Antioxidant, Anti-Inflammation, and Melanogenesis Inhibition of Sang 5 CMU Rice (Oryza sativa) Byproduct for Cosmetic Applications
Abstract
1. Introduction
2. Results
2.1. Crude Extracts Preparation
2.2. Scavenging Activity
2.2.1. Antioxidant Effects of Sang 5 CMU Extracts against DPPH, ABTS Radicals, and Ferrous Ion
2.2.2. Antioxidant Effects of Sang 5 CMU Extracts after H2O2-induced Oxidative Stress in Fibroblast Cells
2.2.3. Effects of Sang 5 CMU Extracts on Gene Expression of Antioxidant-Related Genes
2.3. Anti-Inflammation
2.3.1. Anti-Inflammation Effects of Sang 5 CMU Extracts after LPS-Induced Inflammation in Murine Macrophage and Human Fibroblast Cells
2.3.2. Effects of Sang 5 CMU Extracts on Gene Expression of Inflammation-Related Genes
2.4. Anti-Melanogenesis Activity
2.4.1. Inhibitory Effects of Sang 5 CMU Extracts against Mushroom Tyrosinase Enzyme
2.4.2. Inhibitory Effects of Sang 5 CMU Extracts after IBMX-Induced Melanogenesis in Human Melanoma Cells
2.4.3. Effects of Sang 5 CMU Extracts on Gene Expression of Melanogenesis-Related Genes
2.5. Collagen-Synthesis-Promoting Activity
2.5.1. MMP-2 Inhibition Effects of Sang 5 CMU Extracts in Human Fibroblast Cells
2.5.2. Effects of Sang 5 CMU Extracts on Gene Expression of Collagen-Synthesis-Related Gene
3. Discussion
4. Materials and Methods
4.1. Sample Preparation
4.2. Cell Culture and Cell Viability Assessment
4.3. Scavenging Activity
4.3.1. DPPH Radical Scavenging Assay
4.3.2. ABTS Radical Scavenging Assay
4.3.3. Ferrous Ion Chelating Assay
4.3.4. Thiobarbituric Acid Reactive Substances Assay in Human Fibroblast Cells
4.4. Anti-Inflammatory Activity
Nitrite Concentration Assay in Murine Macrophage and Human Fibroblast Cells
4.5. Anti-Melanogenesis Activity
4.5.1. Mushroom Tyrosinase Inhibition Assay
4.5.2. Melanin Content Assay in Human Melanoma Cells
4.5.3. Intracellular Tyrosinase Inhibition Assay in Human Melanoma Cells
4.6. Collagen-Synthesis-Promoting Activity
MMP-2 Inhibition Assay in Human Fibroblast Cells
4.7. Semi-Quantitative Reverse Transcription and Polymerase Chain Reaction
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Choubey, V.; Sarkar, R.; Garg, V.; Kaushik, S.; Ghunawat, S.; Sonthalia, S. Role of oxidative stress in melasma: A prospective study on serum and blood markers of oxidative stress in melasma patients. Int. J. Dermatol. 2017, 56, 939–943. [Google Scholar] [CrossRef]
- Xue, N.; Liu, Y.; Jin, J.; Ji, M.; Chen, X. Chlorogenic acid prevents UVA-induced skin photoaging through regulating collagen metabolism and apoptosis in human dermal fibroblasts. Int. J. Mol. Sci. 2022, 23, 6941. [Google Scholar] [CrossRef] [PubMed]
- Hseu, Y.-C.; Chen, X.-Z.; Vudhya Gowrisankar, Y.; Yen, H.-R.; Chuang, J.-Y.; Yang, H.-L. The skin-whitening effects of ectoine via the suppression of α-MSH-stimulated melanogenesis and the activation of antioxidant Nrf2 pathways in UVA-irradiated keratinocytes. Antioxidants 2020, 9, 63. [Google Scholar] [CrossRef] [PubMed]
- Boo, Y.C. Natural Nrf2 modulators for skin protection. Antioxidants 2020, 9, 812. [Google Scholar] [CrossRef] [PubMed]
- Seo, S.-H.; Jeong, G.-S. Fisetin inhibits TNF-α-induced inflammatory action and hydrogen peroxide-induced oxidative damage in human keratinocyte HaCaT cells through PI3K/AKT/Nrf-2-mediated heme oxygenase-1 expression. Int. Immunopharmacol. 2015, 29, 246–253. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, N.T.; Fisher, D.E. MITF and UV responses in skin: From pigmentation to addiction. Pigment Cell Melanoma Res. 2019, 32, 224–236. [Google Scholar] [CrossRef] [PubMed]
- Kim, N.-H.; Lee, A.-Y. Oxidative stress induces skin pigmentation in melasma by inhibiting hedgehog signaling. Antioxidants 2023, 12, 1969. [Google Scholar] [CrossRef]
- Gillbro, J.; Olsson, M. The melanogenesis and mechanisms of skin-lightening agents–existing and new approaches. Int. J. Cosmet. Sci. 2011, 33, 210–221. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Hong, Y.; Kim, M. Structural and functional changes and possible molecular mechanisms in aged skin. Int. J. Mol. Sci. 2021, 22, 12489. [Google Scholar] [CrossRef]
- McCabe, M.C.; Hill, R.C.; Calderone, K.; Cui, Y.; Yan, Y.; Quan, T.; Fisher, G.J.; Hansen, K.C. Alterations in extracellular matrix composition during aging and photoaging of the skin. Matrix Biol. Plus 2020, 8, 100041. [Google Scholar] [CrossRef]
- Quan, T. Human skin aging and the anti-aging properties of retinol. Biomolecules 2023, 13, 1614. [Google Scholar] [CrossRef] [PubMed]
- FAO. Medium-Term Projections for World Cereal Markets for the Period 2023–2032; Food and Agriculture Organisation of the United States (FAO): Rome, Italy, 2023; pp. 143–157. [Google Scholar]
- Linsaenkart, P.; Ruksiriwanich, W.; Jantrawut, P.; Chittasupho, C.; Rachtanapun, P.; Jantanasakulwong, K.; Sommano, S.R.; Prom-U-Thai, C.; Jamjod, S.; Arjin, C. Natural melanogenesis inhibitor, antioxidant, and collagen biosynthesis stimulator of phytochemicals in rice bran and husk extracts from purple glutinous rice (Oryza sativa L. cv. Pieisu 1 CMU) for cosmetic application. Plants 2023, 12, 970. [Google Scholar] [CrossRef]
- Khantham, C.; Yooin, W.; Sringarm, K.; Sommano, S.R.; Jiranusornkul, S.; Carmona, F.D.; Nimlamool, W.; Jantrawut, P.; Rachtanapun, P.; Ruksiriwanich, W. Effects on steroid 5-alpha reductase gene expression of Thai rice bran extracts and molecular dynamics study on SRD5A2. Biology 2021, 10, 319. [Google Scholar] [CrossRef] [PubMed]
- Kordi, M.; Farrokhi, N.; Pech-Canul, M.I.; Ahmadikhah, A. Rice husk at a glance: From agro-industrial to modern applications. Rice Sci. 2023, 31, 14–32. [Google Scholar] [CrossRef]
- Chugh, P.; Kaur, J.; Soni, R.; Sharma, A.; Soni, S.K. A low-cost process for efficient hydrolysis of deoiled rice bran and ethanol production using an inhouse produced multi-enzyme preparation from Aspergillus niger P-19. J. Mater. Cycles Waste Manag. 2023, 25, 359–375. [Google Scholar] [CrossRef]
- Plaskova, A.; Mlcek, J. New insights of the application of water or ethanol-water plant extract rich in active compounds in food. Front. Nutr. 2023, 10, 1118761. [Google Scholar] [CrossRef]
- Wisetkomolmat, J.; Arjin, C.; Hongsibsong, S.; Ruksiriwanich, W.; Niwat, C.; Tiyayon, P.; Jamjod, S.; Yamuangmorn, S.; Prom-U-Thai, C.; Sringarm, K. Antioxidant activities and characterization of polyphenols from selected northern Thai rice husks: Relation with seed attributes. Rice Sci. 2023, 30, 148–159. [Google Scholar] [CrossRef]
- Wisetkomolmat, J.; Arjin, C.; Satsook, A.; Seel-Audom, M.; Ruksiriwanich, W.; Prom-u-Thai, C.; Sringarm, K. Comparative analysis of nutritional components and phytochemical attributes of selected Thai rice bran. Front. Nutr. 2022, 9, 833730. [Google Scholar] [CrossRef]
- Cai, Y.-Z.; Sun, M.; Xing, J.; Luo, Q.; Corke, H. Structure–radical scavenging activity relationships of phenolic compounds from traditional Chinese medicinal plants. Life Sci. 2006, 78, 2872–2888. [Google Scholar] [CrossRef]
- Man, M.-Q.; Wakefield, J.S.; Mauro, T.M.; Elias, P.M. Regulatory role of nitric oxide in cutaneous inflammation. Inflammation 2022, 45, 949–964. [Google Scholar] [CrossRef]
- Młynarczyk, G.; Gudowska-Sawczuk, M.; Mroczko, B.; Bruczko-Goralewska, M.; Romanowicz, L.; Tokarzewicz, A. Higher content but no specific activity in gelatinase B (MMP-9) compared with gelatinase A (MMP-2) in human renal carcinoma. Cancers 2023, 15, 5475. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, P.R.; Nascimento, L.D.; Gerlach, R.F.; Rodrigues, K.E.; Prado, A.F. Matrix metalloproteinase 2 as a pharmacological target in heart failure. Pharmaceuticals 2022, 15, 920. [Google Scholar] [CrossRef] [PubMed]
- Mo, Q.; Fu, H.; Zhao, D.; Zhang, J.; Wang, C.; Wang, D.; Li, M. Protective effects of mogroside v on oxidative stress induced by H2O2 in skin fibroblasts. Drug Des. Dev. Ther. 2021, 15, 4901–4909. [Google Scholar] [CrossRef] [PubMed]
- Cals-Grierson, M.-M.; Ormerod, A. Nitric oxide function in the skin. Nitric Oxide 2004, 10, 179–193. [Google Scholar] [CrossRef] [PubMed]
- Giustarini, D.; Rossi, R.; Milzani, A.; Dalle-Donne, I. Nitrite and nitrate measurement by Griess reagent in human plasma: Evaluation of interferences and standardization. Methods Enzymol. 2008, 440, 361–380. [Google Scholar]
- Ruksiriwanich, W.; Khantham, C.; Linsaenkart, P.; Chaitep, T.; Rachtanapun, P.; Jantanasakulwong, K.; Phimolsiripol, Y.; Režek Jambrak, A.; Nazir, Y.; Yooin, W. Anti-inflammation of bioactive compounds from ethanolic extracts of edible bamboo mushroom (Dictyophora indusiata) as functional health promoting food ingredients. Int. J. Food Sci. Technol. 2022, 57, 110–122. [Google Scholar] [CrossRef]
- Nazir, Y.; Linsaenkart, P.; Khantham, C.; Chaitep, T.; Jantrawut, P.; Chittasupho, C.; Rachtanapun, P.; Jantanasakulwong, K.; Phimolsiripol, Y.; Sommano, S.R. High efficiency in vitro wound healing of Dictyophora indusiata extracts via anti-Inflammatory and collagen stimulating (MMP-2 inhibition) mechanisms. J. Fungi 2021, 7, 1100. [Google Scholar] [CrossRef] [PubMed]
- Tošović, J.; Marković, S.; Marković, J.M.D.; Mojović, M.; Milenković, D. Antioxidative mechanisms in chlorogenic acid. Food Chem. 2017, 237, 390–398. [Google Scholar] [CrossRef] [PubMed]
- Bender, O.; Atalay, A. Polyphenol chlorogenic acid, antioxidant profile, and breast cancer. In Cancer; Elsevier: Amsterdam, The Netherlands, 2021; pp. 311–321. [Google Scholar]
- Liang, N.; Kitts, D.D. Role of chlorogenic acids in controlling oxidative and inflammatory stress conditions. Nutrients 2015, 8, 16. [Google Scholar] [CrossRef]
- Chen, R.; Qi, Q.-L.; Wang, M.-T.; Li, Q.-Y. Therapeutic potential of naringin: An overview. Pharm. Biol. 2016, 54, 3203–3210. [Google Scholar] [CrossRef]
- Akamo, A.J.; Rotimi, S.O.; Akinloye, D.I.; Ugbaja, R.N.; Adeleye, O.O.; Dosumu, O.A.; Eteng, O.E.; Amah, G.; Obijeku, A.; Cole, O.E. Naringin prevents cyclophosphamide-induced hepatotoxicity in rats by attenuating oxidative stress, fibrosis, and inflammation. Food Chem. Toxicol. 2021, 153, 112266. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Gao, S.; Guan, H.; Zhang, X.; Gao, Y.; Su, Y.; Song, Y.; Jiang, Y.; Li, N. Naringin protects human nucleus pulposus cells against TNF-α-induced inflammation, oxidative stress, and loss of cellular homeostasis by enhancing autophagic flux via AMPK/SIRT1 activation. Oxidative Med. Cell Longev. 2022, 2022, 7655142. [Google Scholar] [CrossRef] [PubMed]
- Mao, H.; Feng, Y.; Feng, J.; Yusufu, Y.; Sun, M.; Yang, L.; Jiang, Q. Quercetin-3-O-β-D-glucuronide attenuates osteoarthritis by inhibiting cartilage extracellular matrix degradation and inflammation. J. Orthop. Translat 2024, 45, 236–246. [Google Scholar] [CrossRef] [PubMed]
- Mohanty, S.; Konkimalla, V.B.; Pal, A.; Sharma, T.; Si, S.C. Naringin as sustained delivery nanoparticles ameliorates the anti-inflammatory activity in a Freund’s complete adjuvant-induced arthritis model. ACS Omega 2021, 6, 28630–28641. [Google Scholar] [CrossRef] [PubMed]
- Passeron, T.; Lim, H.W.; Goh, C.L.; Kang, H.; Ly, F.; Morita, A.; Ocampo Candiani, J.; Puig, S.; Schalka, S.; Wei, L. Photoprotection according to skin phototype and dermatoses: Practical recommendations from an expert panel. J. Eur. Acad. Dermatol. Venereol. 2021, 35, 1460–1469. [Google Scholar] [CrossRef] [PubMed]
- Ando, H.; Kondoh, H.; Ichihashi, M.; Hearing, V.J. Approaches to identify inhibitors of melanin biosynthesis via the quality control of tyrosinase. J. Investig. Dermat. 2007, 127, 751–761. [Google Scholar] [CrossRef] [PubMed]
- Jang, D.K.; Pham, C.H.; Lee, I.S.; Jung, S.-H.; Jeong, J.H.; Shin, H.-S.; Yoo, H.M. Anti-melanogenesis activity of 6-O-isobutyrylbritannilactone from Inula britannica on B16F10 melanocytes and in vivo zebrafish models. Molecules 2020, 25, 3887. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Di, T.; Wang, W.; Jiang, H. EGCG, GCG, TFDG, or TSA inhibiting melanin synthesis by downregulating MC1R expression. Int. J. Mol. Sci. 2023, 24, 11017. [Google Scholar] [CrossRef]
- Zhang, X.; Li, J.; Li, Y.; Liu, Z.; Lin, Y.; Huang, J.-a. Anti-melanogenic effects of epigallocatechin-3-gallate (EGCG), epicatechin-3-gallate (ECG) and gallocatechin-3-gallate (GCG) via down-regulation of cAMP/CREB/MITF signaling pathway in B16F10 melanoma cells. Fitoterapia 2020, 145, 104634. [Google Scholar] [CrossRef]
- Henriksen, K.; Karsdal, M. Type I collagen. In Biochemistry of Collagens, Laminins and Elastin; Elsevier: Amsterdam, The Netherlands, 2024; pp. 1–11. [Google Scholar]
- Lago, J.C.; Puzzi, M.B. The effect of aging in primary human dermal fibroblasts. PLoS ONE 2019, 14, e0219165. [Google Scholar] [CrossRef]
- Gomathi, K.; Gopinath, D.; Ahmed, M.R.; Jayakumar, R. Quercetin incorporated collagen matrices for dermal wound healing processes in rat. Biomaterials 2003, 24, 2767–2772. [Google Scholar] [CrossRef] [PubMed]
- Castangia, I.; Nácher, A.; Caddeo, C.; Valenti, D.; Fadda, A.M.; Díez-Sales, O.; Ruiz-Saurí, A.; Manconi, M. Fabrication of quercetin and curcumin bionanovesicles for the prevention and rapid regeneration of full-thickness skin defects on mice. Acta Biomater. 2014, 10, 1292–1300. [Google Scholar] [CrossRef] [PubMed]
- Shin, E.J.; Lee, J.S.; Hong, S.; Lim, T.-G.; Byun, S. Quercetin directly targets JAK2 and PKCδ and prevents UV-induced photoaging in human skin. Int. J. Mol. Sci. 2019, 20, 5262. [Google Scholar] [CrossRef]
- Sheng, Y.-Y.; Xiang, J.; Lu, J.-L.; Ye, J.-H.; Chen, Z.-J.; Zhao, J.-W.; Liang, Y.-R.; Zheng, X.-Q. Protective effects of gallocatechin gallate against ultraviolet B induced skin damages in hairless mice. Sci. Rep. 2022, 12, 1310. [Google Scholar] [CrossRef] [PubMed]
- Jackson, J.K.; Zhao, J.; Wong, W.; Burt, H.M. The inhibition of collagenase induced degradation of collagen by the galloyl-containing polyphenols tannic acid, epigallocatechin gallate and epicatechin gallate. J. Mater. Sci. Mater. Med. 2010, 21, 1435–1443. [Google Scholar] [CrossRef]
- Yu, X.; Li, J.; Yang, M.; Chen, C.; Munir, S.; You, J.; Yin, T.; Liu, R.; Xiong, S.; Hu, Y. Role of epigallocatechin gallate in collagen hydrogels modification based on physicochemical characterization and molecular docking. Food Chem. 2021, 360, 130068. [Google Scholar] [CrossRef]
- Lee, Y.; Lim, H.-W.; Ryu, I.W.; Huang, Y.-H.; Park, M.; Chi, Y.M.; Lim, C.-J. Anti-inflammatory, barrier-protective, and antiwrinkle properties of Agastache rugosa Kuntze in human epidermal keratinocytes. Biomed. Res. Int. 2020, 2020, 1759067. [Google Scholar] [CrossRef]
- Ruksiriwanich, W.; Khantham, C.; Sringarm, K.; Sommano, S.; Jantrawut, P. Depigmented Centella asiatica extraction by pretreated with supercritical carbon dioxide fluid for wound healing application. Processes 2020, 8, 277. [Google Scholar] [CrossRef]
- Nguyen, C.N.; Kim, H.E.; Lee, S.G. Caffeoylserotonin protects human keratinocyte HaCaT cells against H2O2-induced oxidative stress and apoptosis through upregulation of HO-1 expression via activation of the PI3K/Akt/Nrf2 pathway. Phytother. Res. 2013, 27, 1810–1818. [Google Scholar] [CrossRef]
- Gao, X.; Xu, D.; Zhang, X.; Zhao, H. Protective effect of lemon peel polyphenols on oxidative stress-induced damage to human keratinocyte hacat cells through activation of the NRF2/HO-1 signaling pathway. Front. Nutr. 2021, 7, 606776. [Google Scholar] [CrossRef]
- Garcin, G.; Le Gallic, L.; Stoebner, P.E.; Guezennec, A.; Guesnet, J.; Lavabre-Bertrand, T.; Martinez, J.; Meunier, L. Constitutive Expression of MC1R in HaCaT Keratinocytes Inhibits Basal and UVB-induced TNF-α Production. Photochem. Photobiol. 2009, 85, 1440–1450. [Google Scholar] [CrossRef] [PubMed]
- Cui, B.; Wang, Y.; Jin, J.; Yang, Z.; Guo, R.; Li, X.; Yang, L.; Li, Z. Resveratrol treats UVB-induced photoaging by anti-MMP expression, through anti-inflammatory, antioxidant, and antiapoptotic properties, and treats photoaging by upregulating VEGF-B expression. Oxidative Med. Cell Longev. 2022, 1, 6037303. [Google Scholar] [CrossRef] [PubMed]
- Javelaud, D.; Alexaki, V.I.; Pierrat, M.J.; Hoek, K.S.; Dennler, S.; Van Kempen, L.; Bertolotto, C.; Ballotti, R.; Saule, S.; Delmas, V. GLI2 and M-MITF transcription factors control exclusive gene expression programs and inversely regulate invasion in human melanoma cells. Pigment Cell Melanoma Res. 2011, 24, 932–943. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liu, P.; Fu, H.; Wang, D.; Zhao, D.; Zhang, J.; Wang, C.; Li, M. Effects of Lactobacillus kefiri fermentation supernatant on skin aging caused by oxidative stress. J. Funct. Foods 2022, 96, 105222. [Google Scholar] [CrossRef]









| Substances (mg/g Sample) | Defatted Rice Bran Extract | Rice Husk Extract |
|---|---|---|
| Caffeic acid | 0.16 ± 0.01 | 0.20 ± 0.03 |
| Epicatechin | 0.22 ± 0.05 | ND |
| Epigallocatechin gallate | 0.42 ± 0.03 | 2.80 ± 0.04 |
| p-Coumaric | 0.23 ± 0.04 | 0.16 ± 0.00 |
| o-Coumaric | 0.55 ± 0.03 | 2.49 ± 0.04 |
| Naringin | 0.58 ± 0.08 | 6.60 ± 2.15 |
| Naringenin | ND | 0.33 ± 0.00 |
| Quercetin | 1.27 ± 0.01 | 0.59 ± 0.03 |
| Phytic acid | ND | 19.42 ± 0.34 |
| Ferulic acid | 0.22 ± 0.00 | 0.76 ± 0.04 |
| Chlorogenic acid | 0.79 ± 0.01 | 1.90 ± 0.10 |
| Kaempferol | 0.07 ± 0.01 | 0.13 ± 0.00 |
| Hydroxybenzoic acid | 0.48 ± 0.03 | 0.53 ± 0.01 |
| Sample | IC50 (mg/mL) | ||
|---|---|---|---|
| DPPH | ABTS | Iron Chelation | |
| Defatted rice bran extract (DFRB) | 0.98 ± 0.24 b | 0.33 ± 0.00 a | 0.70 ± 0.05 a |
| Husk extract (H) | 2.97 ± 0.07 a | 0.39 ± 0.00 a | 0.51 ± 0.01 b |
| Trolox | 0.42 ± 0.00 c | 0.06 ± 0.00 b | ND |
| EDTA | ND | ND | 0.03 ± 0.00 c |
| Sample | Mushroom Tyrosinase Inhibition |
|---|---|
| DFRB | 0.49 ± 0.00 a |
| H | 0.27 ± 0.02 b |
| Arbutin | 0.24 ± 0.06 b |
| Gene | Forward Sequence (5′ to 3′) | Reverse Sequence (5′ to 3′) | Reference |
|---|---|---|---|
| NRF2 | AAACCAGTGGATCTGCCAAC | GTTGGCAGATCCACTGGTTT | Nguyen et al. [52] |
| HO-1 | AACTTTCAGAAGGGCCAGGT | ACCTGGCCCTTCTGAAAGTT | Gao et al. [53] |
| IL-1β | CTGAGCTCGCCAGTGAATG | CATTCACTGGCGAGCTCAG | Garcin et al. [54] |
| IL-6 | ACTCACCTCTTCAGAACGAATTG | CAATTCGTTCTGAAGAGGTGAGT | Cui et al. [55] |
| MITF | ACCGTCTCTCACTGGATTGGT | ACCAATCCAGTGAGAGACGGT | Javelaud et al. [56] |
| TYR | TTGGCATAGACTCTTCTTGTTGCGG | CCGCAACAAGAAGAGTCTATGCCAA | Javelaud et al. [56] |
| TRP-1 | TGGCAAAGCGCACAACTCACCC | GGGTGAGTTGTGCGCTTTGCCA | Javelaud et al. [56] |
| DCT | TGTGGAGACTGCAAGTTTGGC | GCCAAACTTGCAGTCTCCACA | Javelaud et al. [56] |
| COL1A1 | GTGCGATGACGTGATCTGTGA | TCACAGATCACGTCATCGCAC | Zhang et al. [57] |
| GAPDH | GGAAGGTGAAGGTCGGAGTC | CTCAGCCTTGACGGTGCCATG | Khantham et al. [14] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Linsaenkart, P.; Ruksiriwanich, W.; Muangsanguan, A.; Sommano, S.R.; Sringarm, K.; Arjin, C.; Rachtanapun, P.; Jantanasakulwong, K.; Castagnini, J.M.; Chutoprapat, R.; et al. Antioxidant, Anti-Inflammation, and Melanogenesis Inhibition of Sang 5 CMU Rice (Oryza sativa) Byproduct for Cosmetic Applications. Plants 2024, 13, 1795. https://doi.org/10.3390/plants13131795
Linsaenkart P, Ruksiriwanich W, Muangsanguan A, Sommano SR, Sringarm K, Arjin C, Rachtanapun P, Jantanasakulwong K, Castagnini JM, Chutoprapat R, et al. Antioxidant, Anti-Inflammation, and Melanogenesis Inhibition of Sang 5 CMU Rice (Oryza sativa) Byproduct for Cosmetic Applications. Plants. 2024; 13(13):1795. https://doi.org/10.3390/plants13131795
Chicago/Turabian StyleLinsaenkart, Pichchapa, Warintorn Ruksiriwanich, Anurak Muangsanguan, Sarana Rose Sommano, Korawan Sringarm, Chaiwat Arjin, Pornchai Rachtanapun, Kittisak Jantanasakulwong, Juan M. Castagnini, Romchat Chutoprapat, and et al. 2024. "Antioxidant, Anti-Inflammation, and Melanogenesis Inhibition of Sang 5 CMU Rice (Oryza sativa) Byproduct for Cosmetic Applications" Plants 13, no. 13: 1795. https://doi.org/10.3390/plants13131795
APA StyleLinsaenkart, P., Ruksiriwanich, W., Muangsanguan, A., Sommano, S. R., Sringarm, K., Arjin, C., Rachtanapun, P., Jantanasakulwong, K., Castagnini, J. M., Chutoprapat, R., & Boonpisuttinant, K. (2024). Antioxidant, Anti-Inflammation, and Melanogenesis Inhibition of Sang 5 CMU Rice (Oryza sativa) Byproduct for Cosmetic Applications. Plants, 13(13), 1795. https://doi.org/10.3390/plants13131795

