Stable Dopamine-Signaling mRNA Co-Expression in the Substantia Nigra Is Deregulated in Pathological Conditions, but Not in Dopamine Transporter Knockout Rats †
Abstract
1. Introduction
2. Materials and Methods
2.1. Public Resources and Databases
2.2. Data Normalization and Statistical Analysis
2.3. Measurement of Co-Expression and Functional Analysis
2.4. Animals
2.5. RNA Isolation, Reverse Transcription, and Quantitative Polymerase Chain Reaction (qPCR)
3. Results
3.1. DAT Expression in the Mouse Substantia Nigra and Its Association with Other Components of Dopaminergic Signaling
3.2. DAT Expression in the Mouse Substantia Nigra Is Stable in Damaged Mouse Substantia Nigra, but Its Functional Interactions Undergo Significant Changes
3.3. The Association Between DAT and Other Genes Involved in Dopamine Synthesis and Signaling Is Destroyed in Parkinson’s Disease
3.4. Co-Expression of Key Components of DAT-Co-Expressed Genes in Damaged SN Samples
3.5. Stable Co-Expression of Key Components of DAT-Co-Expressed Genes in DAT-KO Rats
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Efimova, E.V.; Gainetdinov, R.R.; Budygin, E.A.; Sotnikova, T.D. Dopamine Transporter Mutant Animals: A Translational Perspective. J. Neurogenet. 2016, 30, 5–15. [Google Scholar] [CrossRef]
- Efimova, E.V.; Kozlova, A.A.; Razenkova, V.; Katolikova, N.V.; Antonova, K.A.; Sotnikova, T.D.; Merkulyeva, N.S.; Veshchitskii, A.S.; Kalinina, D.S.; Korzhevskii, D.E.; et al. Increased Dopamine Transmission and Adult Neurogenesis in Trace Amine-Associated Receptor 5 (TAAR5) Knockout Mice. Neuropharmacology 2021, 182, 108373. [Google Scholar] [CrossRef]
- Kennedy, J.L.; Xiong, N.; Yu, J.; Zai, C.C.; Pouget, J.G.; Li, J.; Liu, K.; Qing, H.; Wang, T.; Martin, E.; et al. Increased Nigral SLC6A3 Activity in Schizophrenia Patients: Findings From the Toronto–McLean Cohorts. Schizophr. Bull. 2016, 42, 772–781. [Google Scholar] [CrossRef][Green Version]
- Artiges, E.; Leroy, C.; Dubol, M.; Prat, M.; Pepin, A.; Mabondo, A.; de Beaurepaire, R.; Beaufils, B.; Korwin, J.-P.; Galinowski, A.; et al. Striatal and Extrastriatal Dopamine Transporter Availability in Schizophrenia and Its Clinical Correlates: A Voxel-Based and High-Resolution PET Study. Schizophr. Bull. 2017, 43, 1134–1142. [Google Scholar] [CrossRef]
- Hsueh, Y.-S.; Lin, C.-Y.; Chiu, N.-T.; Yang, Y.K.; Chen, P.S.; Chang, H.H. Changes in Striatal Dopamine Transporters in Bipolar Disorder and Valproate Treatment. Eur. Psychiatry 2021, 64, e9. [Google Scholar] [CrossRef]
- Yatham, L.N.; Liddle, P.F.; Gonzalez, M.; Saraf, G.; Vafai, N.; Lam, R.W.; Sossi, V. A Positron Emission Tomography Study of Dopamine Transporter Density in Patients with Bipolar Disorder with Current Mania and Those with Recently Remitted Mania. JAMA Psychiatry 2022, 79, 1217–1224. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Justice, J.B. Differential Effect of Structural Modification of Human Dopamine Transporter on the Inward and Outward Transport of Dopamine. Brain Res. Mol. Brain Res. 2000, 75, 208–215. [Google Scholar] [CrossRef] [PubMed]
- Mazei-Robison, M.S.; Bowton, E.; Holy, M.; Schmudermaier, M.; Freissmuth, M.; Sitte, H.H.; Galli, A.; Blakely, R.D. Anomalous Dopamine Release Associated with a Human Dopamine Transporter Coding Variant. J. Neurosci. 2008, 28, 7040–7046. [Google Scholar] [CrossRef] [PubMed]
- Kurian, M.A.; Li, Y.; Zhen, J.; Meyer, E.; Hai, N.; Christen, H.-J.; Hoffmann, G.F.; Jardine, P.; von Moers, A.; Mordekar, S.R.; et al. Clinical and Molecular Characterisation of Hereditary Dopamine Transporter Deficiency Syndrome: An Observational Cohort and Experimental Study. Lancet Neurol. 2011, 10, 54–62. [Google Scholar] [CrossRef]
- Reith, M.E.A.; Kortagere, S.; Wiers, C.E.; Sun, H.; Kurian, M.A.; Galli, A.; Volkow, N.D.; Lin, Z. The Dopamine Transporter Gene SLC6A3: Multidisease Risks. Mol. Psychiatry 2022, 27, 1031–1046. [Google Scholar] [CrossRef]
- Saari, L.; Kivinen, K.; Gardberg, M.; Joutsa, J.; Noponen, T.; Kaasinen, V. Dopamine Transporter Imaging Does Not Predict the Number of Nigral Neurons in Parkinson Disease. Neurology 2017, 88, 1461–1467. [Google Scholar] [CrossRef] [PubMed]
- Frosini, D.; Cosottini, M.; Volterrani, D.; Ceravolo, R. Neuroimaging in Parkinson’s Disease: Focus on Substantia Nigra and Nigro-Striatal Projection. Curr. Opin. Neurol. 2017, 30, 416–426. [Google Scholar] [CrossRef] [PubMed]
- Isaias, I.U.; Trujillo, P.; Summers, P.; Marotta, G.; Mainardi, L.; Pezzoli, G.; Zecca, L.; Costa, A. Neuromelanin Imaging and Dopaminergic Loss in Parkinson’s Disease. Front. Aging Neurosci. 2016, 8, 196. [Google Scholar] [CrossRef] [PubMed]
- Rezai Amin, S.; Gruszczynski, C.; Guiard, B.P.; Callebert, J.; Launay, J.-M.; Louis, F.; Betancur, C.; Vialou, V.; Gautron, S. Viral Vector-Mediated Cre Recombinase Expression in Substantia Nigra Induces Lesions of the Nigrostriatal Pathway Associated with Perturbations of Dopamine-Related Behaviors and Hallmarks of Programmed Cell Death. J. Neurochem. 2019, 150, 330–340. [Google Scholar] [CrossRef]
- Brücke, T.; Brücke, C. Dopamine Transporter (DAT) Imaging in Parkinson’s Disease and Related Disorders. J. Neural Transm. 2022, 129, 581–594. [Google Scholar] [CrossRef] [PubMed]
- Walker, Z.; Costa, D.C.; Walker, R.W.H.; Lee, L.; Livingston, G.; Jaros, E.; Perry, R.; McKeith, I.; Katona, C.L.E. Striatal Dopamine Transporter in Dementia with Lewy Bodies and Parkinson Disease. Neurology 2004, 62, 1568–1572. [Google Scholar] [CrossRef]
- Yang, Z.; Xie, Y.; Dou, K.; Yang, L.; Xie, A. Associations of Striatal Dopamine Transporter Binding with Motor and Non-Motor Symptoms in Early Parkinson’s Disease. Clin. Transl. Sci. 2023, 16, 1021–1038. [Google Scholar] [CrossRef]
- Chouker, M.; Tatsch, K.; Linke, R.; Pogarell, O.; Hahn, K.; Schwarz, J. Striatal Dopamine Transporter Binding in Early to Moderately Advanced Parkinson’s Disease: Monitoring of Disease Progression over 2 Years. Nucl. Med. Commun. 2001, 22, 721–725. [Google Scholar] [CrossRef]
- Ni, A.; Ernst, C. Evidence That Substantia Nigra Pars Compacta Dopaminergic Neurons Are Selectively Vulnerable to Oxidative Stress Because They Are Highly Metabolically Active. Front. Cell Neurosci. 2022, 16, 826193. [Google Scholar] [CrossRef]
- Tagliaferro, P.; Burke, R.E. Retrograde Axonal Degeneration in Parkinson Disease. J. Park. Dis. 2016, 6, 1–15. [Google Scholar] [CrossRef]
- Salvatore, M.F. Dopamine Signaling in Substantia Nigra and Its Impact on Locomotor Function—Not a New Concept, but Neglected Reality. Int. J. Mol. Sci. 2024, 25, 1131. [Google Scholar] [CrossRef] [PubMed]
- Martín-Bastida, A.; Lao-Kaim, N.P.; Roussakis, A.A.; Searle, G.E.; Xing, Y.; Gunn, R.N.; Schwarz, S.T.; Barker, R.A.; Auer, D.P.; Piccini, P. Relationship between Neuromelanin and Dopamine Terminals within the Parkinson’s Nigrostriatal System. Brain 2019, 142, 2023–2036. [Google Scholar] [CrossRef] [PubMed]
- Palermo, G.; Giannoni, S.; Bellini, G.; Siciliano, G.; Ceravolo, R. Dopamine Transporter Imaging, Current Status of a Potential Biomarker: A Comprehensive Review. Int. J. Mol. Sci. 2021, 22, 11234. [Google Scholar] [CrossRef]
- Xicoy, H.; Brouwers, J.F.; Wieringa, B.; Martens, G.J.M. Explorative Combined Lipid and Transcriptomic Profiling of Substantia Nigra and Putamen in Parkinson’s Disease. Cells 2020, 9, 1966. [Google Scholar] [CrossRef]
- Reinwald, J.R.; Gass, N.; Mallien, A.S.; Sartorius, A.; Becker, R.; Sack, M.; Falfan-Melgoza, C.; von Hohenberg, C.C.; Leo, D.; Pfeiffer, N.; et al. Dopamine Transporter Silencing in the Rat: Systems-Level Alterations in Striato-Cerebellar and Prefrontal-Midbrain Circuits. Mol. Psychiatry 2022, 27, 2329–2339. [Google Scholar] [CrossRef]
- Leo, D.; Sukhanov, I.; Zoratto, F.; Illiano, P.; Caffino, L.; Sanna, F.; Messa, G.; Emanuele, M.; Esposito, A.; Dorofeikova, M.; et al. Pronounced Hyperactivity, Cognitive Dysfunctions, and BDNF Dysregulation in Dopamine Transporter Knock-out Rats. J. Neurosci. 2018, 38, 1959–1972. [Google Scholar] [CrossRef]
- Lloyd, J.T.; Yee, A.G.; Kalligappa, P.K.; Jabed, A.; Cheung, P.Y.; Todd, K.L.; Karunasinghe, R.N.; Vlajkovic, S.M.; Freestone, P.S.; Lipski, J. Dopamine Dysregulation and Altered Responses to Drugs Affecting Dopaminergic Transmission in a New Dopamine Transporter Knockout (DAT-KO) Rat Model. Neuroscience 2022, 491, 43–64. [Google Scholar] [CrossRef]
- Ghisi, V.; Ramsey, A.J.; Masri, B.; Gainetdinov, R.R.; Caron, M.G.; Salahpour, A. Reduced D2-Mediated Signaling Activity and Trans-Synaptic Upregulation of D1 and D2 Dopamine Receptors in Mice Overexpressing the Dopamine Transporter. Cell. Signal. 2009, 21, 87–94. [Google Scholar] [CrossRef]
- Morice, E.; Denis, C.; Giros, B.; Nosten-Bertrand, M. Phenotypic Expression of the Targeted Null-Mutation in the Dopamine Transporter Gene Varies as a Function of the Genetic Background. Eur. J. Neurosci. 2004, 20, 120–126. [Google Scholar] [CrossRef] [PubMed]
- Traktirov, D.S.; Nazarov, I.R.; Artemova, V.S.; Gainetdinov, R.R.; Pestereva, N.S.; Karpenko, M.N. Alterations in Serotonin Neurotransmission in Hyperdopaminergic Rats Lacking the Dopamine Transporter. Biomedicines 2023, 11, 2881. [Google Scholar] [CrossRef]
- Wu, N.; Cepeda, C.; Zhuang, X.; Levine, M.S. Altered Corticostriatal Neurotransmission and Modulation in Dopamine Transporter Knock-Down Mice. J. Neurophysiol. 2007, 98, 423–432. [Google Scholar] [CrossRef]
- Del’Guidice, T.; Lemasson, M.; Etiévant, A.; Manta, S.; Magno, L.A.V.; Escoffier, G.; Roman, F.S.; Beaulieu, J.-M. Dissociations between Cognitive and Motor Effects of Psychostimulants and Atomoxetine in Hyperactive DAT-KO Mice. Psychopharmacology 2014, 231, 109–122. [Google Scholar] [CrossRef]
- Gainetdinov, R.R.; Caron, M.G. Genetics of Childhood Disorders: XXIV. ADHD, Part 8: Hyperdopaminergic Mice as an Animal Model of ADHD. J. Am. Acad. Child Adolesc. Psychiatry 2001, 40, 380–382. [Google Scholar] [CrossRef]
- Trinh, J.V.; Nehrenberg, D.L.; Jacobsen, J.P.R.; Caron, M.G.; Wetsel, W.C. Differential Psychostimulant-Induced Activation of Neural Circuits in Dopamine Transporter Knockout and Wild Type Mice. Neuroscience 2003, 118, 297–310. [Google Scholar] [CrossRef]
- Adinolfi, A.; Zelli, S.; Leo, D.; Carbone, C.; Mus, L.; Illiano, P.; Alleva, E.; Gainetdinov, R.R.; Adriani, W. Behavioral Characterization of DAT-KO Rats and Evidence of Asocial-like Phenotypes in DAT-HET Rats: The Potential Involvement of Norepinephrine System. Behav. Brain Res. 2019, 359, 516–527. [Google Scholar] [CrossRef]
- Wong, P.; Sze, Y.; Chang, C.C.R.; Lee, J.; Zhang, X. Pregnenolone Sulfate Normalizes Schizophrenia-like Behaviors in Dopamine Transporter Knockout Mice through the AKT/GSK3β Pathway. Transl. Psychiatry 2015, 5, e528. [Google Scholar] [CrossRef] [PubMed]
- Wong, P.; Chang, C.C.R.; Marx, C.E.; Caron, M.G.; Wetsel, W.C.; Zhang, X. Pregnenolone Rescues Schizophrenia-Like Behavior in Dopamine Transporter Knockout Mice. PLoS ONE 2012, 7, e51455. [Google Scholar] [CrossRef] [PubMed]
- Belskaya, A.; Kurzina, N.; Savchenko, A.; Sukhanov, I.; Gromova, A.; Gainetdinov, R.R.; Volnova, A. Rats Lacking the Dopamine Transporter Display Inflexibility in Innate and Learned Behavior. Biomedicines 2024, 12, 1270. [Google Scholar] [CrossRef]
- Cinque, S.; Zoratto, F.; Poleggi, A.; Leo, D.; Cerniglia, L.; Cimino, S.; Tambelli, R.; Alleva, E.; Gainetdinov, R.R.; Laviola, G.; et al. Behavioral Phenotyping of Dopamine Transporter Knockout Rats: Compulsive Traits, Motor Stereotypies, and Anhedonia. Front. Psychiatry 2018, 9, 43. [Google Scholar] [CrossRef] [PubMed]
- Kalinina, D.S.; Lyakhovetskii, V.A.; Gorskii, O.V.; Shkorbatova, P.Y.; Pavlova, N.V.; Bazhenova, E.Y.; Sysoev, Y.I.; Gainetdinov, R.R.; Musienko, P.E. Alteration of Postural Reactions in Rats with Different Levels of Dopamine Depletion. Biomedicines 2023, 11, 1958. [Google Scholar] [CrossRef]
- Casamassimi, A.; Federico, A.; Rienzo, M.; Esposito, S.; Ciccodicola, A. Transcriptome Profiling in Human Diseases: New Advances and Perspectives. Int. J. Mol. Sci. 2017, 18, 1652. [Google Scholar] [CrossRef] [PubMed]
- Kolobkov, D.S.; Sviridova, D.A.; Abilev, S.K.; Kuzovlev, A.N.; Salnikova, L.E. Genes and Diseases: Insights from Transcriptomics Studies. Genes 2022, 13, 1168. [Google Scholar] [CrossRef]
- Barrett, T.; Wilhite, S.E.; Ledoux, P.; Evangelista, C.; Kim, I.F.; Tomashevsky, M.; Marshall, K.A.; Phillippy, K.H.; Sherman, P.M.; Holko, M.; et al. NCBI GEO: Archive for Functional Genomics Data Sets—Update. Nucleic Acids Res. 2013, 41, D991–D995. [Google Scholar] [CrossRef]
- Burmeister, A.R.; Gordevicius, J.; Paul, E.N.; Houck, C.; George, S.; Escobar Galvis, M.L.; Sha, Q.; Brundin, P.; Pospisilik, J.A.; Racicot, K.; et al. Maternal Herpesviridae Infection during Pregnancy Alters Midbrain Dopaminergic Signatures in Adult Offspring. Neurobiol. Dis. 2022, 169, 105720. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor Package for Differential Expression Analysis of Digital Gene Expression Data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
- Chen, Y.; Lun, A.T.L.; Smyth, G.K. From Reads to Genes to Pathways: Differential Expression Analysis of RNA-Seq Experiments Using Rsubread and the edgeR Quasi-Likelihood Pipeline. F1000Research 2016, 5, 1438. [Google Scholar] [CrossRef] [PubMed]
- Wickham, H. Ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016; ISBN 978-3-319-24277-4. [Google Scholar]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene Ontology: Tool for the Unification of Biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
- Yu, G.; Li, F.; Qin, Y.; Bo, X.; Wu, Y.; Wang, S. GOSemSim: An R Package for Measuring Semantic Similarity among GO Terms and Gene Products. Bioinformatics 2010, 26, 976–978. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.; Hu, E.; Xu, S.; Chen, M.; Guo, P.; Dai, Z.; Feng, T.; Zhou, L.; Tang, W.; Zhan, L.; et al. clusterProfiler 4.0: A Universal Enrichment Tool for Interpreting Omics Data. Innov. 2021, 2, 100141. [Google Scholar] [CrossRef]
- Yin, M.; Feng, C.; Yu, Z.; Zhang, Y.; Li, Y.; Wang, X.; Song, C.; Guo, M.; Li, C. sc2GWAS: A Comprehensive Platform Linking Single Cell and GWAS Traits of Human. Nucleic Acids Res. 2025, 53, D1151–D1161. [Google Scholar] [CrossRef]
- Qian, F.-C.; Zhou, L.-W.; Li, Y.-Y.; Yu, Z.-M.; Li, L.-D.; Wang, Y.-Z.; Xu, M.-C.; Wang, Q.-Y.; Li, C.-Q. SEanalysis 2.0: A Comprehensive Super-Enhancer Regulatory Network Analysis Tool for Human and Mouse. Nucleic Acids Res. 2023, 51, W520–W527. [Google Scholar] [CrossRef] [PubMed]
- Cheng, M.; Li, T.; Hu, E.; Yan, Q.; Li, H.; Wang, Y.; Luo, J.; Tang, T. A Novel Strategy of Integrating Network Pharmacology and Transcriptome Reveals Antiapoptotic Mechanisms of Buyang Huanwu Decoction in Treating Intracerebral Hemorrhage. J. Ethnopharmacol. 2024, 319, 117123. [Google Scholar] [CrossRef]
- Piñero, J.; Bravo, À.; Queralt-Rosinach, N.; Gutiérrez-Sacristán, A.; Deu-Pons, J.; Centeno, E.; García-García, J.; Sanz, F.; Furlong, L.I. DisGeNET: A Comprehensive Platform Integrating Information on Human Disease-Associated Genes and Variants. Nucleic Acids Res. 2016, 45, D833. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Wang, L.-G.; Yan, G.-R.; He, Q.-Y. DOSE: An R/Bioconductor Package for Disease Ontology Semantic and Enrichment Analysis. Bioinformatics 2015, 31, 608–609. [Google Scholar] [CrossRef]
- Diedenhofen, B.; Musch, J. Cocor: A Comprehensive Solution for the Statistical Comparison of Correlations. PLoS ONE 2015, 10, e0121945. [Google Scholar] [CrossRef]
- Khan-Malek, R.; Wang, Y. Statistical Analysis of Quantitative RT-PCR Results. In Drug Safety Evaluation: Methods and Protocols; Gautier, J.-C., Ed.; Springer: New York, NY, USA, 2017; pp. 281–296. ISBN 978-1-4939-7172-5. [Google Scholar]
- Alfonso, J.; Pollevick, G.D.; Castensson, A.; Jazin, E.; Frasch, A.C.C. Analysis of Gene Expression in the Rat Hippocampus Using Real Time PCR Reveals High Inter-Individual Variation in mRNA Expression Levels. J. Neurosci. Res. 2002, 67, 225–234. [Google Scholar] [CrossRef]
- Hobson, B.D.; Stanley, A.T.; De Los Santos, M.B.; Culbertson, B.; Mosharov, E.V.; Sims, P.A.; Sulzer, D. Conserved and Cell Type-Specific Transcriptional Responses to IFN-γ in the Ventral Midbrain. Brain Behav. Immun. 2023, 111, 277–291. [Google Scholar] [CrossRef]
- Simchovitz, A.; Hanan, M.; Yayon, N.; Lee, S.; Bennett, E.R.; Greenberg, D.S.; Kadener, S.; Soreq, H. A lncRNA Survey Finds Increases in Neuroprotective LINC-PINT in Parkinson’s Disease Substantia Nigra. Aging Cell 2020, 19, e13115. [Google Scholar] [CrossRef] [PubMed]
- Aguila, J.; Cheng, S.; Kee, N.; Cao, M.; Wang, M.; Deng, Q.; Hedlund, E. Spatial RNA Sequencing Identifies Robust Markers of Vulnerable and Resistant Human Midbrain Dopamine Neurons and Their Expression in Parkinson’s Disease. Front. Mol. Neurosci. 2021, 14, 699562. [Google Scholar] [CrossRef]
- Mingazov, E.R.; Ugryumov, M.V. Molecular Markers of Dopamine Transport in Nigrostriatal Dopaminergic Neurons as an Index of Neurodegeneration and Neuroplasticity. Neurochem. J. 2019, 13, 43–48. [Google Scholar] [CrossRef]
- Gopinath, A.; Mackie, P.; Hashimi, B.; Buchanan, A.M.; Smith, A.R.; Bouchard, R.; Shaw, G.; Badov, M.; Saadatpour, L.; Gittis, A.; et al. DAT and TH Expression Marks Human Parkinson’s Disease in Peripheral Immune Cells. npj Park. Dis. 2022, 8, 72. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Brown, A.; Fisher, D.; Wu, Y.; Warren, J.; Cui, X. Tissue Specific Expression of Cre in Rat Tyrosine Hydroxylase and Dopamine Active Transporter-Positive Neurons. PLoS ONE 2016, 11, e0149379. [Google Scholar] [CrossRef]
- Block, E.R.; Nuttle, J.; Balcita-Pedicino, J.J.; Caltagarone, J.; Watkins, S.C.; Sesack, S.R.; Sorkin, A. Brain Region-Specific Trafficking of the Dopamine Transporter. J. Neurosci. 2015, 35, 12845–12858. [Google Scholar] [CrossRef]
- Ren, Y.; Jiang, H.; Pu, J.; Li, L.; Wu, J.; Yan, Y.; Zhao, G.; Guttuso, T.J.; Zhang, B.; Feng, J. Molecular Features of Parkinson’s Disease in Patient-Derived Midbrain Dopaminergic Neurons. Mov. Disord. 2022, 37, 70–79. [Google Scholar] [CrossRef]
- Parkinson, G.M.; Dayas, C.V.; Smith, D.W. Age-Related Gene Expression Changes in Substantia Nigra Dopamine Neurons of the Rat. Mech. Ageing Dev. 2015, 149, 41–49. [Google Scholar] [CrossRef]
- Talkowski, M.E.; McCann, K.L.; Chen, M.; McClain, L.; Bamne, M.; Wood, J.; Chowdari, K.V.; Watson, A.; Prasad, K.M.; Kirov, G.; et al. Fine-Mapping Reveals Novel Alternative Splicing of the Dopamine Transporter. Am. J. Med. Genet. Part B Neuropsychiatr. Genet. 2010, 153B, 1434–1447. [Google Scholar] [CrossRef]
- Salatino-Oliveira, A.; Rohde, L.A.; Hutz, M.H. The Dopamine Transporter Role in Psychiatric Phenotypes. Am. J. Med. Genet. Part B Neuropsychiatr. Genet. 2018, 177, 211–231. [Google Scholar] [CrossRef] [PubMed]
- Vaughan, R.A.; Foster, J.D. Mechanisms of Dopamine Transporter Regulation in Normal and Disease States. Trends Pharmacol. Sci. 2013, 34, 489–496. [Google Scholar] [CrossRef]
- Chapman, M.A.; Sorg, B.A. A Systematic Review of Extracellular Matrix-Related Alterations in Parkinson’s Disease. Brain Sci. 2024, 14, 522. [Google Scholar] [CrossRef] [PubMed]
- Rosh, I.; Tripathi, U.; Hussein, Y.; Rike, W.A.; Djamus, J.; Shklyar, B.; Manole, A.; Houlden, H.; Winkler, J.; Gage, F.H.; et al. Synaptic Dysfunction and Extracellular Matrix Dysregulation in Dopaminergic Neurons from Sporadic and E326K-GBA1 Parkinson’s Disease Patients. npj Park. Dis. 2024, 10, 38. [Google Scholar] [CrossRef]
- Chien, C.-H.; Lee, M.-J.; Liou, H.-C.; Liou, H.-H.; Fu, W.-M. Microglia-Derived Cytokines/Chemokines Are Involved in the Enhancement of LPS-Induced Loss of Nigrostriatal Dopaminergic Neurons in DJ-1 Knockout Mice. PLoS ONE 2016, 11, e0151569. [Google Scholar] [CrossRef]
- O’Donnell, L.A.; Henkins, K.M.; Kulkarni, A.; Matullo, C.M.; Balachandran, S.; Pattisapu, A.K.; Rall, G.F. Interferon Gamma Induces Protective Non-Canonical Signaling Pathways in Primary Neurons. J. Neurochem. 2015, 135, 309–322. [Google Scholar] [CrossRef]
- Fan, H.-H.; Hou, N.-N.; Zhang, D.-L.; Liu, D.-N.; Tang, R.-T.; Luo, H.-T.; Song, Y.-D.; Cui, L.; Zhang, X.; Zhu, J.-H. Substantia Nigra and Blood Gene Signatures and Biomarkers for Parkinson’s Disease from Integrated Multicenter Microarray-Based Transcriptomic Analyses. Front. Aging Neurosci. 2025, 17, 1540830. [Google Scholar] [CrossRef]
- Bhat, H.; Lang, K.S.; Hardt, C.; Lang, J. Interferon in the CNS. Neurosignals 2019, 27, 44–53. [Google Scholar] [CrossRef]
- Schoggins, J.W. Interferon-Stimulated Genes: What Do They All Do? Annu. Rev. Virol. 2019, 6, 567–584. [Google Scholar] [CrossRef] [PubMed]
- Babenko, V.N.; Smagin, D.A.; Kovalenko, I.L.; Galyamina, A.G.; Kudryavtseva, N.N. Differentially Expressed Genes of the Slc6a Family as Markers of Altered Brain Neurotransmitter System Function in Pathological States in Mice. Neurosci. Behav. Physi. 2020, 50, 199–209. [Google Scholar] [CrossRef]
- Salvatore, M.F.; Calipari, E.S.; Jones, S.R. Regulation of Tyrosine Hydroxylase Expression and Phosphorylation in Dopamine Transporter-Deficient Mice. ACS Chem. Neurosci. 2016, 7, 941–951. [Google Scholar] [CrossRef] [PubMed]
- Benoit-Marand, M.; Jaber, M.; Gonon, F. Release and Elimination of Dopamine in Vivo in Mice Lacking the Dopamine Transporter: Functional Consequences. Eur. J. Neurosci. 2000, 12, 2985–2992. [Google Scholar] [CrossRef]
- Sørensen, G.; Rickhag, M.; Leo, D.; Lycas, M.D.; Ridderstrøm, P.H.; Weikop, P.; Lilja, J.H.; Rifes, P.; Herborg, F.; Woldbye, D.; et al. Disruption of the PDZ Domain–Binding Motif of the Dopamine Transporter Uniquely Alters Nanoscale Distribution, Dopamine Homeostasis, and Reward Motivation. J. Biol. Chem. 2021, 297, 101361. [Google Scholar] [CrossRef]
- Fauchey, V.; Jaber, M.; Caron, M.G.; Bloch, B.; Le Moine, C. Differential Regulation of the Dopamine D1, D2 and D3 Receptor Gene Expression and Changes in the Phenotype of the Striatal Neurons in Mice Lacking the Dopamine Transporter. Eur. J. Neurosci. 2000, 12, 19–26. [Google Scholar] [CrossRef]
- Hadar, R.; Edemann-Callesen, H.; Reinel, C.; Wieske, F.; Voget, M.; Popova, E.; Sohr, R.; Avchalumov, Y.; Priller, J.; van Riesen, C.; et al. Rats Overexpressing the Dopamine Transporter Display Behavioral and Neurobiological Abnormalities with Relevance to Repetitive Disorders. Sci. Rep. 2016, 6, 39145. [Google Scholar] [CrossRef] [PubMed]
- Jaber, M.; Dumartin, B.; Sagné, C.; Haycock, J.W.; Roubert, C.; Giros, B.; Bloch, B.; Caron, M.G. Differential Regulation of Tyrosine Hydroxylase in the Basal Ganglia of Mice Lacking the Dopamine Transporter. Eur. J. Neurosci. 1999, 11, 3499–3511. [Google Scholar] [CrossRef] [PubMed]
- Fesenko, Z.; Ptukha, M.; da Silva, M.M.; de Carvalho, R.S.M.; Tsytsarev, V.; Gainetdinov, R.R.; Faber, J.; Volnova, A.B. Electrophysiological and Behavioral Markers of Hyperdopaminergia in DAT-KO Rats. Biomedicines 2024, 12, 2114. [Google Scholar] [CrossRef] [PubMed]







| Dataset ID | Title | n | Sequencing Platform | Samples Characteristics |
|---|---|---|---|---|
| GSE218132 | Conserved and cell type-specific transcriptional responses to IFN-γ in the ventral midbrain | 48 | Illumina NextSeq 500, Illumina NovaSeq 6000 | Isolated nuclei samples. Midbrain samples from C57BL/6J mice harvested in 6, 24, 48 or 72 h after intracranial IFNG injection. |
| 36 | Isolated nuclei samples. Midbrain samples of vehicle control C57BL/6J mice. | |||
| GSE162566 | Infection with herpesviridae in pregnant dams alters midbrain dopaminergic signatures in adult offspring | 18 | Illumina NovaSeq 6000 | Murine tissue samples. 8 weeks of age offspring of dames infected by murine cytomegalovirus (for details refer [44]) |
| 15 | Murine tissue samples. 8 weeks of age offspring of dames infected by Murid herpesvirus 68 (for details refer [44]) | |||
| 15 | Murine tissue samples. Midbrain samples of intact animals. | |||
| GSE114517 | Next generation sequencing reveals upregulation of the lncRNA LINC-PINT in the substantia nigra of human Parkinson’s disease patients compared to control donors | 17 | Illumina NextSeq 500 | Human tissue samples. Substantia nigra from patients without Parkinson’s disease. |
| 12 | Human tissue samples. Substantia nigra from patients without Parkinson’s disease (control group). | |||
| GSE136666 | Transcriptomic profiling of substantia nigra and putamen in Parkinson’s disease | 5 | Illumina HiSeq 2000 | Human tissue samples. Substantia nigra from patients without Parkinson’s disease. |
| 5 | Human tissue samples. Substantia nigra from patients without Parkinson’s disease (control group). |
| Dataset ID | Title | n * | Sequence Platform | Samples Characteristics |
|---|---|---|---|---|
| GSE86076 | High motivation for exercise is associated with altered chromatin regulators of monoamine receptor gene expression in the striatum of selectively bred mice | 31 | Illumina HiSeq 2000 | 15 striatal samples from randomly bred control lines and 16 samples from the lines selected for high voluntary wheel running (both male and female). |
| GSE133115 | Chronic, Chemogenetic Stimulation of The Nucleus Accumbens Produces Lasting Effects on Binge Drinking and Ameliorates Alcohol-Related Transcriptional and Morphological Changes | 11 | Illumina HiSeq 2500 | Nucleus accumbens from HDID-1 mice (both male and female) |
| GSE149900 | Transcriptional profiling of striatum from 6-month-old mice heterozygous knockout for 52 genes and corresponding wildtype control mice | 41 | Illumina HiSeq 4000 | Striatal samples from 6-month-old C57BL/6 mice (both male and female). |
| GSE156236 | Transcriptional profiling of striatum and cortex from a LacO-Q140 inducible mouse model of Huntington’s disease with early and late mutant HTT lowering | 10 | Illumina NovaSeq 6000 | Striatal samples from 6-month-old C57BL/6 mice (both male and female). |
| Gene Symbol | Gene Name | F Primer | R Primer |
|---|---|---|---|
| Ddc | dopa decarboxylase | TGGCGTGGAGTTTGCAGATTCC | GTCCTGGTGACTGTGCCTCAGA |
| Drd2 | dopamine receptor D2 | CTTGAAGAGCCGTGCCACCC | TGTCTGCCTTCCCTTCTGACCC |
| Vmat2 | solute carrier family 18 member A2 | TGGGAAGGTGGCTATGTGCTCT | AGGAGTCCACCATCCCAATTGCA |
| Th | tyrosine hydroxylase | CGCTTCTTGAAGGAGCGGACTG | GCATGGCGGATATACTGGGTGC |
| Pkg1 | protein kinase cGMP-dependent 1 | CTGCACACAGAGCCCACAGTTC | AAGCCATTCCCCCACCGATGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vaganova, A.N.; Fesenko, Z.S.; Volnova, A.B.; Gainetdinov, R.R. Stable Dopamine-Signaling mRNA Co-Expression in the Substantia Nigra Is Deregulated in Pathological Conditions, but Not in Dopamine Transporter Knockout Rats. Biomolecules 2025, 15, 1117. https://doi.org/10.3390/biom15081117
Vaganova AN, Fesenko ZS, Volnova AB, Gainetdinov RR. Stable Dopamine-Signaling mRNA Co-Expression in the Substantia Nigra Is Deregulated in Pathological Conditions, but Not in Dopamine Transporter Knockout Rats. Biomolecules. 2025; 15(8):1117. https://doi.org/10.3390/biom15081117
Chicago/Turabian StyleVaganova, Anastasia N., Zoia S. Fesenko, Anna B. Volnova, and Raul R. Gainetdinov. 2025. "Stable Dopamine-Signaling mRNA Co-Expression in the Substantia Nigra Is Deregulated in Pathological Conditions, but Not in Dopamine Transporter Knockout Rats" Biomolecules 15, no. 8: 1117. https://doi.org/10.3390/biom15081117
APA StyleVaganova, A. N., Fesenko, Z. S., Volnova, A. B., & Gainetdinov, R. R. (2025). Stable Dopamine-Signaling mRNA Co-Expression in the Substantia Nigra Is Deregulated in Pathological Conditions, but Not in Dopamine Transporter Knockout Rats. Biomolecules, 15(8), 1117. https://doi.org/10.3390/biom15081117

