A.; Taylor, J.; Li, Z.; Helliwell, C. miRNA regulation in the early development of barley seed. BMC Plant Biol. 2012, 12, 120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fard, E.M.; Bakhshi, B.; Keshavarznia, R.; Nikpay, N.; Shahbazi, M.; Salekdeh, G.H. Drought responsive microRNAs in two barley cultivars differing in their level of sensitivity to drought stress. Plant Physiol. Biochem. 2017, 118, 121–129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferdous, J.; Sanchez-Ferrero, J.C.; Langridge, P.; Milne, L.; Chowdhury, J.; Brien, C.; Tricker, P.J. Differential expression of microRNAs and potential targets under drought stress in barley. Plant Cell Environ. 2017, 40, 11–24. [Google Scholar] [CrossRef] [Scilit]
- Ferdous, J.; Whitford, R.; Nguyen, M.; Brien, C.; Langridge, P.; Tricker, P.J. Drought-inducible expression of Hv-miR827 enhances drought tolerance in transgenic barley. Funct. Integr. Genom. 2017, 17, 279–292. [Google Scholar] [CrossRef] [Scilit]
- Hackenberg, M.; Gustafson, P.; Langridge, P.; Shi, B. Differential expression of micro RNA s and other small RNA s in barley between water and drought conditions. Plant Biotechnol. J. 2015, 13, 2–13. [Google Scholar] [CrossRef] [Scilit]
- Kantar, M.; Unver, T.; Budak, H. Regulation of barley miRNAs upon dehydration stress correlated with target gene expression. Funct. Integr. Genom. 2010, 10, 493–507. [Google Scholar] [CrossRef] [Scilit]
- Kruszka, K.; Pacak, A.; Swida-Barteczka, A.; Nuc, P.; Alaba, S.; Wroblewska, Z.; Karlowski, W.; Jarmolowski, A.; Szweykowska-Kulinska, Z. Transcriptionally and post-transcriptionally regulated microRNAs in heat stress response in barley. J. Exp. Bot. 2014, 65, 6123–6135. [Google Scholar] [CrossRef] [Scilit]
- Hackenberg, M.; Shi, B.-J.; Gustafson, P.; Langridge, P. Characterization of phosphorus-regulated miR399 and miR827 and their isomirs in barley under phosphorus-sufficient and phosphorus-deficient conditions. BMC Plant Biol. 2013, 13, 214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hackenberg, M.; Huang, P.-J.; Huang, C.-Y.; Shi, B.-J.; Gustafson, P.; Langridge, P. A comprehensive expression profile of microRNAs and other classes of non-coding small RNAs in barley under phosphorous-deficient and-sufficient conditions. DNA Res. 2012, 20, 109–125. [Google Scholar] [CrossRef] [Scilit]
- Ozhuner, E.; Eldem, V.; Ipek, A.; Okay, S.; Sakcali, S.; Zhang, B.; Boke, H.; Unver, T. Boron stress responsive microRNAs and their targets in barley. PLoS ONE 2013, 8, e59543. [Google Scholar] [CrossRef] [Scilit]
- Mutum, R.D.; Balyan, S.C.; Kansal, S.; Agarwal, P.; Kumar, S.; Kumar, M.; Raghuvanshi, S. Evolution of variety-specific regulatory schema for expression of osa-miR408 in indica rice varieties under drought stress. FEBS J. 2013, 280, 1717–1730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, K.; Talla, A.; Qiu, W. Small RNA profiling of virus-infected grapevines: Evidences for virus infection-associated and variety-specific miRNAs. Funct. Integr. Genom. 2012, 12, 659–669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mitter, N.; Koundal, V.; Williams, S.; Pappu, H. Differential Expression of Tomato Spotted Wilt Virus-Derived Viral Small RNAs in Infected Commercial and Experimental Host Plants. PLoS ONE 2013, 8, e76276. [Google Scholar] [CrossRef] [Scilit]
- Silva, T.F.; Romanel, E.A.C.; Andrade, R.R.S.; Farinelli, L.; Østerås, M.; Deluen, C.; Corrêa, R.L.; Schrago, C.E.G.; Vaslin, M.F.S. Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus. BMC Mol. Biol. 2011, 12, 40. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Andika, I.B.; Shen, J.; Lv, Y.; Ji, Y.; Sun, L.; Chen, J. Characterization of rice black-streaked dwarf virus-and rice stripe virus-derived siRNAs in singly and doubly infected insect vector Laodelphax striatellus. PLoS ONE 2013, 8, e66007. [Google Scholar] [CrossRef] [Scilit]
- Donaire, L.; Barajas, D.; Martínez-García, B.; Martínez-Priego, L.; Pagán, I.; Llave, C. Structural and genetic requirements for the biogenesis of tobacco rattle virus-derived small interfering RNAs. J. Virol. 2008, 82, 5167–5177. [Google Scholar] [CrossRef] [Scilit]
- Qi, X.; Bao, F.S.; Xie, Z. Small RNA deep sequencing reveals role for Arabidopsis thaliana RNA-dependent RNA polymerases in viral siRNA biogenesis. PLoS ONE 2009, 4, e4971. [Google Scholar] [CrossRef] [Scilit]
- Ogwok, E.; Ilyas, M.; Alicai, T.; Rey, M.E.C.; Taylor, N.J. Comparative analysis of virus-derived small RNAs within cassava (Manihot esculenta Crantz) infected with cassava brown streak viruses. Virus Res. 2016, 215, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahu, P.P.; Rai, N.K.; Puranik, S.; Roy, A.; Khan, M.; Prasad, M. Dynamics of defense-related components in two contrasting genotypes of tomato upon infection with Tomato Leaf Curl New Delhi Virus. Mol. Biotechnol. 2012, 52, 140–150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, A.; Li, G.; Zhao, Y.; Meng, Z.; Zhao, M.; Li, C.; Zhang, Y.; Li, P.; Ma, C.-L.; Xia, H. Combined small RNA and gene expression analysis revealed roles of miRNAs in maize response to rice black-streaked dwarf virus infection. Sci. Rep. 2018, 8, 13502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, Q.; Hollunder, J.; Niehl, A.; Kørner, C.J.; Gereige, D.; Windels, D.; Arnold, A.; Kuiper, M.; Vazquez, F.; Pooggin, M. Specific impact of tobamovirus infection on the Arabidopsis small RNA profile. PLoS ONE 2011, 6, e19549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blevins, T.; Rajeswaran, R.; Shivaprasad, P.V.; Beknazariants, D.; Si-Ammour, A.; Park, H.-S.; Vazquez, F.; Robertson, D.; Meins, F., Jr.; Hohn, T. Four plant Dicers mediate viral small RNA biogenesis and DNA virus induced silencing. Nucleic Acids Res. 2006, 34, 6233–6246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Csorba, T.; Bovi, A.; Dalmay, T.; Burgyán, J. The p122 subunit of Tobacco Mosaic Virus replicase is a potent silencing suppressor and compromises both small interfering RNA-and microRNA-mediated pathways. J. Virol. 2007, 81, 11768–11780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vogler, H.; Akbergenov, R.; Shivaprasad, P.V.; Dang, V.; Fasler, M.; Kwon, M.-O.; Zhanybekova, S.; Hohn, T.; Heinlein, M. Modification of small RNAs associated with suppression of RNA silencing by tobamovirus replicase protein. J. Virol. 2007, 81, 10379–10388. [Google Scholar] [CrossRef] [Scilit]
- Penzo, M.; Guerrieri, A.; Zacchini, F.; Treré, D.; Montanaro, L. RNA pseudouridylation in physiology and medicine: For better and for worse. Genes 2017, 8, 301. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Karijolich, J.; Glaunsinger, B.; Zhou, Q. Pseudouridylation of 7SK snRNA promotes 7SK snRNP formation to suppress HIV-1 transcription and escape from latency. EMBO Rep. 2016, 17, 1441–1451. [Google Scholar] [CrossRef] [Scilit]
- Bunik, V.I.; Fernie, A.R. Metabolic control exerted by the 2-oxoglutarate dehydrogenase reaction: A cross-kingdom comparison of the crossroad between energy production and nitrogen assimilation. Biochem. J. 2009, 422, 405–421. [Google Scholar] [CrossRef] [Scilit]
- Graf, A.; Trofimova, L.; Loshinskaja, A.; Mkrtchyan, G.; Strokina, A.; Lovat, M.; Tylicky, A.; Strumilo, S.; Bettendorff, L.; Bunik, V.I. Up-regulation of 2-oxoglutarate dehydrogenase as a stress response. Int. J. Biochem. Cell Biol. 2013, 45, 175–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Araujo, W.L.; Nunes-Nesi, A.; Trenkamp, S.; Bunik, V.I.; Fernie, A.R. Inhibition of 2-oxoglutarate dehydrogenase in potato tuber suggests the enzyme is limiting for respiration and confirms its importance in nitrogen assimilation. Plant Physiol. 2008, 148, 1782–1796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jia, M.; Li, Y.; Lei, L.; Di, D.; Miao, H.; Fan, Z. Alteration of gene expression profile in maize infected with a double-stranded RNA fijivirus associated with symptom development. Mol. Plant Pathol. 2012, 13, 251–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sattar, S.; Song, Y.; Anstead, J.A.; Sunkar, R.; Thompson, G.A. Cucumis melo microRNA expression profile during aphid herbivory in a resistant and susceptible interaction. Mol. Plant Microbe Interact. 2012, 25, 839–848. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, X.; Shao, Y.; Jiang, J.; Du, X.; Sheng, L.; Chen, F.; Fang, W.; Guan, Z.; Chen, S. MicroRNA expression profile during aphid feeding in chrysanthemum (Chrysanthemum morifolium). PLoS ONE 2015, 10, e0143720. [Google Scholar] [CrossRef] [Scilit]








| Length | Reads | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Vir08:3-Healthy | Vir08:3-Aphids | Vir08:3-BYDV | Vir13:8-Healthy | Vir13:8-Aphids | Vir13:8-BYDV | Wysor-Healthy | Wysor-Aphids | Wysor-BYDV | |
| 17 nt | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 18 nt | 682,998 | 682,560 | 745,280 | 811,167 | 645,012 | 452,149 | 416,998 | 532,958 | 331,169 |
| 19 nt | 331,899 | 306,980 | 264,569 | 185,988 | 187,166 | 158,464 | 236,887 | 281,412 | 164,734 |
| 20 nt | 222,129 | 223,179 | 246,226 | 228,309 | 264,705 | 204,136 | 199,589 | 198,959 | 154,057 |
| 21 nt | 133,407 | 151,047 | 173,220 | 182,222 | 238,100 | 152,760 | 127,623 | 128,664 | 127,267 |
| 22 nt | 175,074 | 202,756 | 191,915 | 183,252 | 207,757 | 164,975 | 188,409 | 172,958 | 194,110 |
| 23 nt | 647,606 | 642,026 | 521,699 | 743,495 | 545,439 | 553,835 | 616,627 | 459,322 | 510,693 |
| 24 nt | 3103 | 2950 | 3041 | 3563 | 5634 | 2891 | 3685 | 3420 | 3277 |
| 25 nt | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Total | 2,196,216 | 2,211,498 | 2,145,950 | 2,337,996 | 2,093,813 | 1,689,210 | 1,789,818 | 1,777,693 | 1,485,307 |
| No. of Novel miRNAs | No. of Annotated Novel miRNAs | No. of RNA Families |
|---|---|---|
| 680 | 662 | 161 |
| Ten most abundant RNA families | ||
| RNA family ID | No. of novel miRNA | RNA type |
| RF00906 | 159 | MIR1122 |
| RF00100 | 33 | 7SK |
| RF00028 | 31 | Intron_gpl |
| RF00001 | 29 | 5S_rRNA |
| RF00230 | 27 | T-box |
| RF01766 | 18 | cspA |
| RF01417 | 18 | RSV_RNA |
| RF00026 | 17 | U6 |
| RF01959 | 16 | SSU_rRNA_archaea |
| Name of miRNA | No. of Strikes | miRNA Sequence | Accession ID ** | Annotation |
|---|---|---|---|---|
| Novel miRNA10778 | 5 | gaggtctctgtagatgatga | AK364815 | Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex |
| Novel miRNA144 | 5 | aaggtccctgacgtctggtac | AK363491 | Fructose-1,6-bisphosphatase class 1 |
| Novel miRNA1724 | 5 | ccattatagaatgatgctggcgt | AK361660 | Receptor-like protein kinase |
| Novel miRNA2226 | 5 | ttgccgagagctgctcagat | MLOC_44527.2 | Unknown protein |
| Novel miRNA22504 | 5 | ctttgtcatagttactctgatag | AK357280 | tRNA pseudouridine synthase family protein |
| Novel miRNA2944 | 5 | gtttatagtggaatctctaaaag | MLOC_61720.1 | S-adenosylmethionine synthase |
| Novel miRNA36460 | 4 | ggatagagcatggagaacgta | AK364238 | Ent-copalyl diphosphate synthase |
| Novel miRNA4701 | 4 | tttaaaaccggtttgtatcaca | ||
| Novel miRNA7557 | 4 | aattttatcgcgatcgga | AK376576 | Potassium transporter 10 |
| Novel miRNA7558 | 4 | aattttatcgcgatcgga | AK376576 | Potassium transporter 10 |
| Novel miRNA14068 | 4 | gacgactagatagcgacaggctc | MLOC_72356.1 | Lachrymatory factor synthase |
| Novel miRNA18320 | 4 | agtcttcgcgtctggatggacga | MLOC_69330.1 | Retrotransposon protein, putative, Ty1-copia subclass |
| Novel miRNA24228 | 4 | tttaaaaccggtttgtatcaca | ||
| Novel miRNA30197 | 4 | atccaacggtgcggacgcgcggg | AK375972 | L-lactate dehydrogenase |
| Hvu-miR6188 * | 4 | gguggaucgaugaacccggcga | MLOC_67894.2 | Aquaporin |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jarošová, J.; Singh, K.; Chrpová, J.; Kundu, J.K. Analysis of Small RNAs of Barley Genotypes Associated with Resistance to Barley Yellow Dwarf Virus. Plants 2020, 9, 60. https://doi.org/10.3390/plants9010060
Jarošová J, Singh K, Chrpová J, Kundu JK. Analysis of Small RNAs of Barley Genotypes Associated with Resistance to Barley Yellow Dwarf Virus. Plants. 2020; 9(1):60. https://doi.org/10.3390/plants9010060
Chicago/Turabian StyleJarošová, Jana, Khushwant Singh, Jana Chrpová, and Jiban Kumar Kundu. 2020. "Analysis of Small RNAs of Barley Genotypes Associated with Resistance to Barley Yellow Dwarf Virus" Plants 9, no. 1: 60. https://doi.org/10.3390/plants9010060
APA StyleJarošová, J., Singh, K., Chrpová, J., & Kundu, J. K. (2020). Analysis of Small RNAs of Barley Genotypes Associated with Resistance to Barley Yellow Dwarf Virus. Plants, 9(1), 60. https://doi.org/10.3390/plants9010060

