Detection and Quantification of Milk Ingredients as Hidden Allergens in Meat Products by a Novel Specific Real-Time PCR Method
Abstract
1. Introduction
2. Materials and Methods
2.1. Reference Model Mixtures
2.2. Validation Mixtures and Commercial Samples
2.3. Thermal Treatments
2.4. DNA Extraction
2.5. Oligonucleotide Primers and Probes
2.6. Qualitative PCR
2.7. Real-Time PCR
2.8. ELISA
2.9. Statistical Analysis
3. Results and Discussion
3.1. Development of the Analytical Method
3.1.1. Absolute and Relative Sensitivity
3.1.2. Construction and Validation of the Normalized Quantitative Model
3.1.3. Effect of Food Matrix and Thermal Treatment
3.2. Analysis of Commercial Samples
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Spychaj, A.; Pospiech, E.; Iwanska, E.; Montowska, M. Detection of allergenic additives in processed meat products. J. Sci. Food Agric. 2018, 98, 4807–4815. [Google Scholar] [CrossRef] [Scilit]
- Flom, J.D.; Sicherer, S.H. Epidemiology of Cow’s Milk Allergy. Nutrients 2019, 11, 1051. [Google Scholar] [CrossRef] [Scilit]
- Matricardi, P.; Kleine-Tebbe, J.; Hoffmann, H.; Valenta, R.; Hilger, C.; Hofmaier, S.; Aalberse, R.; Agache, I.; Asero, R.; Ballmer-Weber, B. EAACI molecular allergology user’s guide. Pediatr. Allergy Immunol. 2016, 27, 1–250. [Google Scholar] [CrossRef] [Scilit]
- Morisset, M.; Moneret-Vautrin, D.A.; Kanny, G.; Guénard, L.; Beaudouin, E.; Flabbée, J.; Hatahet, R. Thresholds of clinical reactivity to milk, egg, peanut and sesame in immunoglobulin E-dependent allergies: Evaluation by double-blind or single-blind placebo-controlled oral challenges. Clin. Exp. Allergy 2003, 33, 1046–1051. [Google Scholar] [CrossRef] [Scilit]
- Taylor, S.L.; Baumert, J.L.; Kruizinga, A.G.; Remington, B.C.; Crevel, R.W.R.; Brooke-Taylor, S.; Allen, K.J.; Houben, G. Establishment of reference doses for residues of allergenic foods: Report of the VITAL expert panel. Food Chem. Toxicol. 2014, 63, 9–17. [Google Scholar] [CrossRef] [Scilit]
- Costa, J.; Fernandes, T.J.R.; Villa, C.; Oliveira, M.B.P.P.; Mafra, I. Advances in food allergen analysis. In Food Safety: Innovative Analytical Tools for Safety Assessment; Spizzirri, G., Cirillo, G., Eds.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2017; pp. 305–360. [Google Scholar]
- Boo, C.C.; Parker, C.H.; Jackson, L.S. A targeted LC-MS/MS method for the simultaneous detection and quantitation of egg, milk, and peanut allergens in sugar cookies. J. AOAC Int. 2018, 101, 108–117. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Zhang, J.; Ke, X.; Lai, S.; Tao, B.; Yang, J.; Mo, W.; Ren, Y. Quantification of bovine β-casein allergen in baked foodstuffs based on ultra-performance liquid chromatography with tandem mass spectrometry. Food Addit. Contam. Part A Chem. 2015, 32, 25–34. [Google Scholar] [CrossRef] [Scilit]
- Pilolli, R.; De Angelis, E.; Monaci, L. In house validation of a high resolution mass spectrometry Orbitrap-based method for multiple allergen detection in a processed model food. Anal. Bioanal. Chem. 2018, 410, 5653–5662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Planque, M.; Arnould, T.; Delahaut, P.; Renard, P.; Dieu, M.; Gillard, N. Development of a strategy for the quantification of food allergens in several food products by mass spectrometry in a routine laboratory. Food Chem. 2019, 274, 35–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, K.; Liu, T.; Yang, Y.; Zhang, J.; Yin, J.; Ding, X.; Qin, W.; Yang, Y. A rapid immobilized trypsin digestion combined with liquid chromatography—Tandem mass spectrometry for the detection of milk allergens in baked food. Food Control 2019, 102, 179–187. [Google Scholar] [CrossRef] [Scilit]
- Decastelli, L.; Gallina, S.; Manila Bianchi, D.; Fragassi, S.; Restani, P. Undeclared allergenic ingredients in foods from animal origin: Survey of an Italian region’s food market, 2007–2009. Food Addit. Contam. Part B Surveill. 2012, 5, 160–164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, P.E.; Rigby, N.M.; Dainty, J.R.; Mackie, A.R.; Immer, U.U.; Rogers, A.; Titchener, P.; Shoji, M.; Ryan, A.; Mata, L.; et al. A multi-laboratory evaluation of a clinically-validated incurred quality control material for analysis of allergens in food. Food Chem. 2014, 148, 30–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khuda, S.; Slate, A.; Pereira, M.; Al-Taher, F.; Jackson, L.; Diaz-Amigo, C.; Bigley, E.C., 3rd; Whitaker, T.; Williams, K. Effect of processing on recovery and variability associated with immunochemical analytical methods for multiple allergens in a single matrix: Dark chocolate. J. Agric. Food Chem. 2012, 60, 4204–4211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Török, K.; Horváth, V.; Horváth, Á.; Hajas, L.; Bugyi, Z.; Tömösközi, S. Investigation of incurred single- and multi-component model food matrices for determination of food proteins triggering allergy and coeliac disease. Eur. Food Res. Technol. 2014, 239, 923–932. [Google Scholar] [CrossRef] [Scilit]
- Xiao, G.; Qin, C.; Wenju, Z.; Qin, C. Development of a real-time quantitative PCR assay using a TaqMan minor groove binder probe for the detection of α-lactalbumin in food. J. Dairy Sci. 2016, 99, 1716–1724. [Google Scholar] [CrossRef] [Scilit]
- Poms, R.E.; Klein, C.L.; Anklam, E. Methods for allergen analysis in food: A review. Food Addit. Contam. 2004, 21, 1–31. [Google Scholar] [CrossRef] [Scilit]
- Villa, C.; Costa, J.; Gondar, C.; Oliveira, M.B.P.P.; Mafra, I. Effect of food matrix and thermal processing on the performance of a normalised quantitative real-time PCR approach for lupine (Lupinus albus) detection as a potential allergenic food. Food Chem. 2018, 262, 251–259. [Google Scholar] [CrossRef] [Scilit]
- Villa, C.; Costa, J.; Oliveira, M.B.P.P.; Mafra, I. Cow’s milk allergens: Screening gene markers for the detection of milk ingredients in complex meat products. Food Control 2020, 108, 106823. [Google Scholar] [CrossRef] [Scilit]
- López-Andreo, M.; Lugo, L.; Garrido-Pertierra, A.; Prieto, M.I.; Puyet, A. Identification and quantitation of species in complex DNA mixtures by real-time polymerase chain reaction. Anal. Biochem. 2005, 339, 73–82. [Google Scholar] [CrossRef] [Scilit]
- Costa, J.; Oliveira, M.B.P.P.; Mafra, I. Effect of thermal processing on the performance of the novel single-tube nested real-time PCR for the detection of walnut allergens in sponge cakes. Food Res. Int. 2013, 54, 1722–1729. [Google Scholar] [CrossRef] [Scilit]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- ENGL. Definition of Minimum Performance Requirements for Analytical Methods of GMO testing. European NETWOrk of GMO laboratories, Joint Research Center, EURL. Available online: http://gmo-crl.jrc.ec.europa.eu/doc/MPR%20Report%20Application%2020_10_2015.pdf (accessed on 21 July 2019).
- Kalogianni, D.P. DNA-based analytical methods for milk authentication. J. Agric. Food Chem. 2018, 244, 775–793. [Google Scholar] [CrossRef] [Scilit]
- Köppel, R.; Dvorak, V.; Zimmerli, F.; Breitenmoser, A.; Eugster, A.; Waiblinger, H.-U. Two tetraplex real-time PCR for the detection and quantification of DNA from eight allergens in food. Eur. Food Res. Technol. 2010, 230, 367–374. [Google Scholar] [CrossRef] [Scilit]
- Köppel, R.; Velsen-Zimmerli, F.; Bucher, T. Two quantitative hexaplex real-time PCR systems for the detection and quantification of DNA from twelve allergens in food. Eur. Food Res. Technol. 2012, 235, 843–852. [Google Scholar] [CrossRef] [Scilit]
- Costa, J.; Amaral, J.S.; Grazina, L.; Oliveira, M.B.P.P.; Mafra, I. Matrix-normalised real-time PCR approach to quantify soybean as a potential food allergen as affected by thermal processing. Food Chem. 2017, 221, 1843–1850. [Google Scholar] [CrossRef] [Scilit]
- Soares, S.; Amaral, J.S.; Oliveira, M.B.P.P.; Mafra, I. A SYBR Green real-time PCR assay to detect and quantify pork meat in processed poultry meat products. Meat Sci. 2013, 94, 115–120. [Google Scholar] [CrossRef] [Scilit]
- Martín-Fernández, B.; Costa, J.; Oliveira, M.B.P.P.; López-Ruiz, B.; Mafra, I. Combined effects of matrix and gene marker on the real-time PCR detection of wheat. Int. J. Food Sci. Technol. 2016, 51, 1680–1688. [Google Scholar] [CrossRef] [Scilit]
- Waiblinger, H.-U.; Boernsen, B.; Näumann, G.; Koeppel, R. Ring trial validation of single and multiplex real-time PCR methods for the detection and quantification of the allergenic food ingredients sesame, almond, lupine and Brazil nut. J. Verbrauch. Lebensm. 2014, 9, 297–310. [Google Scholar] [CrossRef] [Scilit]
- Siegel, M.; Mutschler, A.; Boernsen, B.; Pietsch, K.; Waiblinger, H.-U. Food matrix standards for the quantification of allergenic food ingredients using real-time PCR. Eur. Food Res. Technol. 2013, 237, 185–197. [Google Scholar] [CrossRef] [Scilit]
- Regulation (EU) No 1169/2011 of 25 October 2011 on the provision of food information to consumers, amending Regulations (EC) No 1924/2006 and (EC) No 1925/2006 of the European Parliament and of the Council, and repealing Commission Directive 87/250/EEC, Council Directive 90/496/EEC, Commission Directive 1999/10/EC, Directive 2000/13/EC of the European Parliament and of the Council, Commission Directives 2002/67/EC and 2008/5/EC and Commission Regulation (EC) No 608/2004. Off. J. Eur. Union 2011, L304, 18–63. Available online: https://eur-lex.europa.eu/legal-content/EN/ALL/?uri=CELEX%3A32011R1169 (accessed on 30 November 2019).



| Primers | Sequence (5′→3′) | Amplicon (bp) | Target | Reference |
|---|---|---|---|---|
| 916 916-R 916-P | GTACTACTAGCAACAGCTTA AGACTGTATTAGCAAGAATTGGTG FAM-TCTAGAAGGATATAAAGCACCGCCAAGT-BHQ1 | 121 | 12S rRNA | [19] |
| EUK-F EUK-R S5 | AGCCTGCGGCTTAATTTGAC CAACTAAGAACGGCCATGCA FAM-AGGATTGACAGATTGAG-BHQ2 | 120 | 18S rRNA | [20] |
| 18SRG-F 18SRG-R | CTGCCCTATCAACTTTCGATGGTA TTGGATGTGGTAGCCGTTTCTCA | 113 | 18S rRNA | [21] |
| Parameter | Ham | Sausages | ||
|---|---|---|---|---|
| Raw | Cooked | Raw | Autoclaved | |
| Correlation coefficient (R2) | 0.951 | 0.980 | 0.990 | 0.961 |
| Slope | −3.265 | −3.450 | −3.122 | −3.203 |
| PCR efficiency (%) | 102.4 | 94.9 | 109.1 | 100.0 |
| Relative LOD (%) | 0.010 | 0.010 | 0.005 | 0.010 |
| Samples | Milk (% w/w) | SD 2 | CV 3 (%) | Bias (%) 4 | |
|---|---|---|---|---|---|
| Actual | Mean Predicted 1 | ||||
| Raw ham | |||||
| A | 4 | 4.70 | 0.41 | 8.7 | 18.2 |
| B | 0.8 | 1.46 | 0.12 | 8.1 | 82.9 |
| C | 0.4 | 0.46 | 0.08 | 16.1 | 15.8 |
| D | 0.2 | 0.07 | 0.02 | 16.0 | −65.4 |
| Cooked ham | |||||
| E | 4 | 4.50 | 0.59 | 1.3 | −11.6 |
| F | 0.8 | 0.70 | 0.12 | 17.4 | −10.8 |
| G | 0.4 | 0.40 | 0.09 | 23.7 | −5.0 |
| H | 0.2 | 0.17 | 0.04 | 19.7 | −14.5 |
| Raw sausages | |||||
| I | 2 | 1.59 | 0.30 | 19.1 | −20.4 |
| J | 0.4 | 0.48 | 0.05 | 9.5 | 21.0 |
| K | 0.2 | 0.15 | 0.03 | 21.8 | −25.5 |
| L | 0.02 | 0.023 | 0.006 | 24.9 | −15.20 |
| Cooked sausages | |||||
| M | 2 | 1.63 | 0.23 | 14.4 | −18.5 |
| N | 0.4 | 0.46 | 0.09 | 19.9 | 14.8 |
| O | 0.2 | 0.17 | 0.04 | 24.5 | −15.0 |
| P | 0.02 | 0.025 | 0.005 | 19.8 | 24.3 |
| Samples | Relevant Label Information | Qualitative PCR | Real-Time PCR | ELISA | |||
|---|---|---|---|---|---|---|---|
| 18SRG-F/18SRG-R | 916-F/916-R | EUK-F/EUK-R (Ct ± SD) 1 | 916-F/916-R (Ct ± SD) 1 | Estimated Milk Content (mg/kg) (mean ± SD) | Estimated Amount (mg/kg) (mean ± SD) 2 | ||
| Cooked hams (from pork) | |||||||
| 1 | Milk proteins | + 3 | - 4 | 26.60 ± 0.16 | 40.76 (1/3) 5 | <LOD 6 | <LOQ 7 |
| 2 | No information about milk | + | - | 29.57 ± 0.28 | 39.77 (1/3) | <LOD | <LOQ |
| 3 | No information about milk | + | - | 26.83 ± 1.21 | 45.58 (1/3) | <LOD | <LOQ |
| Cooked hams (from turkey) | |||||||
| 4 | May contain traces of milk | + | - | 21.88 ± 0.62 | 41.15 ± 1.10 (2/3) | <LOD | 3.95 ± 0.10 |
| 5 | May contain traces of milk | + | - | 25.38 ± 0.08 | (0/3) | ND 8 | <LOQ |
| 6 | Milk proteins | + | + | 19.56 ± 0.04 | 34.19 ± 0.27 (8/8) | 2050 ± 320 | 23300 ± 4722 9 |
| Sausages (from pork) | |||||||
| 7 | No information about milk | + | - | 23.75 ± 1.39 | 40.52 ± 0.90 (3/3) | <LOD | 8.02 ± 2.06 |
| 8 | No information about milk | + | - | 21.31 ± 1.80 | 40.35 ± 0.27 (2/3) | <LOD | <LOQ |
| 9 | No information about milk | + | + | 24.14 ± 0.40 | 39.99 ± 0.85 (3/3) | <LOD | <LOQ |
| Sausages (from turkey) | |||||||
| 10 | May contain traces of milk | + | - | 22.49 ± 0.17 | 39.90 (1/3) | <LOD | <LOQ |
| 11 | May contain traces of milk | + | - | 28.67 ± 0.14 | 41.91 ± 2.07 (3/3) | <LOD | <LOQ |
| 12 | May contain traces of milk | + | + | 18.67 ± 0.01 | 35.77 ± 0.60 (8/8) | 140 ± 30 | 94.5 ± 7.78 9 |
| 13 | Without milk addition | + | + | 20.05 ± 0.04 | 41.01 ± 1.90 (2/3) | <LOD | <LOQ |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Villa, C.; Costa, J.; Mafra, I. Detection and Quantification of Milk Ingredients as Hidden Allergens in Meat Products by a Novel Specific Real-Time PCR Method. Biomolecules 2019, 9, 804. https://doi.org/10.3390/biom9120804
Villa C, Costa J, Mafra I. Detection and Quantification of Milk Ingredients as Hidden Allergens in Meat Products by a Novel Specific Real-Time PCR Method. Biomolecules. 2019; 9(12):804. https://doi.org/10.3390/biom9120804
Chicago/Turabian StyleVilla, Caterina, Joana Costa, and Isabel Mafra. 2019. "Detection and Quantification of Milk Ingredients as Hidden Allergens in Meat Products by a Novel Specific Real-Time PCR Method" Biomolecules 9, no. 12: 804. https://doi.org/10.3390/biom9120804
APA StyleVilla, C., Costa, J., & Mafra, I. (2019). Detection and Quantification of Milk Ingredients as Hidden Allergens in Meat Products by a Novel Specific Real-Time PCR Method. Biomolecules, 9(12), 804. https://doi.org/10.3390/biom9120804
