Next Article in Journal
Study on the Mechanism of Ganoderma lucidum Polysaccharides for Ameliorating Dyslipidemia via Regulating Gut Microbiota and Fecal Metabolites
Previous Article in Journal
Mechanobiological Regulation of Alveolar Bone Remodeling: A Finite Element Study and Molecular Pathway Interpretation
Previous Article in Special Issue
Absolute Quantitative Metagenomic Analysis Provides More Accurate Insights for the Anti-Colitis Effect of Berberine via Modulation of Gut Microbiota
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

EruA, a Regulator of Adherent-Invasive E. coli, Enhances Bacterial Pathogenicity by Promoting Adhesion to Epithelial Cells and Survival Within Macrophages

1
School of Medicine, Southeast University, Ding Jiaqiao Street 87, Nanjing 210009, China
2
Department of Gastroenterology, Affiliated Zhongda Hospital, Southeast University, Ding Jiaqiao Street 87, Nanjing 210009, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Biomolecules 2026, 16(1), 152; https://doi.org/10.3390/biom16010152
Submission received: 31 October 2025 / Revised: 22 December 2025 / Accepted: 10 January 2026 / Published: 14 January 2026
(This article belongs to the Special Issue Recent Advances in Molecular Genetics of Bacteria)

Abstract

Adherent-invasive E. coli (AIEC) is closely related to inflammatory bowel disease (IBD). However, its pathogenic mechanism has not yet been fully elucidated. Using a BLASTP search, we discovered that the amino acid sequence of a putative protein (UFP37798.1) in the AIEC LF82 strain is highly homologous to some regulators in the SlyA family. We named it EruA. We displayed the secondary structures of EruA using bioinformatics, overexpressed the His6-tagged EruA protein using SDS-PAGE, and dissected the genetic organization of the eruA chromosomal region using 5′RACE. We constructed an eruA deletion mutant (ΔeruA) and a complementary strain (CΔeruA) of the LF82 strain. The transcriptomes of wild-type (WT) and ΔeruA bacteria were compared using RNA sequencing and qRT-PCR, thereby identifying 32 differentially expressed genes (DEGs). Based on YASARA software and EMSA analysis, EruA directly binds to the consensus sequences (PfimA and PtnaB) in the promoter region of the fimA and tnaB genes from these DEGs. By using a super-resolution confocal microscope (SCM), counting CFUs of colonies on plates, indole quantification, and crystal violet staining of biofilms adhered to tubes or 96-well plates, we found that EruA activates the fimA to promote bacterial adhesion to intestinal epithelial cells and activates the tnaB to enhance bacterial indole production and biofilm formation. Moreover, EruA helps AIEC resist environmental stress and enhances bacterial survival within macrophages as well as loading in mouse tissues. Notably, EruA promotes AIEC colonization in the colons of mice and exacerbates intestinal inflammation caused by bacterial infection in mice with DSS-induced inflammatory colitis, manifested by weight loss, colon length shortening, and pathological changes in colon tissues. Therefore, EruA plays a key role in the pathogenicity of AIEC.

1. Introduction

Inflammatory bowel disease (IBD), including Crohn’s disease (CD) and ulcerative colitis (UC), affects over a million people worldwide [1]. It has been hypothesized that genetically defective hosts respond to gut microbes, resulting in an inappropriate inflammatory response leading to IBD [2]. Adherent-invasive Escherichia coli (AIEC) is considered to be closely involved in the pathogenesis of IBD [3]. The pathogen is frequently isolated in the intestinal mucosa or mucosa-associated tissues of patients with CD [4]. Though no specific genetic signature has been identified in the genome of AIEC [5], its pathogenicity is rather subtle and complex, involving both the pathogen and the host. As its name suggests, AIEC possesses the ability to adhere to and invade intestinal epithelial cells [6]. For example, a carcinoembryonic antigen-associated cell adhesion molecule (ceacam) 6 is found to be overexpressed in the ileal mucosa of patients with CD, and a type I fimbria of AIEC interacts with the receptor of the ceacam 6 in the ileal epithelium, making it easier for the pathogen to adhere to the intestinal epithelial cells [7]. The fimbria on the bacterial surface is assembled from subunits, of which FimA is the main subunit, accounting for 95% of the total subunits. Moreover, the type I fimbria is one of the key structures for the formation of biofilm in bacteria such as Escherichia coli (E. coli) [8]. OmpR is a transcriptional regulator, and it is essential for the colonization of AIEC and bacterial tolerance to sodium deoxycholate [9]. In addition, another feature of AIEC that has been reported is that the pathogen is able to survive and replicate in phagolysosomes within macrophages [10]. When macrophages are infected by bacteria, the cells will produce reactive oxygen species (ROS) to eliminate the bacteria. In order to survive, AIEC has to adapt to the oxidative and acidic environment within macrophages [11]. A gene encoding an invasive brain endothelial protein A (IbeA) in AIEC facilitates the invasion of the pathogen into intestinal epithelial cells and enables its replication in macrophages [12]. AIEC assembles biofilm-like communities to protect the pathogen from various pressures within macrophages. RstA/RstB is a two-component system (TCS) that is required for the formation of biofilms in AIEC and helps the bacteria resist acidic stress and replicate within macrophages [13]. In addition, a tryptophanase (TnaA) in E. coli decomposes tryptophan to produce indole, and the production of indole is mainly dependent on a tryptophan-specific transporter (TnaB) [14]. Indole is a type of signaling molecule that regulates bacterial resistance, biofilm formation, and survival in host cells [15].
In addition, as AIEC has to adapt to oxidative and acidic environments within macrophages, transcriptional regulators are of great significance for the pathogen’s response to these environmental stresses. SlyA is a regulator in Salmonella typhimurium (S. typhimurium). It is a crucial regulatory factor that can increase bacterial metabolic activity and survival ability within macrophages, and it also contributes to the bacterial virulence [16,17]. However, SlyA in Enterococcus faecalis reduced bacterial persistence, survival, and virulence in an insect infection model [18]. Moreover, SlyA-like proteins are present in 118 species of bacteria, and in E. coli alone, there are 16 homologous proteins [19]. Members of the SlyA family include Rap, Hor, RovA, and Eha proteins from Serratia, Erwinia, Yersinia, and Edwardsiella, all of which are bacterial transcription factors [20]. The family uncovers a conserved architecture, a helix-turn-helix (HTH) domain, which connects a winged region with an α-helical dimerization domain [21]. The active form of SlyA exists in the form of a dimer in vitro [22]. We found that a putative protein (UFP37798.1) in the AIEC LF82 strain shared 92% homology with SlyA in the Salmonella enterica (S. enterica) subsp. indica strain. However, there are currently no reports on proteins similar to SlyA in AIEC.
In the present study, the secondary structure of the protein (UFP37798.1) was revealed based on bioinformatics analysis. The His6-tagged protein was overexpressed, as confirmed by SDS-PAGE analysis. The gene organization of the open reading frame (ORF) chromosomal region was dissected on the basis of 5′ rapid amplification of cDNA ends (5′RACE) analysis. We considered this ORF to be a gene and named it E. coli LF82 regulating gene (eruA) (GenBank accession number: MZ475355). To further demonstrate the function of the eruA gene, we constructed an eruA deletion mutant (ΔeruA) as well as a complementary strain (CΔeruA) of the AIEC LF82 strain. Under certain conditions, the transcriptomes of ΔeruA bacteria and wild-type (WT) bacteria were compared to identify some differentially expressed genes (DEGs). The main interaction sites between the consensus sequences in the promoters of the target genes from these DEGs and EruA were analyzed by bioinformatics methods. The results were verified by electrophoretic mobility shift assay (EMSA). Next, to gather evidence for the role of EruA in AIEC biology, we compared the biological effects of the WT and ΔeruA bacteria according to the function of their target genes. Finally, we found that EruA can enhance the bacterial survival ability within macrophages as well as the loading in mouse tissues. EruA promoted AIEC colonization in the colons of mice and exacerbated intestinal inflammation caused by bacterial infection in mice with DSS-induced inflammatory colitis, manifested by weight loss, colon length shortening, and pathological changes in colon tissues. Our work contributes to the understanding of the function of regulator EruA in AIEC, particularly its role in bacterial pathogenicity, which may influence the management of IBD.

2. Materials and Methods

2.1. Strains, Cells, and Growth Conditions

The AIEC LF82 strain was kindly provided by Prof. Moller-Jensen [23]. Plasmid pDS132 and E. coli SM10λpir were kindly supplied by Prof. Liang [24]. The plasmids and bacterial strains used in the study are listed in Table 1. All bacteria were grown in Luria-Bertani (LB) (Sunshine Biotechnology, Nanjing, China). Murine RAW 264.7 macrophage (CBP60533) and murine intestinal epithelial MODE-K cells (C495) were obtained from Nanjing Cobioer Biosciences Co., Ltd. (Nanjing, China). Human monocyte THP-1 cells (BH-C136) were obtained from Bohui Biotechnolog Co., Ltd. (Guangzhou, China). The RAW 264.7 macrophages and MODE-K cells were respectively cultured in Dulbecco’s Minimal Eagle Medium (DMEM; Gibco, Shanghai, China) and Roswell Park Memorial Institute (PRMI) 1640, supplemented with 10% (v/v) fetal calf serum (FCS) (Gibco, Shanghai, China) at 37 °C in a humidified incubator with less than 5% CO2.
THP-1 cells were grown in suspension with RPMI 1640, with glutamax supplemented with 10% FCS in the presence of phorbol 12-myristate-12 acetate (PMA; Sigma-Aldrich, St. Louis, MO, USA). The PMA was moved after two days of treatment.

2.2. Bioinformatic Analysis of EruA Structure

The amino acid sequence of EruA from the AIEC LF82 strain was compared with that of SlyA from Salmonella enterica subsp. indica using BLASTP (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 31 October 2026). Multiple sequence alignment was performed and optimized using Jalview software (version 2.11.3.0) for comparative analysis. Structural models of the EruA monomer and dimer were predicted using the AlphaFold Server (AlphaFold3, https://alphafoldserver.com/) with default parameters. To model the EruA-DNA interaction, the experimentally determined structure of the SlyA-DNA complex was used as a structural reference, and protein-double-stranded DNA complex prediction was performed using AlphaFold3.
Predicted models were evaluated based on established confidence metrics, including the interface predicted TM-score (ipTM). Models with an ipTM score ≥ 0.8 were considered high-confidence predictions and selected for downstream analyses, whereas models with ipTM scores < 0.6 were excluded due to insufficient reliability. Selected models were subsequently visualized and rendered using PyMOL software (version 3.0.3). Further optimization of hydrogen-bond networks and analysis of protein–DNA intermolecular interactions were conducted using YASARA (version 19.9.17). Protein–DNA interface residues and non-covalent interactions were identified using the Analyze > Interactions module with a distance cut-off of ≤4.0 Å.

2.3. 5′RACE Analysis of the eruA Gene Chromosomal Region

The identification of 5′ ends of the eruA transcripts was performed by the 5′RACE system (Sangon, Shanghai, China), as described in the manufacturer’s instructions. Total RNA was extracted from the AIEC LF82 strain, and cDNA was synthesized based on reverse transcription (RT) with the RC1145-RT3 and RC1145-RT4 primers (Table 2). In the middle amplification step, PCR was performed with primers RC1145-MZ-Y-F and RC1145-MZ-Y-R (Table 2), and the products were sequenced. For nested amplification, the first-round PCR was finished using the RC1145-R3 and 5′ adaptor primers, and the second-round PCR used the primers RC1145-R4 and 5.3′ outer primers (Table 2). Subsequently, sequencing products were carried out.

2.4. Cloning the eruA Gene

The X-F and X-R primers (Table 2) from the fragment were designed according to the genomic sequence of the AIEC LF82 strain (GenBank accession no: NC_011993). The fragment was amplified from the AIEC LF82 strain by PCR and sequencing. A 435 bp gene was digested with EcoR I and Hind Ⅲ and inserted into a pET28a+ vector with His6-tag at its N-terminus to produce a recombinant plasmid, pET28a-eruA. The recombinant plasmid and vector plasmid were respectively transformed into E. coli BL21 using the CaCl2 method. E. coli pET28a-eruA/BL21 (DE3) and pET28a+/BL21 (DE3) were obtained on plates containing kanamycin (50 μg/mL).

2.5. Expression and Purification of an EruA Protein in E. coli

The logarithmic phase pET28a-eruA/BL21 and pET28a+/BL21 strains were separately cultured in LB with kanamycin (50 μg/mL) at 37 °C until the OD600 reached 0.5. Next, a final concentration of 1 mM isopropyl β-D-1-thiogalactopyranosid (IPTG, Sigma-Aldrich, St. Louis, MO, USA) was added to induce protein production for 4 or 6 h at 30 °C. After these cultures were centrifuged, bacterial pellets were collected and dispersed in phosphate buffer saline (PBS). These bacterial suspensions were broken by ultrasonication on ice for 10 min at 400 W, and were centrifuged.
Next, a 200 mL logarithmic phase culture of the pET28a-eruA/BL21 was induced with 1 mM IPTG for 6 h at 30 °C. The bacterial pellets were harvested after centrifugation and dispersed in TieChui E. coli lysis buffer (ACE, Shuzhou, China) on ice for 30 min, and lysed by ultrasonication on ice for 10 min at 400 W, and then centrifuged. A His6-tagged EruA fusion protein was purified by affinity chromatography, following the manufacturer’s instructions for Protino NI-NTA Agarose (Gene Biotech, Shanghai, China), as described by Spriestersbach et al. [25].
The proteins from the supernatants were quantified with a bicinchoninic acid (BCA) protein assay kit (Yeasen, Shanghai, China) and separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The gels were stained with Coomassie brilliant blue.

2.6. Constructing an eruA Mutant (∆eruA), Complementary Strain, and LF 82-flu Strain

The mutant was constructed as described by Gao et al. [26], with minor modifications. In brief, a synthesized F1F2 fragment (Genewiz, Suzhou, China) was generated that encompassed the upstream and downstream regions of the eruA gene from the AIEC LF82 strain. The F1F2 fragment was ligated into a recombinant plasmid pDS132-F1F2 using a suicide vector pDS132. The recombinant plasmid was transformed into E. coli SM10λpir using the CaCl2 method, and then introduced into the AIEC LF82 strain by conjugation with SM10λpir. The conjugants (pDS132-F1F2/LF82 strain) were selected on LB plates containing 30 μg/mL chloramphenicol and 100 μg/mL ampicillin. An eruA mutant was obtained by selection on LB plates with 15% wt/vol sucrose and 30 μg/mL chloramphenicol. The eruA mutant was identified by PCR with F1-F/F2-R primers (Table 2) and was confirmed by sequencing (Sunshine, Nanjing, China). The eruA mutant was named ∆eruA.
The tnaB and fimA fragments were respectively amplified from the AIEC LF82 strain by PCR with the tnaB-F, tnaB-R, fimA-F, and fimA-R primers (Table 2) and inserted into the pET28a+ vector to produce two recombinant plasmids, pET28a-tnaB and pET28a-fimA. The recombinant plasmids, pACYC184-eruA, pET28a-tnaB, and pET28a-fimA, were transformed into ΔeruA bacteria to generate the complementary strains CΔeruA, ΔeruA-tnaB, and ΔeruA-fimA using the CaCL2 method. These complementary strains were confirmed by PCR with eruA-F, eruA-R, tnaB-F, tnaB-R, fimA-F, and fimA-R primers, respectively (Table 2).
A red fluorescence plasmid, pBBbr1mcs2-Tac-mcherry, was transformed into the wild type (WT), ΔeruA, CΔeruA, and ΔeruA-fimA of the LF 82 strain to produce the WT-flu, ΔeruA-flu, CΔeruA-flu, and ΔeruA-fimA-flu strain using the CaCl2 method.

2.7. RNA Extraction and Transcriptome Sequencing

The logarithmic phase WT and ΔeruA bacteria continued to grow in LB broth (pH 6.3) for 2 h at 37 °C. The two types of RNA were isolated using an RNA extraction kit (TaKaRa Bio, Dalian, China). The concentration, purity, and RIN (RNA integrity number) of these RNAs were inspected with Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and Agilent 2100 (Agilent Technologies, Santa Clara, CA, USA). The complementary DNA (cDNA) libraries were constructed. These samples were sequenced on the Illumina sequencing 2000 platform located in Shenzhen Hua Da Gene Co., Ltd. (Shenzhen, China). The raw data from RNA-sequencing were deposited in the NCBI SRA (Sequence Read Archive) database (BioProject number: PRJNA1070331).

2.8. Analysis of Differentially Expressed Genes (DEGs)

Clean reads were mapped onto the genome sequences of the reference AIEC LF82 strain (Genbank accession number: NC011993.1). The quality of transcriptome sequencing was evaluated. The differences in the gene expression between the WT and ΔeruA bacteria were compared, and the mRNA abundances were estimated using the expected number of fragments per kilobase of transcript sequenced per million base pairs sequenced (RPKM) method. If the differences in RPKM values of these genes between the two samples were |log2 fold change| ≥ 2, false discovery rate (FDR) ≤ 0.001, and p-value < 0.05, the genes were considered to be DEGs. The FDR adjusted the p-value. The functional classification of these DEGs was analyzed with Gene Ontology (GO).

2.9. Binding of the Consensus Sequences (PfimA or PtnaB) in the Promoter Region of fimA or tnaB Genes by EruA Detected by EMSA

For EMSA, oligonucleotide probes (PfimA, uPfimA, mPfimA, PtnaB, uPtnaB, and mPtnaB, Table 2) were synthesized in GenScript Biotech Co., Ltd. (Nanjing, China) using the conserved sequences in the promoter region of the fimA and tnaB genes and labeled or unlabeled with fluorescent CY3 at the 5′ end, and annealed. Experiments were performed in accordance with the manufacturer’s instructions for the LightShift™ Chemiluminescent EMSA optimization and control kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). The purified EruA protein was bound to 10 nM probes in EMSA buffer for 20 min at room temperature. The probe–EruA protein binding complexes were separated on 6% native polyacrylamide gels using a 0.5× Tris-Borate-EDTA (TBE) buffer system for 1.5 h at 4 °C. The resulting bands were detected using a Sapphire™ FL biomolecular imager (Azure Biosystems, Dublin, CA, USA) and analyzed with Sapphire Capture software (version 18.5).

2.10. Counting Colony-Forming Units (CFUs) of Colonies on Plates and Observing Under a Super-Resolution Confocal Microscope (SCM) for Adhesion to Cells

A MODE-K cell suspension (about 1 × 105 cell/mL) was added to a sterile coverslip in each well on a 24-well plate and incubated in RPMI with 10% FCS at 37 °C for 24 h. After log-phase bacterial suspensions (about 1 × 108 CFU/mL) were centrifuged, bacterial precipitates were washed with PBS and resuspended with 1640 containing 50 μg/mL kanamycin, either with or without 35 μg/mL chloramphenicol. After the MODE-K cells were infected by the WT-flu, ΔeruA-flu, or ΔeruA-fimA-flu bacteria for 20 min or 2 h at a multiplicity of infection (MOI) of 100:1 and were washed with PBS, the cells were lysed with 0.2% Triton X-100. Samples were diluted and plated on LB plates, either with or without 35 μg/mL chloramphenicol, overnight at 37 °C to count CFUs/mL. The CFUs/mL were determined as CFUs/mL × dilution ratio.
Then, the infected cells were permeabilized with 0.2% Triton X-100, washed with PBS, and incubated with EPCAM/CD326 goat anti-mouse polyclonal antibody (Proteintech, Wuhan, China) and Alexa Fluor 488-conjugated goat anti-rabbit polyclonal antibody (Servicebio, Wuhan, China) for 1 h at room temperature. Finally, the coverslips were mounted using fluoroshieldTM with DAPI (Sigma-Aldrich, St. Louis, MO, USA).
Images were captured using an SCM (Nikon A1R HD25, Tokyo, Japan) equipped with 100× oil-immersion objective, analyzed with an NIS Elements Viewer 5.21, and formatted using Image J software (version 1.0).

2.11. Determination of Indole Concentrations in Bacterial Cultures Using a p-Dimethylaminobenzaldehyde (p-DMAB)

This assay was performed as described previously [27]. First, an indole standard curve indicating the relationship between different concentrations of indole standard (Sinopharm, Shanghai, China) and the corresponding spectrophotometric absorbances (OD571) was established. Next, overnight, 2 mL bacterial cultures were sub-cultured into 200 mL LB broth, either without or with 35 μg/mL chloramphenicol at 37 °C. Five milliliters of bacterial culture were removed every 2 h from 2 to 18 h, and at 24 and 36 h, and centrifuged at 4000 rpm for 5 min. Then, the supernatants were filtered and added to the 200 µL p-DMAB developer. These mixtures were incubated in a boiling water bath for 10 min. The absorbance at OD571 was measured by an ultraviolet spectrophotometer. The relative indole concentrations were calculated from the indole standard curve.

2.12. Biofilm Assays with Crystal Violet Staining

Bacterial biofilm assays were stained with crystal violet, as previously described [27]. Five microliters of fresh bacterial suspension (about 1 × 108 CFU/mL) was added to 5 mL LB in a glass tube and incubated at 37 °C for designated times (24, 36, 48, 60, or 72 h). After discarding these cultures, the tubes were washed with PBS three times and stained with 1% crystal violet for 25 min. After the staining solutions were discarded, the tubes were washed with sterile water for 2 min three times. At the junction of culture and air, the purple biofilms were observed in the walls of the tubes.
Subsequently, 250 microliters of bacterial suspension (about 1 × 108 CFU/mL) were added to each well in a 96-well plate, and the suspensions were incubated for 48 h at 37 °C, with LB medium serving as a negative control. After discarding the cultures, the wells were fixed with 250 microliters of methanol and washed with PBS. The wells were stained with 1% crystal violet, and decolorized with 250 μL acetic acid for 25 min. The absorbance value at OD570 in each well was determined by an automatic microplate reader.

2.13. Bacterial Survival Rate in H2O2 or Acidic LB Medium

As previously described [26], logarithmic phase bacteria were cultured in LB broth with various concentrations of H2O2 (2, 5, or 10 mM), or in LB broth (pH 2.0 or 5.8) for 2 h at 37 °C. Bacteria grown in standard LB broth (pH 7.4) without H2O2 were used as the control group. After the treatment, bacteria were diluted and smeared on LB plates overnight at 37 °C. The bacterial survival rates were determined as the colony numbers in the experimental group/the colony numbers in the control group × 100%.

2.14. Bacterial Growth Curve

The fresh bacterial cultures were sub-cultured 1:100 into 200 mL LB broth or DMEM, either with or without 35 μg/mL chloramphenicol at 37 °C. Every hour, one milliliter of bacterial culture was taken out of each culture to measure its OD600. The growth curves of LB or DMEM at different times and with corresponding spectrophotometric absorbances (OD600) were established.

2.15. Intracellular Bacterial Replication Observed Under an SCM

Briefly, RAW 264.7 macrophage suspension (about 1 × 105 cells/mL) was added to a sterile coverslip in each well on a 24-well plate and incubated in DMEM with 10% FCS for 24 h at 37 °C. After the macrophages were infected by the WT-flu, ΔeruA-flu, or CΔeruA-flu bacteria in LB containing 50 μg/mL kanamycin, either with or without 35 μg/mL chloramphenicol for 20 min at a MOI of 100:1, the cells were cultured in DMEM containing 200 μg/mL gentamicin for 1 h to kill the bacteria outside the cells. Then, when these cells were further cultured using a fresh medium containing 30 μg/mL gentamicin, time was defined as 0 h.
Intracellular bacterial replication was observed under an SCM as previously described [13]. At designated times (1, 6, and 18 h) post-infection, the infected cells were washed with PBS and fixed with 4% paraformaldehyde for 10 min. Then, the infected cells were permeabilized with 0.2% Triton X-100 and washed with PBS. The coverslips were mounted using FluoroshieldTM with DAPI (Sigma-Aldrich, St. Louis, MO, USA). Images were captured using an SCM.

2.16. Counting CFUs/mL of Colonies on Plates for Intracellular Bacterial Replication

Bacterial intracellular replication in RAW 264.7 macrophages or THP-1 cells was assessed by counting CFUs/mL on plates as previously described [26]. Briefly, the cell suspension (about 1 × 105 cells/mL) was added to each well on a 24-well plate and incubated in DMEM or RPMI with 10% FCS for 24 h at 37 °C. The macrophages were infected by the WT, ΔeruA, or CΔeruA bacteria for 20 min at an MOI of 100:1. The cells were then cultured in DMEM or RPMI containing 200 μg/mL gentamicin for 1 h to kill the bacteria outside the cells, then fresh medium containing 30 μg/mL gentamicin, either with or without 35 μg/mL chloramphenicol, was used to continue incubating the cells and defined as 0 h. At designated time intervals (1, 6, and 18 h) post-infection, the infected cells were lysed with 0.2% Triton X-100, then the cell lysates were diluted and spread on LB agar plates, either with or without 35 μg/mL chloramphenicol. After overnight incubation at 37 °C, CFUs/mL were determined as CFUs × dilution ratio/mL.

2.17. RNA Extraction and qRT-PCR

The logarithmic phase WT or ΔeruA bacteria continued to grow in LB broth (pH 6.3) for 2 h at 37 °C. The two types of RNA were isolated using an RNA extraction kit (TaKaRa Bio, Dalian, China). The log-phase WT and ΔeruA bacteria of the AIEC LF82 strain were respectively cultivated in DMEM (pH 5.8 or 7.4) or in DMEM containing H2O2 (0 or 2 mM) for 2 h at 37 °C. In addition, the WT bacteria infected RAW 264.7 macrophages for 20 min at an MOI of 100:1. The extracellular bacteria were killed with DMEM containing 200 μg/mL gentamicin for 1 h, and defined as 0 h. The cells continued to be cultured in the fresh medium containing 30 μg/mL gentamicin for 1, 6, and 18 h. The WT bacteria grown in DMEM (pH 7.4) served as the control group. After centrifugation, the bacterial deposits were collected and treated with TRIzol reagent (TaKaRa Bio, Dalian, China), and the RNAs were isolated.
RNAs were reverse-transcribed using a PrimeScript™ RT reagent kit (Takara, Dalian). The qPCRs were conducted using SYBR Premix ExTaq (Takara, Dalian, China) in an ABI 7300 real-time detection system (Applied Biosystems, Carlsbad, CA, USA). The primers are shown in Table 2, and the 16S rRNA gene was used as a control. The transcriptional levels of these genes were compared using the 2−ΔΔCT method [28].

2.18. Bacterial Loads from Infected Mouse Tissues

All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Southeast University and were conducted in accordance with the ARRIVE guidelines (version 2.0) [29].
Six-week-old male C57BL/6 mice weighing 18–22 g were obtained from the Experimental Animal Center of Yangzhou University. Mice were raised under specific pathogen-free (SPF) conditions at the Experimental Animal Center of Southeast University. A total of 64 mice were randomly assigned to two experimental groups and intraperitoneally injected with either wild-type (WT) or ΔeruA bacteria.
After 7 d of habituation, each mouse was intraperitoneally injected with 0.2 mL containing 5 × 106 CFUs/mL of logarithmic-phase bacteria suspended in sterile normal saline (NS) as previously described [26]. Briefly, mice were sacrificed under anesthesia at 1, 3, 5, and 7 d post-infection, and organs (liver, kidney, and spleen) were harvested for preparation of tissue homogenates. A series of dilutions of these homogenates were smeared onto LB plates with 100 μg/mL ampicillin. The plates were incubated overnight at 37 °C. The CFUs/organ were determined as CFUs/organ × dilution ratio.

2.19. DSS-Induced and Non-Induced Mice Colitis Model

After 7 d of habituation, the mice were randomly divided into Control, DSS, WT, ΔeruA, DSS + ΔeruA, and DSS + WT groups, with 8 mice in each group, using a computer-generated random number sequence. The logarithmic-phage WT or ΔeruA bacteria were suspended in NS (5 × 109 CFUs/mL). The mice in the DSS, DSS + ΔeruA, and DSS + WT groups drank 2.5% (w/v) DSS (Aladdin Company, Shanghai, China) in distilled water for 5 d to induce colitis, while the mice in the Control, WT, and ΔeruA groups drank NS at the same time. In addition, the mice in the Control and DSS groups were given 200 μL/d distilled water by gavage for 8 d, while the mice in the other groups were given an equal volume of the WT or ΔeruA bacterial suspension at the same time. All mice were administered distilled water for 1 d before sacrifice (Figure 7A). During the experiment, the body weights of the six groups of mice were measured at the same time each day for 9 d. Humane endpoints were predefined: mice exhibiting more than 25% body-weight loss relative to baseline, persistent diarrhea for more than 3 consecutive days, or marked lethargy and anorexia were euthanized and excluded from further analyses. Detailed exclusion criteria and welfare considerations are provided in ARRIVE guidelines 2.0: author checklist.
Before sacrifice on day 17, all the mice in the six groups were anesthetized with isoflurane gas inhalation through a small animal anesthesia machine (RWD Life Science Co., Ltd., Shenzhen, China) and kept in a coma. The mice were anesthetized by inhalation of 4–5% isoflurane, and then 1.5–2% isoflurane was used to maintain anesthesia. Finally, the mice were executed by CO2 inhalation after anesthesia.
After the colons were excised, the colon lengths were measured. After removal of the colonic contents, part of the colon tissues were fixed with 4% paraformaldehyde, and the remaining fresh colon tissues were weighed and minced. Then, grinding beads were added to pulverize freshly minced tissues using a tissue crushing instrument. A series of dilutions of the samples were smeared onto LB plates with 100 μg/mL ampicillin. The plates were incubated overnight at 37 °C. The CFUs/g was CFUs × dilution ratio/weight of colon (g).

2.20. Hematoxylin and Eosin (H&E) Staining for Histological Analysis

Colonic tissue samples were fixed with 4% paraformaldehyde, embedded with paraffin, and sectioned (4 μm thick). The sections were stained with H&E, and histopathological scores were performed on the basis of the extent of inflammatory cell infiltration (0–5), crypt damage (0–4), ulceration (0–3), and edema (0 or 1) [30]. The parameters were calculated and summed to obtain the total score.

2.21. Statistical Analysis

Data are from at least three independent experiments and presented as the mean ± standard deviation (SD). GraphPad Prism (version 8.0) was used to analyze the data. Data from two or more groups were analyzed using a one-way analysis of variance (ANOVA), followed by John Wilder Tukey’s test. The difference was considered to be statistically significant for p values < 0.05.

3. Results

3.1. EruA Resembling SlyA in S. enterica Found in AIEC LF82 Strain

The secondary protein structure of EruA (UFP37798.1) was predicted using Alphafold3 software (Figure 1A). Its ipTM value was 0.81 (>0.8). By BLASTP and Jalview analysis, we observed that the amino acid sequence of EruA of the AIEC LF82 strain showed 92% identity and 97% similarity with that of SlyA of the S. enterica subsp. indica strain (Figure 1B). Secondary structure elements were annotated and visualized in PyMOL to support comparative structural analysis. In the EruA protein, the helices α1, α5, and α6 formed a dimerization domain, and the helices α3 and α4 formed a canonical HTH of DNA-binding domain. A wing-like region consisted of two antiparallel β-sheets and their connecting loop between helices α4 and α5 (Figure 1A). Based on alignments between EruA and SlyA proteins, the HTH domain was stabilized due to intramolecular hydrophobic interactions between Thr-36, Leu-37, Ile-40, Leu-52, Leu-63, Leu-67, and Leu-70. The helix α2 separates the upper dimerization domain from the lower DNA-binding domain. SlyA forms a dimer, which is an active form in vitro [22]. In the predicted structure, the EruA dimer adopted a triangular arrangement (Figure 1C). Analysis of the EruA dimer interface revealed that Leu-12 from one monomer interacted hydrophobically with Ile-130 and Leu-133 from another monomer in the dimerization domain. Two Leu-126 residues, one from each monomer, interacted with each other to form a hydrophobic dimer interface. Glu-59 and Arg-65 in each monomer formed an intermolecular salt bridge to anchor these helices. Similar to the SlyA-DNA model, the EruA dimer in the EruA-DNA model was located above the DNA duplex, with the DNA helical axis located beneath the symmetry axis of the dimer (Figure 1D).
The size of the ORF appears to be 435 bp, with an initiation codon TTG and a termination codon TGA, respectively. The initiation codon separated by six nucleotides is a putative ribosome binding site sequence (RBS), AGGAG. The eruA gene transcript was found using 5′RACE analysis (Figure 1E). We concluded that the A at the upstream of the TTG codon corresponded to the nucleotide +1 of the transcript. A putative 10 box (TAACAT) located eight nucleotides upstream from the transcriptional start point, and a putative sequence near the 35 box separated by 13 nucleotides was consensus ACATAA.
Next, we expressed a recombinant His6-tagged EruA protein, encoded by the eruA gene. A 17-kDa protein was obtained from the crude extract from E. coli pET28a-eruA/BL21 induced by IPTG, while no such protein was present in the crude extract from control E. coli pET28a+/BL21 (Figure 1F). The molecular weight of the protein based on the eruA gene was predicted to be 16.058 kDa, which, coupled with the size of His6 tags (0.8 kDa) from the pET28a-eruA plasmid, allowed a protein of about 17 kDa to be produced. The expression abundance of the EruA protein was higher for 6 h than for 4 h of induction. The protein may be a regulator like SlyA in the SlyA family.

3.2. The eruA Gene Encodes a Regulator in the AIEC LF82 Strain

As EruA may be a member of the SlyA family that can regulate some target genes in response to environmental stress [16,17], we simulated an oxidative or acidic environment to culture the LF82 strain in vitro, and compared the expression levels of the eruA gene in these conditions. The results showed that the highest expression level of the eruA was observed when the logarithmic phase LF82 strain was cultivated in LB broth (pH 6.3) for 2 h at 37 °C (Supplementary Materials; Figure S1). In this condition, the transcriptome of the WT bacteria was compared with that of the ΔeruA bacteria. Based on RNA sequencing, the WT bacterial group and the ΔeruA bacterial group, respectively, obtained a total of 96.15% and 95.33% of the read data, and all of these data were mapped onto the reference genome of the AIEC LF82 strain. Next, gene expression profiles of the two samples were compared using the RPKM algorithm. As shown in the volcano plot (Figure 2A), the results displayed that the expressions of DEGs were upregulated or downregulated in the ΔeruA bacteria, compared to the WT bacteria (Table S1).
Gene ontology (GO) was used to classify the functional annotations of these DEGs. A GO category analysis revealed that these DEGs were classified into three functional categories, including biological process, cellular component, and molecular function (Figure 2B). These DEGs were mainly involved in biological adhesion, biological regulation, cellular process, catalytic activity, response to stimulus, localization, metabolism, transport, binding, and transcription regulator activity, and so on. Among these DEGs, normalized reads for thirty-two genes that exhibited consistent expression changes were visualized in a heatmap (Figure 2C), and their differential expression was verified by qRT-PCR (Figure 2D). Functional annotation of these genes revealed representation of multiple biological categories, including regulators (SlyA (EruA), ArcA, PhoB, YbtA), two-component systems (EvgS/EvgA, PhoR, RstAB), transportors (MdtE/MdtF, ProV/ProW/ProX, MgtA, PstA/PstC, TnaB, TreB) or enzymes (DegP, GlcC/GlcB, NuoE/NuoF, SdhB, TnaA, TrpE, WecC, YiaK, HflC), and others (YbjX, FimA). For example, the expression level of the slyA (eruA) gene in ΔeruA was only 1/16th of that in the WT bacteria (Table S1). SlyA, an analogue of EruA, in Salmonella regulates some target genes and responds to the stimulation of hydrogen peroxide and sodium hypochlorite [31]. In E. coli, evgS/evgA encodes a two-component system, which enables the bacteria to adapt to acidic environments [32]. MdtEF-TolC is a proton-driven drug pump in E. coli and other bacteria in the intestines. Acid-modulated MdtEF-TolC allows these bacteria to survive in an extreme-acid environment [33]. The proteins encoded by these thirty-two DEGs may be related to the bacteria’s ability to resist oxidative or acidic stress, and so on, and their functions will be suggested in the discussion. These results indicate that deletion of eruA has a broad impact on the transcriptional landscape of AIEC LF82. Therefore, we think that the eruA gene in AIEC may be a regulator. It might regulate some target genes, enabling the pathogen to survive when facing environmental stresses.
Based on this broad regulatory signature and the presence of conserved promoter motifs in several candidate targets, we focused on tnaB and fimA genes for targeted validation. In the S. typhimurium LT2 strain, the binding site for SlyA is TTAN6TAA within the promoter region of its target genes and contains a near-perfect inverted repeat [22]. We found that the promoter regions of the fimA and tnaB genes from these DEGs possessed the consensus sequence TTAN6TAA (PfimA and PtnaB). Alphafold3 predicted the interaction of the EruA dimer with the consensus pseudo-palindromic DNA sequences of PfimA and PtnaB, supporting the hypothesis that EruA may directly engage these promoters to modulate transcription. The ipTM scores were 0.80 and 0.87. In the EruA-DNA complex, the DNA at the PfimA or PtnaB bent toward the bottom of the EruA dimer. The potential intermolecular interactions were further evaluated using YASARA software. The results reveal that hydrogen bonds were the predominant interaction force mediating the binding between the EruA dimer and the PfimA or PtnaB. A hydrogen bond between the EruA dimer and TTAAAGGGTTAA in the PtnaB is shown (Figure 3A). The N atom of Lys-88 in EruA formed a hydrogen bond with the O1 atom of the adenine 3 in the consensus sequences of the PtnaB with a hydrogen–oxygen distance of 1.88 Å and a bond energy of 10.55 kJ/mol. Some hydrogen bonds between EruA and TTAAGAGGATAA in the PfimA were observed (Figure 3B). The N2 atom of residue Gln-49 in EruA donated a hydrogen bond to the O2 atom of guanine 5 in the consensus sequences of the PfimA. The hydrogen bond distance was 1.88 Å with a calculated bond energy of 23.85 kJ/mol. The N atoms in the backbone and side chain of Lys-88 in EruA also had two hydrogen bonds with the O1 atoms of adenine 4 and guanine 5 in the sequences of the PfimA. The two hydrogen bond distances were 2.23 and 1.13 Å, with calculated bond energies of 18.50 and 17.20 kJ/mol, respectively.
Next, to further determine whether the purified EruA specifically bound to the consensus sequences in the promoter region of the fimA and tnaB, we performed EMSA. The lowest concentrations of EruA that fully bound to the 5′-CY3-labeled PfimA and PtnaB probes were determined, indicating that EruA had a higher affinity for PfimA than for PtnaB (Figure 3C,D). The EMSA results showed that EruA can bind to the CY3-labeled probes PfimA and PtnaB, but could not bind to the mutant probes mPfimA and mPtnaB. These bindings were competitively inhibited by high concentrations of the unlabeled probes uPfimA and uPtnaB (Figure 3E,F). The results show that EruA specifically bound to the TTAAGAGGATAA motif in the promoter region of the fimA gene and the TTAAAGGGTTAA motif in the promoter region of the tnaB gene. Compared with PtnaB, EruA required a higher concentration of unlabeled uPfimA probe to competitively inhibit the binding of labeled PfimA. This indicates that PfimA has a higher affinity for EruA, which is consistent with the results predicted by AlphaFold3. Therefore, the gene was identified as encoding a regulator, and was therefore designated as the gene E. coli LF82 strain regulating gene (eruA) (GenBank accession number: MZ475355).

3.3. EruA Activates fimA to Promote Bacterial Adhesion to Intestinal Epithelial Cells and tnaB to Increase Production of Indole and Formation of Biofilm

EruA directly regulates the fimA and tnaB of its target genes. FimA is a main subunit of type I fimbriae, which are related to bacterial adhesion [8]. We attempted to find whether EruA affects the adherence of AIEC to epithelial cells. After the MODE-K cells were infected by the AIEC LF 82 strain for 20 min or 2 h, the number of ∆eruA-flu bacteria adhering to MODE-K cells was less than that of WT-flu and ∆eruA-fimA-flu bacteria under an SCM (Figure 4A), and the number of ∆eruA bacteria was significantly lower than that of WT and ∆eruA-fimA bacteria determined by counting CFUs/mL on plates (p < 0.001; all three, p < 0.0001; Figure 4B). These results show that the eruA gene could activate the fimA gene to promote the adherence of the LF82 strain to epithelial cells.
TnaA (Tryptophanase) can catalyze tryptophan to generate indole, and tryptophan-specific transporter TnaB is used for transporting tryptophan [14]. Indole is a bacterial signal molecule that can participate in regulating processes such as biofilm formation [15]. We attempted to investigate whether the eruA deletion causes the LF82 strain to produce indole. The concentrations of indole in the supernatants of the WT, ∆eruA-tnaB, and ∆eruA bacteria at different culture time points were compared. The results showed that the concentrations increased rapidly in the first 2–12 h, and then decreased slowly for 14–36 h. At 36 h, the indole concentration of the ∆eruA bacteria was significantly different from that of the WT and ∆ eruA-tnaB bacteria (both, p < 0.0001; Figure 4C). These results show that the eruA gene can activate the tnaB gene to allow the LF82 strain to produce indole.
As indole is related to the formation of bacterial biofilm, we further explored whether deletion of eruA affects the biofilm. The biofilms formed by the LF82 strain at different times were deposited on glass tubes stained with crystal violet (Figure 4D). The results demonstrate that the biofilms began to form at 24 h and reached a mature state at 48 h. The biofilm of the ∆eruA bacteria was less than that of the WT and ∆eruA-tnaB bacteria. In a 96-well plate stained with crystal violet, the uninoculated LB medium was used as a negative control. After 48 h of cultivation, the biofilm formed by the ∆eruA bacteria was less than that of the WT bacteria and ∆eruA-tnaB bacteria (Figure 4E). The absorbance OD571 of the ∆eruA bacteria was significantly lower than that of the WT and ∆eruA-tnaB bacteria (p = 0.005, p = 0.013; Figure 4F). Therefore, these results show that the eruA gene can activate tnaB to promote the formation of bacterial biofilm.

3.4. EruA Helps AIEC Respond to Acidic and Oxidative Signals and Tolerate Environmental Stresses

Since some target genes from DEGs may be involved in the bacterial response to acidic or oxidative stress, we compare the survival rates of the ΔeruA and WT bacteria in a simulated gastric acidic environment, as well as acidic or oxidative environments of phagolysosomes within macrophages. In the acidified LB (pH 2), the rate of the ΔeruA bacteria was significantly lower than that of the WT and CΔeruA bacteria (p = 0.0012, p = 0.0064). In the less-acidified LB (pH 5.8), the rate of the ΔeruA bacteria was significantly lower than that of the WT and CΔeruA bacteria (both, p < 0.0001; Figure 5A). All survival rates of the ΔeruA bacteria were also significantly lower than those of the WT (p = 0.0212, p = 0.0095, and p = 0.0089) and CΔeruA (p = 0.0396, p = 0.0030, and p = 0.0083) bacteria in LB containing 10, 5, or 2 mM H2O2 (Figure 5B). However, in standard LB broth (pH 7.4; Figure 5C) and DMEM (pH 7.4; Figure 5D), the growth curve of the ∆eruA bacteria was not significantly different from that of the WT and C∆eruA bacteria. Therefore, EruA helps the LF82 strain adapt to acidic and oxidative environments.
Moreover, when the WT bacteria were cultured in acidified DMEM (pH 5.8), the expression level of the eruA gene was significantly different compared with cultures in standard DMEM (pH 7.4) (p < 0.0001; Figure 5E). There was also a significant difference in the expression level of the eruA gene between the LF82 strain cultured in the oxidative DMEM (containing 2 mM H2O2) and the strain cultured in the standard DMEM (without H2O2) (p < 0.0001; Figure 5F). Overall, these results suggest that the expression level of the eruA gene in the WT bacteria was upregulated under acidic or oxidative stress.
As indole functions as a signaling molecule involved in bacterial resistance [15], we investigated the tnaB expression in response to acidic or oxidative stress by measuring the tnaB mRNA levels in the WT and ΔeruA bacteria cultured in acidic or oxidative DMEM. The results indicated that compared with standard DMEM, acidic or oxidative treatment increased the expression of the tnaB in the WT bacteria (both, p < 0.0001). However, the ΔeruA bacteria abolished the upregulation of the tnaB induced by acidic or oxidative stress (p < 0.0082, p < 0.0001; Figure 5G,H). These results show that EruA could activate the tnaB gene and help the LF82 strain resist environmental stress.

3.5. EruA Promotes the Survival of AIEC Within Macrophages and Bacterial Virulence

As the eruA gene is involved in the bacterial response to stress signals and in tolerating environmental stresses, its protein may regulate the intracellular survival of AIEC within macrophages. First, we investigated the expression levels of the eruA gene in the LF82 strain when infected with RAW 264.7 macrophages (Figure 6A). The results showed that its expression levels gradually increased at 1, 6, and 18 h after the LF82 strain had infected the cells, and when only using standard DMEM for cultivation of the bacteria, those expression levels remained stable. The expression levels of eruA when the LF82 strain infected the cells were higher than those when only using standard DMEM for cultivation of the bacteria (p = 0.0118, both p < 0.0001). The results suggested that the upregulation of the eruA may contribute to AIEC adapting to the environment within macrophages. Next, we further investigated whether EruA affected the replication of AIEC within macrophages. It was observed under an SCM that intracellular numbers of the ΔeruA bacteria decreased in RAW 264.7 macrophages compared with those of the WT or CΔeruA bacteria (Figure 6B). The number of intracellular bacteria increased with the incubation time, as determined by counting CFUs/mL on LB plates (Figure 6C). The intracellular number of ΔeruA was significantly lower than that of the WT and CΔeruA bacteria after 1, 6, and 18 h of culture in RAW 264.7 macrophages (all p < 0.0001). The results of AIEC replication performed in THP-1 macrophages showed the same trend as RAW 264.7 macrophages at 1, 6, and 18 h (p < 0.001, p = 0.0204; all three, p < 0.0001; p < 0.001; Figure 6D). Overall, the results indicate that EruA affects the replication of AIEC within macrophages.
As bacterial replication within macrophages favors bacterial spread in animals, we compared the WT and ΔeruA bacterial loads in various organs in an i.p. infection mouse model. The results showed that compared with the WT bacteria, the ΔeruA bacteria had reduced dissemination to the livers (all three, p < 0.0001; p < 0.001; Figure 6E), spleens (both, p < 0.0001; p = 0.9660; p = 0.8733; Figure 6F), and kidneys (both, p < 0.0001; p = 0.6589; p = 0.3739; Figure 6G) on days 1, 3, 5, and 7 post-infection. In conclusion, these data suggest that EruA favors the virulence of AIEC.
Figure 6. EruA promotes the bacterial survival of the AIEC LF82 strain within macrophages and loading in mouse tissues. (A) The expression levels of the eruA gene of the LF82 strain grown in RAW 264.7 macrophages for 1, 6, and 18 h compared with those of the LF82 strain cultured in standard DMEM using qRT-PCR. (B) The numbers of WT-flu, ΔeruA-flu, and CΔeruA-flu bacteria cultured in RAW 264.7 macrophages for 1, 6, and 18 h of incubation observed under an SCM (scale bars, 10 µm; bacteria, red; cell nuclei, blue). The white arrows indicate the AIEC bacteria. (C) The number of ΔeruA bacteria cultured in RAW 264.7 macrophages compared with those of the WT or CΔeruA bacteria for 1, 6, and 18 h of incubation, as determined by counting CFUs/mL on LB plates. (D) The number of ΔeruA bacteria within THP-1 macrophages compared with those of the WT or CΔeruA bacteria for 1, 6, and 18 h of incubation, as determined by counting CFUs/mL on LB plates. (EG) Each mouse was intraperitoneally injected with the WT or ΔeruA bacteria. The bacterial loads of the WT or ΔeruA bacteria in the livers (E), spleens (F), and kidneys (G) were determined on days 1, 3, 5, and 7 post-infection by counting CFUs/mL on LB plates. Data are from three independent experiments and are represented as the mean ± SD. Statistical significance was assessed using one-way ANOVA, followed by Tukey’s test. Note: * p < 0.05, *** p < 0.001, **** p < 0.0001; ns, not significant.
Figure 6. EruA promotes the bacterial survival of the AIEC LF82 strain within macrophages and loading in mouse tissues. (A) The expression levels of the eruA gene of the LF82 strain grown in RAW 264.7 macrophages for 1, 6, and 18 h compared with those of the LF82 strain cultured in standard DMEM using qRT-PCR. (B) The numbers of WT-flu, ΔeruA-flu, and CΔeruA-flu bacteria cultured in RAW 264.7 macrophages for 1, 6, and 18 h of incubation observed under an SCM (scale bars, 10 µm; bacteria, red; cell nuclei, blue). The white arrows indicate the AIEC bacteria. (C) The number of ΔeruA bacteria cultured in RAW 264.7 macrophages compared with those of the WT or CΔeruA bacteria for 1, 6, and 18 h of incubation, as determined by counting CFUs/mL on LB plates. (D) The number of ΔeruA bacteria within THP-1 macrophages compared with those of the WT or CΔeruA bacteria for 1, 6, and 18 h of incubation, as determined by counting CFUs/mL on LB plates. (EG) Each mouse was intraperitoneally injected with the WT or ΔeruA bacteria. The bacterial loads of the WT or ΔeruA bacteria in the livers (E), spleens (F), and kidneys (G) were determined on days 1, 3, 5, and 7 post-infection by counting CFUs/mL on LB plates. Data are from three independent experiments and are represented as the mean ± SD. Statistical significance was assessed using one-way ANOVA, followed by Tukey’s test. Note: * p < 0.05, *** p < 0.001, **** p < 0.0001; ns, not significant.
Biomolecules 16 00152 g006

3.6. EruA Contributes to AIEC Colonization and Exacerbates Intestinal Inflammation in Mice with DSS-Induced Colitis and Those That Are DSS-Free

AIEC can replicate within macrophages in the mucous lamina propria of CD patients, resulting in the pathogen crossing the intestinal barrier and invading deeper tissues [4]. We investigated whether EruA contributes to AIEC colonizing in mice, both in mice with DSS-induced colitis and those that were DSS-free. Mice were orally administered 2.5% DSS or NS, with or without the WT or ΔeruA bacteria, on consecutive days (Figure 7A). From the third day of DSS induction, the body weights in the Control, WT, and ΔeruA groups increased (Figure 7B), whereas those in the DSS, DSS + ΔeruA, and DSS + WT groups decreased (Figure 7C). On day nine post-infection, the body weights in the DSS group were significantly lower than those in the Control, WT, and ΔeruA groups (all, p < 0.0001), and there were no significant differences in the body weights among the Control, WT, and ΔeruA groups (p = 0.9983, p = 0.9348, p = 0.9747; Figure 7B). The body weights in the DSS + WT group were significantly lower than those in the DSS or DSS + ΔeruA group (both, p < 0.0001), and there was no significant difference in the body weights between the DSS and DSS + ΔeruA groups (p = 0.7645; Figure 7C). These results showed that the mice model with DSS-induced colitis had been successfully established.
Figure 7. EruA contributes to AIEC colonization and exacerbates intestinal inflammation in mice with DSS-induced colitis and those that were DSS-free. (A) Mice in the Control, WT, ∆eruA, DSS, DSS + ∆eruA, and DSS + WT groups were orally administered 2.5% DSS or NS, and/or the WT or ∆eruA bacteria for bacterial infection. (B) The body weights in the Control, DSS, WT, and ∆eruA groups, as recorded from the first day after NS or DSS was added to the drinking water. (C) The body weights in the DSS, DSS + WT, and DSS + ∆eruA groups, as recorded from the first day after DSS was added to the drinking water. (D) The number of WT and ∆eruA bacteria colonized in the colons of mice with and without DSS-induced colitis. (E) All mouse colons in the six groups were harvested on day 17. Numbers 1–6 represent the colons in the DSS, WT, ∆eruA, Control, DSS + ∆eruA, and DSS + WT groups, respectively. (F) The colon lengths in the DSS, WT, and ∆eruA groups compared with those in the Control group. (G) The colon lengths in the DSS + ∆eruA and DSS + WT groups compared with those in the DSS group. (H) Representative pictures of H&E-stained colon tissues in the Control, WT, ∆eruA, DSS, DSS + ∆eruA, and DSS + WT groups (scale bars, 100 µm; magnification, 100×, 400× (objective × eyepiece)). (I) The cumulative histology scores of the colon tissues in the control group compared with those in the WT, ∆eruA, DSS, DSS + ∆eruA, and DSS + WT groups, and the cumulative histology scores of the colon tissues in the DSS group compared with those in the DSS + ∆eruA and DSS + WT groups. Data are represented as the mean ± SD, with n = 6–8 per group. Statistical significance was assessed using one-way ANOVA, followed by Tukey’s test. Note: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001; ns, not significant.
Figure 7. EruA contributes to AIEC colonization and exacerbates intestinal inflammation in mice with DSS-induced colitis and those that were DSS-free. (A) Mice in the Control, WT, ∆eruA, DSS, DSS + ∆eruA, and DSS + WT groups were orally administered 2.5% DSS or NS, and/or the WT or ∆eruA bacteria for bacterial infection. (B) The body weights in the Control, DSS, WT, and ∆eruA groups, as recorded from the first day after NS or DSS was added to the drinking water. (C) The body weights in the DSS, DSS + WT, and DSS + ∆eruA groups, as recorded from the first day after DSS was added to the drinking water. (D) The number of WT and ∆eruA bacteria colonized in the colons of mice with and without DSS-induced colitis. (E) All mouse colons in the six groups were harvested on day 17. Numbers 1–6 represent the colons in the DSS, WT, ∆eruA, Control, DSS + ∆eruA, and DSS + WT groups, respectively. (F) The colon lengths in the DSS, WT, and ∆eruA groups compared with those in the Control group. (G) The colon lengths in the DSS + ∆eruA and DSS + WT groups compared with those in the DSS group. (H) Representative pictures of H&E-stained colon tissues in the Control, WT, ∆eruA, DSS, DSS + ∆eruA, and DSS + WT groups (scale bars, 100 µm; magnification, 100×, 400× (objective × eyepiece)). (I) The cumulative histology scores of the colon tissues in the control group compared with those in the WT, ∆eruA, DSS, DSS + ∆eruA, and DSS + WT groups, and the cumulative histology scores of the colon tissues in the DSS group compared with those in the DSS + ∆eruA and DSS + WT groups. Data are represented as the mean ± SD, with n = 6–8 per group. Statistical significance was assessed using one-way ANOVA, followed by Tukey’s test. Note: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001; ns, not significant.
Biomolecules 16 00152 g007
In DSS-free mice, the number of ∆eruA bacteria colonized in the colons of the ∆eruA group significantly decreased, compared with that of the WT bacteria in the colons of the WT group (p < 0.001; Figure 7D). In mice with DSS-induced colitis, the number of ∆eruA bacteria colonized in the colons of the DSS + ∆eruA group was significantly lower than that of the WT bacteria in the colons of the DSS + WT group (p < 0.001). Moreover, the number of WT and ∆eruA bacteria colonized in the colons of DSS-free mice was significantly lower than that of the WT and ∆eruA bacteria in the colons of DSS-induced mice, respectively (p < 0.010; p < 0.003). Therefore, the results suggested that EruA helped the LF82 strain colonize the colon in both DSS-free induced and DSS-induced mice, with a stronger effect observed in DSS-induced mice. Together, these results show that EruA enhances the pathogenicity of AIEC in mice regardless of DSS treatment.
Next, we further investigated whether EruA helped the LF82 strain exacerbate intestinal inflammation in mice. The colon length was used to evaluate inflammation severity in the mouse model with DSS-induced colitis. Compared with the Control group, the colon lengths in the mice of the DSS group were significantly shorter (p = 0.0253), while there were no differences in colon lengths among the Control, WT, and ∆eruA groups (p = 0.9831, p = 0.9952, p = 0.9992; Figure 7E,F). However, compared with the DSS group, the colon lengths in the DSS + WT group were significantly shorter (p = 0.0485), while there was no significant change in the colon lengths in the DSS + ∆eruA group (p = 0.7096; Figure 7E,G). The H&E-stained colon tissues in the Control, WT, and ∆eruA groups seemed to be normal, while the epithelial barriers were eroded and ulcerated, the crypts were damaged, and inflammatory cells were infiltrated in the DSS, DSS + ∆eruA, and DSS + WT groups (Figure 7H). There was no significant difference in the degree of colonic inflammation between the WT or ∆eruA group and the Control group (p = 0.670, p = 0.382). Compared with the Control group, the degree of colonic inflammation in the DSS group significantly increased (p = 0.002; Figure 7I). The degree of colonic inflammation in the DSS + WT group was significantly higher than that in the DSS group (p < 0.001), while there was no significant difference between the DSS + ∆eruA group and the DSS group (p = 0.895). The cumulative scores for each group were compared, and the results (Figure 7I) were consistent with those of Figure 7H. On the whole, oral administration of the WT bacteria exacerbated DSS-induced colitis more than the administration of the ∆eruA.

4. Discussion

AIEC colonization in the intestines and replication within macrophages contribute to the pathogen’s persistence in patients with CD [7,9]. In the present study, EruA was identified as a regulator of AIEC involved in the pathogenesis of IBD [3]. EMSA confirmed that EruA directly and sequence-specifically binds to fimA and tnaB, supporting a direct regulatory role. It activated the fimA gene, promoted bacterial adhesion to intestinal epithelial cells, and colonized the intestines of both DSS-free and DSS-induced colitis mice. EruA directly activated the tnaB gene, which enhanced bacterial production of the signaling molecule indole and the formation of bacterial biofilms. Eha, another member of the SlyA family, activated the aroC gene encoding chorismate synthase [34], which is required for the production of indole to assist in the formation of bacterial biofilms in Edwardsiella tarda (E. tarda) [27]. Interestingly, AIEC can assemble biofilm-like communities to avoid being cleared by lysosomes and replicate within macrophages [11]. EruA contributes to AIEC biofilm formation to promote bacterial replication within macrophages.
In addition, based on RNA sequencing (Figure 2C), there is a slyA gene, which is an orthologue of the eruA gene. Firstly, why did RNA sequencing automatic annotation mislabel the eruA gene as slyA? As EruA in AIEC shares high amino acid homology with SlyA in Salmonella and other transcriptional regulators in the SlyA family, the RNA sequencing annotation software (based on standard NCBI/RefSeq databases) automatically assigned the gene to “slyA”. The naming of the eruA occurred after RNA sequencing analysis. Next, the genome of the AIEC LF82 strain (GenBank accession no: NC_011993) contains only a canonical slyA-like eruA gene. Moreover, EruA does not regulate the fimA and tnaB genes by means of an “on/off” system but rather exerts its effect on these two target genes by means of a dose-dependent relationship (Figure 3C,D). The binding specificity was further validated by mutating the TTAN6TAA motif in mPfimA and mPtnaB. Loss of binding in the mutated probes confirmed that EruA interacted directly and sequence-specifically with these promoters, supporting a direct regulatory role rather than an indirect effect via global regulators (Figure 3E,F). Furthermore, for AIEC, the bacterial adhesion ability and resistance against acidic or oxidative stress, as well as the formation of bacterial biofilms, are not only regulated by the eruA gene but also by other regulatory genes and two-component system genes [32]. This is the reason why the impact of deleting the eruA gene is not particularly significant.
In addition, in the non-pathogenic Escherichia coli strain K-12, the overexpression of a slyA(EC) gene (another gene homologous to eruA) led to the emergence of a hemolytic phenotype [35]. However, like slyA in S. typhimurium, eruA helps AIEC respond to acidic and oxidative signals and tolerate environmental stresses [16,17]. The slyA in S. typhimurium is not directly activated by sensing signals; instead, its concentration increases under environmental stresses through the action of other transcriptional factors [36]. However, how the eruA helps AIEC respond to such signals remains unclear.
Among the target genes of EruA, in E. coli, both evgS/evgA encoding a two-component system and mdtE/mdtF encoding a proton-driven drug pump MdtEF-TolC contribute to the bacterial resistance to acidic environments [32,33]. In addition, the membrane sensor protein PhoR and transcription regulator PhoB both belong to the two-component system. In S. enterica, when phosphorus is deficient, PhoR and PhoB are activated and help maintain the bacterial inorganic phosphate homeostasis [37]. These regulations play an important role under phosphate limitation, nitrogen limitation, and acidic conditions [38]. In Listeria monocytogenes (L. monocytogenes), TreB is the sole trehalose transporter. Trehalose metabolism enhances the formation of bacterial biofilm and acid resistance [39]. In the study, when the WT bacteria were cultured in acidic LB medium (pH 5.8), the expression levels of the phoB, phoR, rstA, and rstB genes were significantly different compared with culture in standard LB medium (pH 7.4) (Figure S2A). Overall, these results indicate that under acidic stress conditions, the aforementioned target genes of the eruA gene in AIEC bacteria may be able to play a role. Therefore, the eruA gene may activate these target genes under acidic conditions, thus resisting acid stress.
Among the target genes of EruA, ArcA, encoded by arcA, is also a key regulator that inhibits aerobic respiration in Gram-negative bacteria to adapt to environmental changes [40]. The pstFEDCBA gene cluster encodes a high-affinity phosphate transporter. Compared with the WT bacteria of Lactococcus lactis, the pstA mutant was less responsive to copper and zinc and more sensitive to oxygen [41]. Moreover, NuoF and SdhB, encoded by the nuoF and sdhB genes, are two important enzymes in the respiratory chain of Xanthomonas oryzae pv. Oryzae (Xoo). Parthenolide can bind to NuoF and SdhB, impairing the function of these enzymes and leading to ROS accumulation in Xoo [42]. DegP, encoded by the degP gene, is a highly conserved periplasmic protease in bacteria. The degP mutant in Streptococcus pyogenes was more sensitive to high temperature and reactive oxygen intermediates than the WT bacteria [43]. In addition, the expression level of the trpE gene, encoding anthranilate synthetase, was increased when L. monocytogenes proliferated in macrophages, suggesting that the trpE gene was involved in helping the bacteria overcome oxidative stress and contributed to their intracellular survival [44]. GlcB (malate synthase), encoded by the glcB gene in Pseudomonas aeruginosa, is a component of the glyoxylate shunt (GS) pathway, an alternative to the tricarboxylic acid (TCA) cycle. The glcB gene expression is upregulated when the bacteria infect the host and combat oxidative stress [45]. Membrane microdomains, also known as lipid rafts, belong to the SPFH superfamily and regulate membrane-dependent functions. Four genes (yqiK, qmcA, hflK, and hflC) encode SPFH proteins in Gram-negative bacteria, which help the bacteria resist aminoglycoside antibiotics and oxidative stress [46]. The yiaK-S operon in E. coli is required for the aerobic utilization of L-ascorbate and has been implicated in bacterial resistance to oxidative stress [47]. In this study, there was also a significant difference in the expression levels of the phoB, phoR, rstA, and rstB genes between the LF82 strain grown in oxidative LB medium (2 mM H2O2) and that grown in the standard LB medium (0 mM H2O2) (Figure S2B). Overall, these results indicate that under aerobic stress conditions, the aforementioned target genes of the eruA gene in AIEC bacteria may be able to function. Therefore, the eruA gene may activate these target genes to help bacteria resist oxidative stress.
In addition, among the other target genes of EruA, the proU gene cluster encodes a transport system consisting of the proV, proW, and proX genes. In Shigella, this system efficiently eliminates glycine betaine and proline betaine, thereby protecting bacteria from extreme osmotic stress and promoting their survival within the cells and the infection process [48]. The ybtA gene encodes a global regulator, which can regulate the expression of a high-pathogenicity island as well as the process of iron ion uptake in Yersinia [49]. The ybjX gene encodes an outer membrane protein that functions as an efficient adaptive barrier, helping avian pathogenic E. coli resist environmental stress and survive in macrophages [50]. Two wecC and wecB genes respectively encode UDP-N-acetyl-d-mannosamine dehydrogenase and UDP-N -acetylglucosamine 2-epimerase, which are crucial for the survival of Yersinia pestis (Y. pestis) in murine macrophages [51]. Therefore, EruA may activate these target genes to respond to osmosis and other signals, enabling bacteria to replicate within macrophages.
In summary, thirty-two DEGs of the eruA gene were found by RNA sequencing and qRT-PCR. EruA in AIEC may both positively and negatively regulate these genes, which may encode various regulators, two-component systems, transport systems, enzymes, and others that help AIEC replicate within macrophages and resist oxidative, acid, osmosis, and other stresses. Moreover, understanding the role of such regulators in pathogens is of vital importance for effectively controlling bacteria and preventing infections. In Salmonella, the transcriptional regulator SlyA activates the PhoP/PhoQ two-component system, thereby controlling the expression of numerous genes within macrophages and influencing the bacterial virulence [52]. The emrR encodes a regulator in the SlyA/MarR family. This regulator plays a crucial role in the virulence of S. Typhimurium and Y. pestis of the Enterobacteriaceae family and is activated by the regulator SlyA and PhoP/PhoQ [53]. A type III secretion system (T3SS), a specialized transport system, helps Gram-negative pathogenic bacteria inject multiple effectors into host cells. A gene cluster, a virulence island, encodes T3SS and is regulated by regulators such as SlyA in response to environmental changes [54]. However, the interaction between the regulator EruA and the two-component system remains unclear.
Lastly, AIEC is different from infectious pathogens such as S. typhi, as AIEC only causes disease under specific host conditions. In this study, when DSS-free mice were administered the WT or ∆eruA bacteria, no intestinal inflammation was observed in the mice. In DSS-induced colitis mice, the WT bacteria aggravated the epithelial barrier damage and colonic inflammation, whereas the ∆eruA bacteria had no significant change. This might be because the WT bacteria survived longer within macrophages and colonized more in intestinal epithelial cells than ∆eruA bacteria. These findings are consistent with the report by Drouet et al., who found that AIEC cannot colonize normal or NOD2 knockout mice without antibiotic or DSS treatment [55]. Therefore, in the presence of intestinal inflammation, the expression of the eruA gene may favor the competitive growth of AIEC in the gut.
In addition, AIEC is different from commensal bacteria such as E. coli. Mice were orally administrated 2.5% DSS or NS, and/or AIEC LF82 or the E. coli DH5α strain, over consecutive days (Figure S3A). The results suggested that the LF82 strain was more capable of colonizing the colon than the DH5α strain, both in mice with either DSS-free or DSS-induced colitis. Compared with DSS-free mice, the LF82 strain was more favorable for colonization in mice with DSS-induced colitis (Figure S3D). Moreover, the oral administration effect of the LF82 strain was the same as that of the DH5α strain in DSS-free mice (Figure S3B,E,F,H,I). However, oral administration of the LF82 strain more effectively aggravated intestinal colitis than that of the DH5α strain in the DSS-induced colitis mice, as shown by weight loss, colon length shortening, and pathological changes in colon tissues (Figure S3C,E,G–I).

5. Conclusions

EruA is a novel member of the SlyA family and serves as a master regulator in AIEC. It activates the fimA gene to promote bacterial adhesion to intestinal epithelial cells and the tnaB gene to increase indole production and biofilm formation. EruA also contributes to the pathogen’s resistance to environmental stresses and improves the bacterial survival rates within macrophages, thereby increasing virulence. Overall, EruA promotes bacterial colonization in the gut and aggravates intestinal inflammation in mice with DSS-induced colitis, ultimately enhancing bacterial pathogenicity and influencing the management of AIEC.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biom16010152/s1, Table S1: Variations of the expression of DEGs based on RNA sequencing. Supplementary methods: The β-galactosidase activity of the ΔeruA-pMP220-PeruALacZ bacteria was detected under acidic or oxidative stress using an ELISA assay. Figure S1: The β-galactosidase activity of the ΔeruA-pMP220-PeruAlacZ bacteria was detected under acidic or oxidative stress using an ELISA assay. Figure S2: The expression levels of some target genes of the eruA gene of the AIEC LF82 strain changed under acidic or oxidative stress. Figure S3: The intestinal inflammation of DSS-free or DSS-induced mice infected with the AIEC LF82 strain was compared with that of mice infected with E. coli DH5α. Figure S4: Graphical model representing the relationship between the eruA, fimA, and tnaB genes and the bacterial indole, adhesion, biofilm, indoles, colonization, stress resistance, as well as survival within macrophages. File S1: Original images in the manuscript.

Author Contributions

Z.X. wrote the main manuscript. Z.X. and C.Q. designed the experiments. Z.X., M.W., and A.C. performed animal and cellular experiments and analyzed the results. C.Q., R.Z., W.C., and L.C. conducted bacterial experiments and analyzed the results. D.G. and R.S. supervised the research. D.G., R.S., and L.C. acquired funding. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Chinese National Nature and Science Foundation (Grant No. 31570124); Nanjing Science and Technology Development Program (Grant No. 202305041); and Zhongda Hospital Affiliated with Southeast University, Jiangsu Province High-Level Hospital Construction Funds (Grant No. YKK24268).

Institutional Review Board Statement

The experimental animal projects were approved by the Experimental Animal Ethics and Welfare Committee of Southeast University (20230301020, approved date: 1 March 2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

The eruA gene data have been deposited in the NCBI database (Genbank Accession Number: MZ475355). The raw data from RNA sequencing have been deposited in the NCBI SRA database (BioProject number: PRJNA1070331).

Acknowledgments

AIEC LF82 strain was provided by Jakob Moller-Jensen (Department of Biochemistry and Molecular Biology, University of Southern Denmark) and Guoqiang Zhu (College of Veterinary Medicine, Yangzhou University). Plasmid pDS132 and E. coli SM10λpir were provided by Weili Liang (State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention). We are grateful to the students (Qiyan Xu, Qian Zhou, Jiali Miao, Jinling Fu) in the Medicine School of Southeast University and the staff in the Department of Pathogenic Microbiology and Immunology of Medicine School of Southeast University, and the staff at the Public Scientific Research Platforms in Zhongda Hospital Affiliated with Southeast University for their technical assistance.

Conflicts of Interest

The authors declared no conflicts of interest.

References

  1. Kaplan, G.G. The global burden of IBD: From 2015 to 2025. Nat. Rev. Gastroenterol. Hepatol. 2015, 12, 720–727. [Google Scholar] [CrossRef] [PubMed]
  2. Bruner, L.P.; White, A.M.; Proksell, S. Inflammatory Bowel Disease. Prim. Care 2023, 50, 411–427. [Google Scholar] [CrossRef] [PubMed]
  3. Palmela, C.; Chevarin, C.; Zhilu, X.; Torres, J.; Sevrin, G.; Hirten, R.; Barnich, N.; Ng, S.C.; Colombel, J.F. Adherent-invasive Escherichia coli in inflammatory bowel disease. Gut 2018, 67, 574–587. [Google Scholar] [CrossRef] [PubMed]
  4. Darfeuille-Michaud, A.; Boudeau, J.; Bulois, P.; Neut, C.; Glasser, A.L.; Barnich, N.; Bringer, M.A.; Swidsinski, A.; Beaugerie, L.; Colombel, J.F. High prevalence of adherent-invasive Escherichia coli associated with ileal mucosa in Crohn’s disease. Gastroenterology 2004, 127, 412–421. [Google Scholar] [CrossRef]
  5. O’brien, C.L.; Bringer, M.A.; Holt, K.E.; Gordon, D.M.; Dubois, A.L.; Barnich, N.; Darfeuille-Michaud, A.; Pavli, P. Comparative genomics of Crohn’s disease-associated adherent-invasive Escherichia coli. Gut 2017, 66, 1382–1389. [Google Scholar] [CrossRef]
  6. Smith, E.J.; Thompson, A.P.; O’driscoll, A.; Clarke, D.J. Pathogenesis of adherent-invasive Escherichia coli. Future Microbiol. 2013, 8, 1289–1300. [Google Scholar] [CrossRef]
  7. Keita, Å.V.; Alkaissi, L.Y.; Holm, E.B.; Heil, S.D.S.; Chassaing, B.; Darfeuille-Michaud, A.; Mckay, D.M.; Söderholm, J.D. Enhanced E. coli LF82 Translocation through the Follicle-associated Epithelium in Crohn’s Disease is Dependent on Long Polar Fimbriae and CEACAM6 expression, and Increases Paracellular Permeability. J. Crohns Colitis. 2020, 14, 216–229. [Google Scholar] [CrossRef]
  8. Hung, D.L.; Hultgren, S.J. Pilus biogenesis via the chaperone/usher pathway: An integration of structure and function. J. Struct. Biol. X 1998, 124, 201–220. [Google Scholar] [CrossRef]
  9. Lucchini, V.; Sivignon, A.; Pieren, M.; Gitzinger, M.; Lociuro, S.; Barnich, N.; Kemmer, C.; Trebosc, V. The Role of OmpR in Bile Tolerance and Pathogenesis of Adherent-Invasive Escherichia coli. Front. Microbiol. 2021, 12, 684473–684482. [Google Scholar] [CrossRef]
  10. Bringer, M.A.; Glasser, A.L.; Tung, C.H.; Méresse, S.; Darfeuille-Michaud, A. The Crohn’s disease-associated adherent-invasive Escherichia coli strain LF82 replicates in mature phagolysosomes within J774 macrophages. Cell Microbiol. 2006, 8, 471–484. [Google Scholar] [CrossRef]
  11. Prudent, V.; Demarre, G.; Vazeille, E.; Wery, M.; Quenech’du, N.; Ravet, A.; Dauverd-Girault, J.; Van Dijk, E.; Bringer, M.A.; Descrimes, M.; et al. The crohn’s disease-related bacterial strain LF82 assembles biofilm-like communities to protect itself from phagolysosomal attack. Commun. Biol. 2021, 4, 627–634. [Google Scholar] [CrossRef] [PubMed]
  12. Cieza, R.J.; Hu, J.; Ross, B.N.; Sbrana, E.; Torres, A.G. The IbeA invasin of adherent-invasive Escherichia coli mediates interaction with intestinal epithelia and macrophages. Infect. Immun. 2015, 83, 1904–1918. [Google Scholar] [CrossRef] [PubMed]
  13. Yao, T.; Liu, X.; Li, D.; Huang, Y.; Yang, W.; Liu, R.; Wang, Q.; Li, X.; Zhou, J.; Jin, C.; et al. Two-component system RstAB promotes the pathogenicity of adherent-invasive Escherichia coli in response to acidic conditions within macrophages. Gut Microbes. 2024, 16, 2356642. [Google Scholar] [CrossRef] [PubMed]
  14. Li, G.; Young, K.D. Indole production by the tryptophanase TnaA in Escherichia coli is determined by the amount of exogenous tryptophan. Microbiology 2013, 159, 402–410. [Google Scholar] [CrossRef]
  15. Lee, J.H.; Lee, J. Indole as an intercellular signal in microbial communities. FEMS Microbiol. Rev. 2010, 34, 426–444. [Google Scholar] [CrossRef]
  16. Buchmeier, N.; Bossie, S.; Chen, C.Y.; Fang, F.C.; Guiney, D.G.; Libby, S.J. SlyA, a transcriptional regulator of Salmonella typhimurium, is required for resistance to oxidative stress and is expressed in the intracellular environment of macrophages. Infect. Immun. 1997, 65, 3725–3730. [Google Scholar] [CrossRef]
  17. Tian, S.; Wang, C.; Li, Y.; Bao, X.; Zhang, Y.; Tang, T. The Impact of SlyA on Cell Metabolism of Salmonella typhimurium: A Joint Study of Transcriptomics and Metabolomics. J. Proteome Res. 2021, 20, 184–190. [Google Scholar] [CrossRef]
  18. Michaux, C.; Sanguinetti, M.; Reffuveille, F.; Auffray, Y.; Posteraro, B.; Gilmore, M.S.; Hartke, A.; Giard, J.C. SlyA is a transcriptional regulator involved in the virulence of Enterococcus faecalis. Infect. Immun. 2011, 79, 2638–2645. [Google Scholar] [CrossRef]
  19. Thomson, N.R.; Cox, A.; Bycroft, B.W.; Stewart, G.S.; Williams, P.; Salmond, G.P. The rap and hor proteins of Erwinia, Serratia and Yersinia: A novel subgroup in a growing superfamily of proteins regulating diverse physiological processes in bacterial pathogens. Mol. Microbiol. 1997, 26, 531–544. [Google Scholar] [CrossRef]
  20. Curran, T.D.; Abacha, F.; Hibberd, S.P.; Rolfe, M.D.; Lacey, M.M.; Green, J. Identification of new members of the Escherichia coli K-12 MG1655 SlyA regulon. Microbiology 2017, 163, 400–409. [Google Scholar] [CrossRef]
  21. Dolan, K.T.; Duguid, E.M.; He, C. Crystal structures of SlyA protein, a master virulence regulator of Salmonella, in free and DNA-bound states. J. Biol. Chem. 2011, 286, 22178–22185. [Google Scholar] [CrossRef] [PubMed]
  22. Stapleton, M.R.; Norte, V.A.; Read, R.C.; Green, J. Interaction of the Salmonella typhimurium transcription and virulence factor SlyA with target DNA and identification of members of the SlyA regulon. J. Biol. Chem. 2002, 277, 17630–17637. [Google Scholar] [CrossRef] [PubMed]
  23. Simonsen, K.T.; Nielsen, G.; Bjerrum, J.V.; Kruse, T.; Kallipolitis, B.H.; Møller-Jensen, J. A role for the RNA chaperone Hfq in controlling adherent-invasive Escherichia coli colonization and virulence. PLoS ONE 2011, 6, e16387. [Google Scholar] [CrossRef] [PubMed]
  24. Fan, F.; Li, X.; Pang, B.; Zhang, C.; Li, Z.; Zhang, L.; Yan, M.; Liang, W.; Kan, B. The outer-membrane protein TolC of Vibrio cholerae serves as a second cell-surface receptor for the VP3 phage. J. Biol. Chem. 2018, 293, 4000–4013. [Google Scholar] [CrossRef]
  25. Spriestersbach, A.; Kubicek, J.; Schäfer, F.; Block, H.; Maertens, B. Purification of His-Tagged Proteins. Methods Enzymol. 2015, 559, 1–15. [Google Scholar] [CrossRef]
  26. Gao, D.; Zhang, Y.; Liu, R.; Fang, Z.; Lu, C. EsR240, a non-coding sRNA, is required for the resistance of Edwardsiella tarda to stresses in macrophages and for virulence. Vet. Microbiol. 2019, 231, 254–263. [Google Scholar] [CrossRef]
  27. Liu, R.; Ga, D.; Fang, Z.; Zhao, L.; Xu, Z.; Qin, C.; Zhang, R.; Xu, J.; Lu, C. AroC, a chorismate synthase, is required for the formation of Edwardsiella tarda biofilms. Microbes Infect. 2022, 24, 104955. [Google Scholar] [CrossRef]
  28. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  29. Percie Du Sert, N.; Hurst, V.; Ahluwalia, A.; Alam, S.; Avey, M.T.; Baker, M.; Browne, W.J.; Clark, A.; Cuthill, I.C.; Dirnagl, U.; et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol. 2020, 18, e3000410. [Google Scholar] [CrossRef]
  30. Peng, Y.; Yan, Y.; Wan, P.; Chen, D.; Ding, Y.; Ran, L.; Mi, J.; Lu, L.; Zhang, Z.; Li, X.; et al. Gut microbiota modulation and anti-infammatory properties of anthocyanins from the fruits of Lycium ruthenicum Murray in dextran sodium sulfate-induced colitis in mice. Free Radic. Biol. Med. 2019, 136, 96–108. [Google Scholar] [CrossRef]
  31. Cabezas, C.E.; Briones, A.C.; Aguirre, C.; Pardo-Esté, C.; Castro-Severyn, J.; Salinas, C.R.; Baquedano, M.S.; Hidalgo, A.A.; Fuentes, J.A.; Morales, E.H.; et al. The transcription factor SlyA from Salmonella Typhimurium regulates genes in response to hydrogen peroxide and sodium hypochlorite. Res. Microbiol. 2018, 169, 263–278. [Google Scholar] [CrossRef] [PubMed]
  32. Zhang, R.; Wang, Y. EvgS/EvgA, the unorthodox two-component system regulating bacterial multiple resistance. Appl. Environ. Microbiol. 2023, 89, e0157723. [Google Scholar] [CrossRef] [PubMed]
  33. Schaffner, S.H.; Lee, A.V.; Pham, M.T.N.; Kassaye, B.B.; Li, H.; Tallada, S.; Lis, C.; Lang, M.; Liu, Y.; Ahmed, N.; et al. Extreme Acid Modulates Fitness Trade-Offs of Multidrug Efflux Pumps MdtEF-TolC and AcrAB-TolC in Escherichia coli K-12. Appl. Environ. Microbiol. 2021, 87, e0072421. [Google Scholar] [CrossRef] [PubMed]
  34. Gao, D.; Liu, N.; Tian, C.; Liu, R.; Zhao, L.; Zhang, Y.; Zheng, E.; Lu, C. Target genes directly regulated by Eha are required for Edwardsiella tarda survival within macrophages. Vet. Microbiol. 2020, 247, 108739. [Google Scholar] [CrossRef]
  35. Oscarsson, J.; Mizunoe, Y.; Uhlin, B.E.; Haydon, D.J. Induction of haemolytic activity in Escherichia coli by the slyA gene product. Mol. Microbiol. 1996, 20, 191–199. [Google Scholar] [CrossRef]
  36. Norte, V.A.; Stapleton, M.R.; Green, J. PhoP-responsive expression of the Salmonella enterica serovar typhimurium slyA gene. J. Bacteriol. 2003, 185, 3508–3514. [Google Scholar] [CrossRef]
  37. Bruna, R.E.; Kendra, C.G.; Pontes, M.H. Phosphorus starvation response and PhoB-independent utilization of organic phosphate sources by Salmonella enterica. Microbiol. Spectr. 2023, 11, e0226023. [Google Scholar] [CrossRef]
  38. Marzan, L.W.; Shimizu, K. Metabolic regulation of Escherichia coli and its phoB and phoR genes knockout mutants under phosphate and nitrogen limitations as well as at acidic condition. Microb. Cell Fact. 2011, 10, 39–51. [Google Scholar] [CrossRef]
  39. Wu, J.; Mcauliffe, O.; O’byrne, C.P. Trehalose transport occurs via TreB in Listeria monocytogenes and it influences biofilm development and acid resistance. Int. J. Food Microbiol. 2023, 394, 110165. [Google Scholar] [CrossRef]
  40. Brown, A.N.; Anderson, M.T.; Smith, S.N.; Bachman, M.A.; Mobley, H.L.T. Conserved metabolic regulator ArcA responds to oxygen availability, iron limitation, and cell envelope perturbations during bacteremia. mBio 2023, 14, e0144823. [Google Scholar] [CrossRef]
  41. Cesselin, B.; Ali, D.; Gratadoux, J.J.; Gaudu, P.; Duwat, P.; Gruss, A.; El Karoui, M. Inactivation of the Lactococcus lactis high-affinity phosphate transporter confers oxygen and thiol resistance and alters metal homeostasis. Microbiology 2009, 155, 2274–2281. [Google Scholar] [CrossRef]
  42. Zhou, Q.; Li, L.; Liu, F.; Hu, J.; Cao, Y.; Qiao, S.; Zhou, Y.; Wang, B.; Jia, Y.; Chen, Y.; et al. Mining and characterization of oxidative stress-related binding proteins of parthenolide in Xanthomonas oryzae pv. oryzae. Pest. Manag. Scim 2022, 78, 3345–3355. [Google Scholar] [CrossRef] [PubMed]
  43. Jones, C.H.; Bolken, T.C.; Jones, K.F.; Zeller, G.O.; Hruby, D.E. Conserved DegP protease in gram-positive bacteria is essential for thermal and oxidative tolerance and full virulence in Streptococcus pyogenes. Infect. Immun. 2001, 69, 5538–5545. [Google Scholar] [CrossRef] [PubMed]
  44. Mraheil, M.A.; Billion, A.; Mohamed, W.; Rawool, D.; Hain, T.; Chakraborty, T. Adaptation of Listeria monocytogenes to oxidative and nitrosative stress in IFN-activated macrophages. Int. J. Med. Microbiol. 2011, 301, 547–555. [Google Scholar] [CrossRef] [PubMed]
  45. Ahn, S.; Jung, J.; Jang, I.A.; Madsen, E.L.; Park, W. Role of Glyoxylate Shunt in Oxidative Stress Response. J. Biol. Chem. 2016, 291, 11928–11938. [Google Scholar] [CrossRef]
  46. Wessel, A.K.; Yoshii, Y.; Reder, A.; Boudjemaa, R.; Szczesna, M.; Betton, J.M.; Bernal-Bayard, J.; Beloin, C.; Lopez, D.; Völker, U.; et al. Escherichia coli SPFH Membrane Microdomain Proteins HflKC Contribute to Aminoglycoside and Oxidative Stress Tolerance. Microbiol. Spectr. 2023, 11, e0176723. [Google Scholar] [CrossRef]
  47. Campos, E.; Montella, C.; Garces, F.; Baldoma, L.; Aguilar, J.; Badia, J. Aerobic L-ascorbate metabolism and associated oxidative stress in Escherichia coli. Microbiology 2007, 153, 3399–3408. [Google Scholar] [CrossRef]
  48. Mahmoud, R.Y.; Li, W.; Eldomany, R.A.; Emara, M.; Yu, J. The Shigella ProU system is required for osmotic tolerance and virulence. Virulence 2017, 8, 362–374. [Google Scholar] [CrossRef]
  49. Anisimov, R.; Brem, D.; Heesemann, J.; Rakin, A. Transcriptional regulation of high pathogenicity island iron uptake genes by YbtA. Int. J. Med. Microbiol. 2005, 295, 19–28. [Google Scholar] [CrossRef]
  50. Song, X.; Qiu, M.; Jiang, H.; Xue, M.; Hu, J.; Liu, H.; Zhou, X.; Tu, J.; Qi, K. ybjX mutation regulated avian pathogenic Escherichia coli pathogenicity though stress-resistance pathway. Avian Pathol. 2020, 49, 144–152. [Google Scholar] [CrossRef]
  51. Klein, K.A.; Fukuto, H.S.; Pelletier, M.; Romanov, G.; Grabenstein, J.P.; Palmer, L.E.; Ernst, R.; Bliska, J.B. A transposon site hybridization screen identifies galU and wecBC as important for survival of Yersinia pestis in murine macrophages. J. Bacteriol. 2012, 194, 653–662. [Google Scholar] [CrossRef]
  52. Song, H.; Kong, W.; Weatherspoon, N.; Qin, G.; Tyler, W.; Turk, J.; Curtiss, R., 3rd; Shi, Y. Modulation of the regulatory activity of bacterial two-component systems by SlyA. J. Biol. Chem. 2008, 283, 28158–28168. [Google Scholar] [CrossRef]
  53. Yang, D.; Kong, Y.; Sun, W.; Kong, W.; Shi, Y. Dopamine-Responsive Signal Transduction Controls Transcription of Salmonella enterica Serovar Typhimurium Virulence Genes. mBio 2019, 10, e02772-18. [Google Scholar] [CrossRef]
  54. Yuan, X.; Yu, M.; Yang, C.H. Innovation and Application of the Type III Secretion System Inhibitors in Plant Pathogenic Bacteria. Microorganisms 2020, 8, 1956. [Google Scholar] [CrossRef]
  55. Drouet, M.; Vignal, C.; Singer, E.; Djouina, M.; Dubreuil, L.; Cortot, A.; Desreumaux, P.; Neut, C. AIEC colonization and pathogenicity: Influence of previous antibiotic treatment and preexisting inflammation. Inflamm. Bowel Dis. 2012, 18, 1923–1931. [Google Scholar] [CrossRef]
Figure 1. The EruA found in AIEC LF82 was similar to the SlyA in S. enterica subsp. indica. (A) A schematic diagram of an EruA monomer showing secondary structures. α-helices, pale cyan; β-sheet, slate; loop, salmon. (B) The EruA amino acid sequence of the AIEC LF82 strain compared with the SlyA amino acid sequence of S. enterica subsp. Marked with six rectangles (α-helices), two arrows (β-sheet), and several dashed lines (loop). (C) A schematic diagram of an EruA dimer showing secondary structures. (D) A schematic diagram of an EruA-DNA model predicated based on the structure of the SlyA-DNA complex as a reference. (E) The genetic organization of the eruA chromosomal region dissected in the AIEC LF82 strain. Large arrows represented the eruA and its adjacent slyB and yahI genes, and their orientation indicates the transcriptional direction. The nucleotide sequence of the eruA promoter region is shown. The transcription initiation nucleotide (+1) identified by 5′RACE is marked with an arrow, and a putative ribosome binding site (RBS) sequence, −10 and −35 sites, and transcription initiation codon (TTG) are underlined. (F) The crude extracts from E. coli pET28a-eruA/BL21 and control E. coli pET28a+/BL21 were analyzed with 12% SDS-PAGE following 1 mM IPTG induction for 4 or 6 h at 30 °C. M: protein marker; lane 1: the crude extracts from control E. coli pET28a+/BL21 induced for 6 h; lane 2–3: the crude extracts from pET28a-eruA/BL21 induced for 4 or 6 h. Original images can be found at Supplementary Materials.
Figure 1. The EruA found in AIEC LF82 was similar to the SlyA in S. enterica subsp. indica. (A) A schematic diagram of an EruA monomer showing secondary structures. α-helices, pale cyan; β-sheet, slate; loop, salmon. (B) The EruA amino acid sequence of the AIEC LF82 strain compared with the SlyA amino acid sequence of S. enterica subsp. Marked with six rectangles (α-helices), two arrows (β-sheet), and several dashed lines (loop). (C) A schematic diagram of an EruA dimer showing secondary structures. (D) A schematic diagram of an EruA-DNA model predicated based on the structure of the SlyA-DNA complex as a reference. (E) The genetic organization of the eruA chromosomal region dissected in the AIEC LF82 strain. Large arrows represented the eruA and its adjacent slyB and yahI genes, and their orientation indicates the transcriptional direction. The nucleotide sequence of the eruA promoter region is shown. The transcription initiation nucleotide (+1) identified by 5′RACE is marked with an arrow, and a putative ribosome binding site (RBS) sequence, −10 and −35 sites, and transcription initiation codon (TTG) are underlined. (F) The crude extracts from E. coli pET28a-eruA/BL21 and control E. coli pET28a+/BL21 were analyzed with 12% SDS-PAGE following 1 mM IPTG induction for 4 or 6 h at 30 °C. M: protein marker; lane 1: the crude extracts from control E. coli pET28a+/BL21 induced for 6 h; lane 2–3: the crude extracts from pET28a-eruA/BL21 induced for 4 or 6 h. Original images can be found at Supplementary Materials.
Biomolecules 16 00152 g001
Figure 2. The eruA gene encodes a regulator in the AIEC LF82 strain. (A) The results of RNA sequencing presented as a volcano plot, showing the number of differentially expressed genes (DEGs) in the ΔeruA bacteria, compared to the WT strain (|log2 fold change| ≥ 2, FDR ≤ 0.001). In the ΔeruA bacteria, the red indicates the upregulated DEGs, and the blue indicates the downregulated DEGs. (B) The GO functional categories of these DEGs for ΔeruA and its WT bacteria, including biological process, cellular component, and molecular function. (C) The normalized reads for thirty-two DEGs from RNA-sequencing are shown. (D) The thirty-two DEGs verified by qRT-PCR. **** p < 0.0001.
Figure 2. The eruA gene encodes a regulator in the AIEC LF82 strain. (A) The results of RNA sequencing presented as a volcano plot, showing the number of differentially expressed genes (DEGs) in the ΔeruA bacteria, compared to the WT strain (|log2 fold change| ≥ 2, FDR ≤ 0.001). In the ΔeruA bacteria, the red indicates the upregulated DEGs, and the blue indicates the downregulated DEGs. (B) The GO functional categories of these DEGs for ΔeruA and its WT bacteria, including biological process, cellular component, and molecular function. (C) The normalized reads for thirty-two DEGs from RNA-sequencing are shown. (D) The thirty-two DEGs verified by qRT-PCR. **** p < 0.0001.
Biomolecules 16 00152 g002
Figure 3. EruA directly regulates the tnaB and fimA of its target genes in the AIEC LF82 strain. (A) A main interaction site between Lys-88 in EruA and TTAAAGGGTTAA of the consensus sequences in the PtnaB identified using YASARA software analysis. Gray and pink, carbon (EruA and DNA, respectively); dark grey, hydrogen; blue, nitrogen; red, oxygen; orange, phosphorus. (B) The main interaction sites between Lys-88 and Gln-49 in EruA and TTAAGAGGATAA of the consensus sequences in the PfimA identified using YASARA software analysis. Gray and green, carbon (EruA and DNA, respectively); dark gray, hydrogen; blue, nitrogen; red, oxygen; orange, phosphorus. Nucleic acid and protein residues are depicted by bars, and hydrogen bonds are shown as dashed lines. (C) Different concentrations of purified EruA subjected to EMSA with 5′-Cy3-labeled probe PfimA. For the 5′-CY3-PfimA probe (10 nM), EruA concentrations were 0, 2, or 4 μM. (D) Different concentrations of purified EruA subjected to EMSA with 5′-Cy3-labeled probe PtnaB. For the 5′-CY3-labeled PtnaB probe (10 nM), EruA concentrations were 0, 6, 8, or 10 μM. (E) The specific binding of EruA to the consensus sequences in the promoter region of the fimA gene (5′-CY3-labeled PfimA) verified by EMSA. The concentration of 5′-CY3-labeled PfimA was 10 nM, the concentrations of unlabeled probes (uPfimA) were 100 and 200 times those of PfimA, and the concentration of 5′-CY3-labeled mutant probes (mPfimA) was 10 nM. The purified EruA protein was 4 μM. (F) The specific binding of EruA to the consensus sequences in the promoter region of the tnaB gene (5′-CY3-labeled PtnaB) verified by EMSA. The concentration of 5′-CY3-labeled PtnaB was 10 nM, the concentrations of unlabeled probes (uPtnaB) were 10, 20, 40, 80, and 100 times those of PtnaB, and the concentration of 5′-CY3-labeled mutant probes (mPtnaB) was 10 nM. The purified EruA protein was 10 μM. Original images can be found at Supplementary Materials.
Figure 3. EruA directly regulates the tnaB and fimA of its target genes in the AIEC LF82 strain. (A) A main interaction site between Lys-88 in EruA and TTAAAGGGTTAA of the consensus sequences in the PtnaB identified using YASARA software analysis. Gray and pink, carbon (EruA and DNA, respectively); dark grey, hydrogen; blue, nitrogen; red, oxygen; orange, phosphorus. (B) The main interaction sites between Lys-88 and Gln-49 in EruA and TTAAGAGGATAA of the consensus sequences in the PfimA identified using YASARA software analysis. Gray and green, carbon (EruA and DNA, respectively); dark gray, hydrogen; blue, nitrogen; red, oxygen; orange, phosphorus. Nucleic acid and protein residues are depicted by bars, and hydrogen bonds are shown as dashed lines. (C) Different concentrations of purified EruA subjected to EMSA with 5′-Cy3-labeled probe PfimA. For the 5′-CY3-PfimA probe (10 nM), EruA concentrations were 0, 2, or 4 μM. (D) Different concentrations of purified EruA subjected to EMSA with 5′-Cy3-labeled probe PtnaB. For the 5′-CY3-labeled PtnaB probe (10 nM), EruA concentrations were 0, 6, 8, or 10 μM. (E) The specific binding of EruA to the consensus sequences in the promoter region of the fimA gene (5′-CY3-labeled PfimA) verified by EMSA. The concentration of 5′-CY3-labeled PfimA was 10 nM, the concentrations of unlabeled probes (uPfimA) were 100 and 200 times those of PfimA, and the concentration of 5′-CY3-labeled mutant probes (mPfimA) was 10 nM. The purified EruA protein was 4 μM. (F) The specific binding of EruA to the consensus sequences in the promoter region of the tnaB gene (5′-CY3-labeled PtnaB) verified by EMSA. The concentration of 5′-CY3-labeled PtnaB was 10 nM, the concentrations of unlabeled probes (uPtnaB) were 10, 20, 40, 80, and 100 times those of PtnaB, and the concentration of 5′-CY3-labeled mutant probes (mPtnaB) was 10 nM. The purified EruA protein was 10 μM. Original images can be found at Supplementary Materials.
Biomolecules 16 00152 g003
Figure 4. EruA activates the fimA gene to promote adhesion to intestinal epithelial cells and the tnaB gene to increase the production of indole and the formation of biofilm. (A) The number of WT-flu, ΔeruA-flu, and ΔeruA-fimA-flu bacteria adhering to MODE-K cells for 20 min or 2 h of incubation, as observed under an SCM (scale bars, 10 µm; red indicates bacteria; blue indicates cell nuclei, and green indicates cytoplasm within MODE-K cells). The white arrows indicate the AIEC bacteria. (B) The number of the ΔeruA bacteria adhering to MODE-K cells compared with that of the WT and ∆eruA-fimA bacteria for 20 min or 2 h of incubation, as determined by counting CFUs/mL on LB plates without or with 35 μg/mL chloramphenicol. (C) The concentrations of indole in the supernatants of the ∆eruA bacteria compared with those of the WT and ∆eruA-tnaB bacteria at different culture times using the p-DMAB method. (D) Biofilm formation of the ∆eruA bacteria compared with that of the WT and ∆eruA-tnaB bacteria at 24, 36, 48, 60, and 72 h after incubation in 0.2% crystal violet-stained glass tubes. (E) Biofilm formation of the ∆eruA bacteria compared with the WT and ∆eruA-tnaB bacteria by incubation in 0.2% crystal violet-stained 96-well plates for 48 h using uninoculated LB medium as a negative control; 1–8 represent biofilm of the WT, WT, ∆eruA, ∆eruA, ∆eruA-tnaB, and ∆eruA-tnaB bacteria, as well as LB and LB broth, respectively. (F) The absorbance (570 nm) of the biofilms of the ∆eruA bacteria compared with that of the WT and ∆eruA-tnaB bacteria in the 96-well plates for 48 h using an automatic microplate reader. Data are from three independent experiments and are represented as the mean ± SD. Statistical significance was assessed using one-way ANOVA, followed by Tukey’s test. Note: * p < 0.05, ** p < 0.01, *** p < 0.001; **** p < 0.0001. Original images can be found at Supplementary Materials.
Figure 4. EruA activates the fimA gene to promote adhesion to intestinal epithelial cells and the tnaB gene to increase the production of indole and the formation of biofilm. (A) The number of WT-flu, ΔeruA-flu, and ΔeruA-fimA-flu bacteria adhering to MODE-K cells for 20 min or 2 h of incubation, as observed under an SCM (scale bars, 10 µm; red indicates bacteria; blue indicates cell nuclei, and green indicates cytoplasm within MODE-K cells). The white arrows indicate the AIEC bacteria. (B) The number of the ΔeruA bacteria adhering to MODE-K cells compared with that of the WT and ∆eruA-fimA bacteria for 20 min or 2 h of incubation, as determined by counting CFUs/mL on LB plates without or with 35 μg/mL chloramphenicol. (C) The concentrations of indole in the supernatants of the ∆eruA bacteria compared with those of the WT and ∆eruA-tnaB bacteria at different culture times using the p-DMAB method. (D) Biofilm formation of the ∆eruA bacteria compared with that of the WT and ∆eruA-tnaB bacteria at 24, 36, 48, 60, and 72 h after incubation in 0.2% crystal violet-stained glass tubes. (E) Biofilm formation of the ∆eruA bacteria compared with the WT and ∆eruA-tnaB bacteria by incubation in 0.2% crystal violet-stained 96-well plates for 48 h using uninoculated LB medium as a negative control; 1–8 represent biofilm of the WT, WT, ∆eruA, ∆eruA, ∆eruA-tnaB, and ∆eruA-tnaB bacteria, as well as LB and LB broth, respectively. (F) The absorbance (570 nm) of the biofilms of the ∆eruA bacteria compared with that of the WT and ∆eruA-tnaB bacteria in the 96-well plates for 48 h using an automatic microplate reader. Data are from three independent experiments and are represented as the mean ± SD. Statistical significance was assessed using one-way ANOVA, followed by Tukey’s test. Note: * p < 0.05, ** p < 0.01, *** p < 0.001; **** p < 0.0001. Original images can be found at Supplementary Materials.
Biomolecules 16 00152 g004
Figure 5. EruA can help the AIEC LF82 strain resist environmental stress. (A) The survival rates of the ΔeruA bacteria were significantly lower than those of the WT and CΔeruA bacteria in LB broth (pH 2.0 or 5.8), as determined by counting CFUs on plates. (B) The survival rates of the ΔeruA bacteria were significantly lower than those of the WT or CΔeruA strain grown on 10, 5, or 2 mM H2O2 LB broth, as determined by counting CFUs on plates. (C) The growth curve of the ΔeruA bacteria compared with that of the WT and CΔeruA bacteria grown on standard LB (pH 7.4 and 0 mM H2O2). (D) The growth curve of the WT bacteria compared with that of the ΔeruA and CΔeruA bacteria grown in DMEM (pH 7.4 and 0 mM H2O2). (E) The expression levels of the eruA gene in the WT LF82 strain in acidified DMEM (pH 5.8) compared with those in standard DMEM (pH 7.4) based on qRT-PCR analysis. (F) The expression levels of the eruA gene of the WT LF82 strain in oxidative DMEM (2 mM H2O2) compared with those in standard DMEM (0 mM H2O2) according to qRT-PCR analysis. (G) The expression levels of the tnaB gene in the WT or ΔeruA bacteria cultured in acidified DMEM relative to standard DMEM, as determined using qRT-PCR analysis. (H) The expression levels of the tnaB gene in the WT or ΔeruA bacteria cultured in oxidative DMEM (2 mM H2O2) relative to standard DMEM (0 mM H2O2), as determined using qRT-PCR analysis. Data are from three independent experiments and are represented as the mean ± SD. Statistical significance was assessed using one-way ANOVA, followed by Tukey’s test. Note: * p < 0.05, ** p < 0.01, **** p < 0.0001.
Figure 5. EruA can help the AIEC LF82 strain resist environmental stress. (A) The survival rates of the ΔeruA bacteria were significantly lower than those of the WT and CΔeruA bacteria in LB broth (pH 2.0 or 5.8), as determined by counting CFUs on plates. (B) The survival rates of the ΔeruA bacteria were significantly lower than those of the WT or CΔeruA strain grown on 10, 5, or 2 mM H2O2 LB broth, as determined by counting CFUs on plates. (C) The growth curve of the ΔeruA bacteria compared with that of the WT and CΔeruA bacteria grown on standard LB (pH 7.4 and 0 mM H2O2). (D) The growth curve of the WT bacteria compared with that of the ΔeruA and CΔeruA bacteria grown in DMEM (pH 7.4 and 0 mM H2O2). (E) The expression levels of the eruA gene in the WT LF82 strain in acidified DMEM (pH 5.8) compared with those in standard DMEM (pH 7.4) based on qRT-PCR analysis. (F) The expression levels of the eruA gene of the WT LF82 strain in oxidative DMEM (2 mM H2O2) compared with those in standard DMEM (0 mM H2O2) according to qRT-PCR analysis. (G) The expression levels of the tnaB gene in the WT or ΔeruA bacteria cultured in acidified DMEM relative to standard DMEM, as determined using qRT-PCR analysis. (H) The expression levels of the tnaB gene in the WT or ΔeruA bacteria cultured in oxidative DMEM (2 mM H2O2) relative to standard DMEM (0 mM H2O2), as determined using qRT-PCR analysis. Data are from three independent experiments and are represented as the mean ± SD. Statistical significance was assessed using one-way ANOVA, followed by Tukey’s test. Note: * p < 0.05, ** p < 0.01, **** p < 0.0001.
Biomolecules 16 00152 g005
Table 1. Bacteria and plasmids listed in this work.
Table 1. Bacteria and plasmids listed in this work.
Strain or PlasmidRelevant CharacteristicsSource
Strains  
SM10λpirE. coli; RP4-2 (Km::Tn7,Tc::Mu-1), pro-82, LAMpir, recA1, endA1, thiE1, hsdR17, creC510Prof. Liang [24]
BL21(DE3)E. coil; F-, lon-11, Δ(ompT-nfrA)885, Δ(galM-ybhJ) 884Stratagene
WT LF82AIEC; wild type; Ampr; isolated from humanProf. Zhu [23]
∆eruA LF82AIEC; eruA Deletion mutant of LF82; AmprThis study
C∆eruA LF82AIEC; ∆eruA containing expression plasmid pACYC184-eruA; Cmr, AmprThis study
∆eruA-fimA LF82AIEC; ∆eruA containing expression plasmid pACYC184-fimA; Cmr, AmprThis study
∆eruA-tnaB LF82AIEC; ∆eruA containing expression plasmid pACYC184-tnaB; Cmr, AmprThis study
WT LF82-fluAIEC; containing pBBbr1mcs2-Tac-mcherry plasmid; Kanr, AmprThis study
∆eruA LF82-fluAIEC; ∆eruA containing pBBbr1mcs2-Tac- mcherry plasmid; Kanr, AmprThis study
C∆eruA LF82-fluAIEC; C∆eruA containing pBBbr1mcs2-Tac- mcherry plasmid; Cmr; Kanr, AmprThis study
plasmids  
pDS132Suicide plasmid, mob RP4 oriR6K, SacB, CmrProf. Liang [24]
pACYC184origin, p15A vector; Tetr, CmrStratagene
pET28a+origin, F1 vector, promoter T7, expression plasmid; KanrNovagen
pET28a-eruA435 bp DNA fragment encompassing the eruA cloned into pET28a+; KanrThis study
pDS132-F1F2DNA fragment encompassing upstream and downstream of eruA cloned in pDS132, CmrThis study
pACYC184-eruADNA fragment encompassing eruA ORF cloned in pACYC184; CmrThis study
pACYC184-fimADNA fragment encompassing fimA ORF cloned in pACYC184; Cmr 
pACYC184-tnaBDNA fragment encompassing tnaB ORF cloned in pACYC184; Cmr 
pBBbr1mcs2-Tac-mcherryorigin, Rep pBBR1, oriV, promoter Tac, red fluorescence plasmid; KanrMorzanbio
Table 2. PCR primers or probes and product sizes listed in this work.
Table 2. PCR primers or probes and product sizes listed in this work.
Gene NamePrimer Sequence (5′-3′)Product SizeMethods
RC1145-RT3AAGTTTTGCGATGAGCTTAATCAG-5′RACE-RT
RC1145-RT4CGGGTTTTGTTAATAACGGCTT
RC1145-R3GATCGCTGGCACAAGTTTGAC240 bp5′RACE-PCR (First round)
5′ adaptorGCTGTCAACGATACGCTACGTAACGGCATGACAGTGGGIIGGGIIGGGIIG
RC1145-RT4CGGGTTTTGTTAATAACGGCTT257 bp5′RACE-PCR (Second round)
5.3′ outerGCTGTCAACGATACGCTACGTAAC
RC1145-MZ-Y-FTTGCGATGAGCTTAATCAGTTGTT380 bp5′RACE-PCR
RC1145-MZ-Y-RAGGTTCTGATCTGGCACGGTT
F1-FCATGCATGCATGATGCCATATACTTTGACCATGAG515 bpPCR
F1-RGCTCTAGAGCCACCTGACTGCCATTGCTG
F2-FGCTCTAGAGCAAGATATTATGCGGCTTTTAGAA582 bpPCR
F2-RCGAGCTCGCAATAATACGTCCCGACACCT
X-FGGAATTCCCCTTCATTTCACCCTTTG435 bpPCR
X-RCAAGCTTCGCATAATATCTTAGCAAGCTAATT
eruA-FCGGAATTCCGCCCTTCATTTCACCCTTTG435 bpPCR
eruA-RCCCAAGCTTGGGCGCATAATATCTTAGCAAGCTAATT
eruA-FCGACTGGTCTGGAGGTAA140 bpqRT-PCR
eruA-RAATCGCCACTAGGTTCTG
fimA-FCGGAATTCCGACGACGGTAAATGGTGGGAC422 bpPCR
fim-RCCCAAGCTTGGCAGCACCGGTTGCAAAATA
tnaB-FCGGAATTCCGAAAGCGTGGTTTTCGGTTCG229 bpPCR
tnaB-RCCCAAGCTTGTTCTTGCGGGCTTTGATTGC
evgA-FGCAGAGTTGACTGAAGGCGGA197 bpqRT-PCR
evgA-RGCATCAGCACAATGTTTCCCG
tnaB-FGCTTTACCTGTTGACCTTGC198 bpqRT-PCR
tnaB-RGGCAACGGTAATACCGCTGA
glpC-FCACCAGCTTCGAAAACTGCATT167 bpqRT-PCR
glpC-RAGTTGATGCAATATTTCAGCGCC
yiaK-FAGCAGCCTTTAATCGGGTCT123 bpqRT-PCR
yiaK-RGGGAAACGATTAACGCCGTGAG
tnaA-FTTTGACCTTGAGGGATTAG130 bpqRT-PCR
tnaA-RACATCGCTTTTAAGTTTGC
arcA-FATTCGGTAACGGCTTCATA109 bpqRT-PCR
arcA-RTCGTCATTTAAGTGGTGGG
fimA-FGCAATCGGCTACAAACAAC89 bpqRT-PCR
fimA-RTGGTAAATGCCGCTTGTGC
phoR-FTTGATGTGCCGATGATGCT113 bpqRT-PCR
phoR-RTTCGTTGCCTGACACCTTG
degP-FAACGGCGGCTGAGACTTCTT127 bpqRT-PCR
degP-RCGGCGTATTAACGGTTGTGC
evgS-FGCAAGGAACAACGGGTGGAG183 bpqRT-PCR
evgS-RCAGCAATCGCAGCGAAAGAG
glcB-FTTTGCCCATCCACAACAACC203 bpqRT-PCR
glcB-RTCATCTGCTGGCGTTAAGTCG
hflC-FATCGTGCTGGTAGTGCTTT184 bpqRT-PCR
hflC-RTGGTCTGAATACGTGCGTC
mdtE-FACACCGCACGCACCCAGTT135 bpqRT-PCR
mdtE-RCCGACGATTTCCCGCTGAC
mdtF-FGATAGGGTTACTGGTGGAT259 bpqRT-PCR
mdtF-RGCTCATTGCTACAAATACTG
mgtA-FTTTGCCGCAGGTGTTATCG156 bpqRT-PCR
mgtA-RGCCATTTTCGCCTTTGTCG
nuoF-FTGCGTGGGCACAGAAAGTT265 bpqRT-PCR
nuoF-RCATCGGTAAAGCGGGAAGC
nuoE-FAACCGTTGATGTGACAGAC185 bpqRT-PCR
nuoE-RGAAAATCGTTCAGAAGCAG
proV-FGGATGCGTCAACGAGTGGG145 bpqRT-PCR
proV-RCGCTGATGTTTCGCCTGTA
proX-FTCAATAAACCCAGCGAAGT182 bpqRT-PCR
proX-RGATCAGGTAACCCTGTGCC
proW-FTATTCGTCCACTGCTTGAT240 bpqRT-PCR
ProW-RAGCGGTAACTGAACTTTGA
pstA-FAGCAGCAGTACGCACAGGG273 bpqRT-PCR
pstA-RTACGCCGAAGTGGAAGATG
pstC-FCCAGATAACTTCCCAGGTG235 bpqRT-PCR
stC-RGTTCGCCGTTTACTTCCAG
phoB-FAAGAACCGCTGGAGATGGG163 bpqRT-PCR
PhoB-RTTACGCAGGCGACGAATGT
rstB-FCTGGGGTAAGACGCTGAAA263 bpqRT-PCR
rstB-RGGGAAATGGCAATAAAAGC
rstA-FCGGACCGATTGTTCTTCTA159 bpqRT-PCR
rstA-RGTCACTGTGGCTTGCTCAT
slyA-FTTGCGACTGGTCTGGAGGT132 bpqRT-PCR
slyA-RGGTTCTGATCTGGCACGGT
sdhB-FACACCCTGGAAGCGGAAGA186 bpqRT-PCR
sdhB-RGCTGGTTGAGTGCCGAAAT
treB-FTGCTTGCGGCTGGAAATGAT314 bpqRT-PCR
treB-RGTGCCCGTCTGTTCGCTGAT
trpE-FCTTCATCGCTCTGGTTACAT119 bpqRT-PCR
trpE-RAAAACAACGTCTCACTGCTC
ybjX-FTAATGGCGTTCAGCATCACA281 bpqRT-PCR
ybjX-RACGATGTTTATTGGCGGACT
ybtA-FGCAAACGCAATCTGAAATCT235 bpqRT-PCR
ybtA-RGAGTCCCTGAATCGCAAAGC
wecC-FCTGCCGTAGAAGGCGGTTTT187 bpqRT-PCR
wecC-RGGCGAGGTGGATTCAAGGAT
16S rRNA-FGTAGTCCACGCTGTAAACGA173 bpqRT-PCR
16S rRNA-RGAATTAAACCACATGCTCCA
PfimA-F5′-CY3-TCCATGTGTTAAGAGGATAAGCGGGGAAACCG32 bp probeEMSA
PfimA-R5′-CY3-CGGTTTCCCCGCTTATCCTCTTAACACATGGA
mPfimA-F5′-CY3-TCCATGTG∆AGCGGGGAAACCG21 bp probeEMSA
mPfimA-R5′-CY3-CGGTTTCCCCGCT∆CACATGGA
uPfimA-F5′-TCCATGTGTTAAGAGGATAAGCGGGGAAACCG32 bp probeEMSA
uPfimA-R5′-CGGTTTCCCCGCTTATCCTCTTAACACATGGA
PtnaB-F5′-CY3-GCGGCGAATATTAAAGGGTTAACCTTTACCTA32 bp probeEMSA
PtnaB-R5′-CY3-TAGGTAAAGGTTAACCCTTTAATATTCGCCGC
mPtnaB-F5′-CY3-GCGGCGAATAAA∆AACCTTTACCTA24 bp probeEMSA
mPtnaB-R5′-CY3-TAGGTAAAGGT∆TTTTATTCGCCGC
uPtnaB-F5′-GCGGCGAATATTAAAGGGTTAACCTTTACCTA32 bp probeEMSA
uPtnaB-R5′-TAGGTAAAGGTTAACCCTTTAATATTCGCCGC
F: forward primer. R: reverse primer. The underlined nucleotide sequence represents the motif.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, Z.; Qin, C.; Zhang, R.; Wu, M.; Cui, A.; Chen, W.; Chen, L.; Gao, D.; Shi, R. EruA, a Regulator of Adherent-Invasive E. coli, Enhances Bacterial Pathogenicity by Promoting Adhesion to Epithelial Cells and Survival Within Macrophages. Biomolecules 2026, 16, 152. https://doi.org/10.3390/biom16010152

AMA Style

Xu Z, Qin C, Zhang R, Wu M, Cui A, Chen W, Chen L, Gao D, Shi R. EruA, a Regulator of Adherent-Invasive E. coli, Enhances Bacterial Pathogenicity by Promoting Adhesion to Epithelial Cells and Survival Within Macrophages. Biomolecules. 2026; 16(1):152. https://doi.org/10.3390/biom16010152

Chicago/Turabian Style

Xu, Zeyan, Chuyu Qin, Ruohan Zhang, Mengting Wu, Anqi Cui, Wei Chen, Lu Chen, Daqing Gao, and Ruihua Shi. 2026. "EruA, a Regulator of Adherent-Invasive E. coli, Enhances Bacterial Pathogenicity by Promoting Adhesion to Epithelial Cells and Survival Within Macrophages" Biomolecules 16, no. 1: 152. https://doi.org/10.3390/biom16010152

APA Style

Xu, Z., Qin, C., Zhang, R., Wu, M., Cui, A., Chen, W., Chen, L., Gao, D., & Shi, R. (2026). EruA, a Regulator of Adherent-Invasive E. coli, Enhances Bacterial Pathogenicity by Promoting Adhesion to Epithelial Cells and Survival Within Macrophages. Biomolecules, 16(1), 152. https://doi.org/10.3390/biom16010152

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop