Functional Analysis of DNMT3A DNA Methyltransferase Mutations Reported in Patients with Acute Myeloid Leukemia
Abstract
1. Introduction
The Preliminary Results
2. Materials and Methods
2.1. Chemicals, Oligonucleotides, and Enzymes
2.2. Site-Directed Mutagenesis
2.3. Protein Expression and Purification
2.4. CD Spectroscopy
2.5. Methylation Assay
2.6. Formation of Covalent Intermediates between Dnmt3a and DNA Duplexes Containing 2-Pyrimidinone
2.7. DNA Binding
2.8. Western Blotting
2.9. Computational Modeling
2.10. Database Analysis
3. Results
3.1. Dnmt3a-CD Purification
3.2. Effect of Cancer-Associated Mutations of Dnmt3a-CD on DNA Methylation
3.3. DNA Binding
3.4. Formation of Covalent Intermediates between Dnmt3a-CD and DNA Duplexes Containing 2-Pyrimidinone
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
References
- Bird, A. DNA methylation patterns and epigenetic memory. Genes Dev. 2002, 16, 6–21. [Google Scholar] [CrossRef]
- Deaton, A.M.; Bird, A. CpG islands and the regulation of transcription. Genes Dev. 2011, 25, 1010–1022. [Google Scholar] [CrossRef] [PubMed]
- Jurkowska, R.Z.; Jurkowski, T.P.; Jeltsch, A. Structure and function of mammalian DNA methyltransferases. Chembiochem 2011, 12, 206–222. [Google Scholar] [CrossRef] [PubMed]
- Hamidi, T.; Singh, A.K.; Chen, T. Genetic alterations of DNA methylation machinery in human diseases. Epigenomics 2015, 7, 247–265. [Google Scholar] [CrossRef] [PubMed]
- Robertson, K.D. DNA methylation and human disease. Nat. Rev. Genet. 2005, 6, 597–610. [Google Scholar] [CrossRef] [PubMed]
- Jin, B.; Robertson, K.D. DNA methyltransferases, DNA damage repair and cancer. Adv. Exp. Med. Biol. 2013, 754, 3–29. [Google Scholar] [PubMed]
- Zhang, W.; Xu, J. DNA methyltransferases and their roles in tumorigenesis. Biomark. Res. 2017, 5, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Tatton-Brown, K.; Seal, S.; Ruark, E.; Harmer, J.; Ramsay, E.; Del Vecchio Duarte, S.; Zachariou, A.; Hanks, S.; O’Brien, E.; Aksglaede, L.; et al. Mutations in the DNA methyltransferase gene, DNMT3a, cause an overgrowth syndrome with intellectual disability. Nat. Genet. 2014, 46, 385–388. [Google Scholar] [CrossRef]
- Tatton-Brown, K.; Loveday, C.; Yost, S.; Clarke, M.; Ramsay, E.; Zachariou, A.; Elliott, A.; Wylie, H.; Ardissone, A.; Rittinger, O.; et al. Mutations in Epigenetic Regulation Genes Are a Major Cause of Overgrowth with Intellectual Disability. Am. J. Hum. Genet. 2017, 100, 725–736. [Google Scholar] [CrossRef]
- O’Brien, E.C.; Brewin, J.; Chevassut, T. DNMT3A: The DioNysian MonsTer of acute myeloid leukemia. Ther. Adv. Hematol. 2014, 5, 187–196. [Google Scholar] [CrossRef]
- Heuser, M.; Yun, H.; Thol, F. Epigenetics in myelodysplastic syndromes. Semin. Cancer Biol. 2017, 51, 170–179. [Google Scholar] [CrossRef] [PubMed]
- Ley, T.J.; Ding, L.; Walter, M.J.; McLellan, M.D.; Lamprecht, T.; Larson, D.E.; Kandoth, C.; Payton, J.E.; Baty, J.; Welch, J.; et al. DNMT3A mutations in acute myeloid leukemia. N. Engl. J. Med. 2010, 363, 2424–2433. [Google Scholar] [CrossRef] [PubMed]
- Medinger, M.; Passweg, J.R. Acute myeloid leukemia genomics. Br. J. Haematol. 2017, 179, 530–542. [Google Scholar] [CrossRef] [PubMed]
- Brunetti, L.; Gundry, M.C.; Goodell, M.A. DNMT3A and Leukemia. Cold Spring Harb. Perspect. Med. 2017, 7, a030320. [Google Scholar] [CrossRef] [PubMed]
- The Cancer Genome Atlas. Available online: https://portal.gdc.cancer.gov/ (accessed on 31 October 2019).
- CBioPortal for Cancer Genomics. Available online: https://www.cbioportal.org/ (accessed on 31 October 2019).
- Spencer, D.H.; Russler-Germain, D.A.; Ketkar, S.; Helton, N.M.; Lamprecht, T.L.; Fulton, R.S.; Fronick, C.C.; O’Laughlin, M.; Heath, S.E.; Shinawi, M.; et al. CpG Island Hypermethylation Mediated by DNMT3A Is a Consequence of AML Progression. Cell 2017, 168, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Russler-Germain, D.A.; Spencer, D.H.; Young, M.A.; Lamprecht, T.L.; Miller, C.A.; Fulton, R.; Meyer, M.R.; Erdmann-Gilmore, P.; Townsend, R.R.; Wilson, R.K.; et al. The R882H DNMT3A Mutation Associated with AML Dominantly Inhibits Wild-Type DNMT3A by Blocking Its Ability to Form Active Tetramers. Cancer Cell 2014, 25, 442–454. [Google Scholar] [CrossRef]
- Fried, I.; Bodner, C.; Pichler, M.M.; Lind, K.; Beham-Schmid, C.; Quenhenberger, F.; Sperr, W.R.; Linkesch, W.; Sill, H.; Wolfer, A. Frequency, onset and clinical impact of somatic DNMT3A mutations in therapy-related and secondary acute myeloid leukemia. Haemotologica 2012, 97, 246–250. [Google Scholar] [CrossRef][Green Version]
- Hou, H.A.; Kuo, Y.Y.; Liu, C.Y.; Chou, W.C.; Lee, M.C.; Chen, C.Y.; Lin, L.I.; Tseng, M.H.; Huang, C.F.; Chiang, Y.C.; et al. DNMT3A mutations in acute myeloid leukemia: Stability during disease evolution and clinical implications. Blood 2012, 119, 559–568. [Google Scholar] [CrossRef]
- Park, S.H.; Choi, J.C.; Kim, S.Y.; Yi, J.; Oh, S.H.; Kim, I.S.; Kim, H.H.; Chang, C.L.; Lee, E.Y.; Song, M.K.; et al. Incidence and Prognostic Impact of DNMT3A Mutations in Korean Normal Karyotype Acute Myeloid Leukemia Patients, BioMed Research International. BioMed Res. Int. 2015, 2015, 723682. [Google Scholar]
- Gale, R.E.; Lamb, K.; Allen, C.; El-Sharkawi, D.; Stowe, C.; Jenkinson, S.; Tinsley, S.; Dickson, G.; Burnett, A.K.; Hills, R.K.; et al. Simpson’s Paradox and the Impact of Different DNMT3A Mutations on Outcome in Younger Adults With Acute Myeloid Leukemia. J. Clin. Oncol. 2015, 33, 2072–2083. [Google Scholar] [CrossRef]
- Yang, L.; Rau, R.; Goodell, M.A. DNMT3A in haematological malignancies. Nat. Rev. Cancer 2015, 15, 152–165. [Google Scholar] [CrossRef] [PubMed]
- Mechaal, A.; Safra, I.; Hind, B.N.; Ichraf, R.; Samia, M.; Chaker, F.; Balkis, M.; Salem, A. DNMT3A Mutations in Tunisian Patients with Acute Myeloid Leukemia. J. Blood Disord. 2015, 2, 1032. [Google Scholar]
- Gowher, H.; Loutchanwoot, P.; Vorobjeva, O.; Handa, V.; Jurkowska, R.Z.; Jurkowski, T.P.; Jeltsch, A. Mutational analysis of the catalytic domain of the murine Dnmt3a DNA-(cytosine C5)- methyltransferase. J. Mol. Biol. 2006, 357, 928–941. [Google Scholar] [CrossRef] [PubMed]
- Walter, M.J.; Ding, L.; Shen, D.; Shao, J.; Grillot, M.; McLellan, M.; Fulton, R.; Schmidt, H.; Schmidt, H.; Kalicki-Veizer, J.; et al. Recurrent DNMT3A mutations in patients with myelodysplastic syndromes. Leukemia 2011, 25, 1153–1158. [Google Scholar] [CrossRef] [PubMed]
- Sehgal, A.R.; Gimotty, P.A.; Zhao, J.; Hsu, J.M.; Daber, R.; Morrissette, J.D.; Luger, S.; Loren, A.W.; Carroll, M. DNMT3A mutational status affects the results of dose-escalated induction therapy in acute myelogenous leukemia. Clin. Cancer Res. 2015, 21, 1614–1620. [Google Scholar] [CrossRef]
- Holz-Schietinger, C.; Doug, M.; Matje, S.; Reich, O.N. Mutations in DNA Methyltransferase (DNMT3A) Observed in Acute Myeloid Leukemia Patients Disrupt Processive Methylation. J. Bio. Chem. 2012, 287, 30941–30951. [Google Scholar] [CrossRef]
- Sandoval, E.J.; Huang, Y.-H.; Muise, A.; Goodell, A.M.; Reich, O.N. Mutations in the DNMT3A DNA methyltransferase in AML patients cause both loss and gain of function and differential regulation by protein partners. J. Biol. Chem. 2019, 294, 4898–4910. [Google Scholar] [CrossRef]
- Zhang, Z.M.; Lu, R.; Wang, P.; Yu, Y.; Gao, L.; Liu, S.; Ji, D.; Rothbart, S.B.; Wang, Y.; Wang, G.G.; et al. Structural basis for DNMT3A-mediated de novo DNA methylation. Nature 2018, 554, 387–391. [Google Scholar] [CrossRef]
- Lukashevich, O.V.; Baskunov, V.B.; Darii, M.V.; Kolbanovskiy, A.; Baykov, A.A.; Gromova, E.S. Dnmt3a-CD is less susceptible to bulky benzo[a]pyrene diolepoxidederived DNA lesions than prokaryotic DNA methyltransferases. Biochemistry 2011, 50, 875–881. [Google Scholar] [CrossRef]
- Sergeev, A.V.; Kirsanova, O.V.; Loiko, A.G.; Nomerotskaya, E.I.; Gromova, E.S. Detection of DNA methylation by Dnmt3a methyltransferase using methyl-dependent restriction endonucleases. Mol. Biol. 2018, 52, 272–278. [Google Scholar] [CrossRef]
- Posfai, J.; Bhagwat, A.S.; Posfai, G.; Roberts, R.J. Predictive motifs derived from cytosine methyltransferases. Nucleic Acids Res. 1989, 17, 2421–2435. [Google Scholar] [CrossRef] [PubMed]
- Emperle, M.; Dukatz, M.; Kunert, S.; Holzer, K.; Rajavelu, A.; Jurkowska, R.Z.; Jeltsch, A. The DNMT3A R882H mutation does not cause dominant negative effects in purified mixed DNMT3A/R882H complexes. Sci. Rep. 2018, 8, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Jeltsch, A. Molecular enzymology of mammalian DNA methyltransferases. Curr. Top. Microbiol. Immunol. 2006, 301, 203–225. [Google Scholar] [PubMed]
- Wyszynski, M.W.; Gabbara, S.; Kubareva, E.A.; Romanova, E.A.; Oretskaya, T.S.; Gromova, E.S.; Shabarova, Z.A.; Bhagwat, A.S. The cysteine conserved among DNA cytosine methylases is required for methyl transfer, but not for specific DNA binding. Nucleic Acids Res. 1993, 21, 295–301. [Google Scholar] [CrossRef]
- Maltseva, D.V.; Baykov, A.A.; Jeltsch, A.; Gromova, E.S. Impact of 7,8-Dihydro-8-oxoguanine on Methylation of the CpG site by Dnmt3a. Biochem. 2009, 48, 1361–1368. [Google Scholar] [CrossRef]
- Zhou, L.; Cheng, X.; Connolly, B.A.; Dickman, M.J.; Hurd, P.J.; Hornby, D.P. Zebularine: A novel DNA methylation inhibitor that forms a covalent complex with DNA methyltransferases. J. Mol. Biol. 2002, 321, 591–599. [Google Scholar] [CrossRef]
- Gerasimate, R.; Merkiene, E.; Klimasauskas, S. Direct observation of cytosine flipping and covalent catalysis in a DNA methyltransferase. Nucleic Acids Res. 2011, 39, 3771–3780. [Google Scholar] [CrossRef]
- Norvil, B.A.; Saha, D.; Dar, S.M.; Gowher, H. Effect of Disease-Associated Germline Mutations on Structure Function Relationship of DNA Methyltransferases. Genes 2019, 10, 369. [Google Scholar] [CrossRef]
Amino Acid Number in Dnmt3a-CD | Amino Acid Number in Full-Length Human DNMT3A | The Number of Patients | The Number of COSMIC References | Allele Frequency |
---|---|---|---|---|
R45 | R635W/Q | 5 | 4 | 0.24 |
V46 | V636M | 2 | 2 | - |
S124 | S714C | 6 | 12 | 0.29 |
P128 | P718L | 1 | 1 | - |
R139 | R729W/Q | 3 | 5 | 0.11 |
Y145 | Y735C | 2 | 6 | - |
R146 | R736H/C/A/P | 10 | 10 | 0.49 |
F162 | F752V | 2 | 2 | - |
R181 | R771Q/L | 3 | 3 | 0.42 |
P187 | P777R | 2 | 1 | - |
B191 | D781G | 1 | 1 | 0.1 |
R202 | R792H/C | 2 | 2 | 0.41 |
K213 | R803S | 1 | 1 | - |
K251 | K841Q | 1 | 1 | - |
R292 | R882H/C/P | 173 | 619 | 0.28 |
A319 | F909C | 1 | 1 | 0.17 |
Designation | Sequence * |
---|---|
fCG/GCf | 5′- FAM - CTGAATACTACTTGCGCTCTCTAACCTGAT 3′- GACTTATGATGAACGCGAGAGATTGGACTA - FAM |
fCG/CG | 5′- FAM - CTGAATACTACTTGCGCTCTCTAACCTGAT 3′- GACTTATGATGAACGCGAGAGATTGGACTA |
fCG/GZ | 5′- FAM - GAGCCAAGCGCACTCTGA 3′- CTCGGTTCGZGTGAGACT |
fCG/GC | 5′- FAM - GAGCCAAGCGCACTCTGA 3′ - CTCGGTTCGCGTGAGACT |
CGZ/GCf | 5′ - GAGCCAAGCGZACTCTGA 3′ - CTCGGTTCGCGTGAGACT - FAM |
Exchange | v0, nM/min ** | v0rel, % | Kd, nM | Kdrel | Ability of Dnmt3L to Enhance Dnmt3a Functionality | Covalent Complex Formation with fCG/GZ |
---|---|---|---|---|---|---|
WT | 15.7 ± 1 | 100 | 77 ± 6 | 1.00 | Yes | Yes |
S124C | 6.2 ± 4 | 39 | 127 ± 44 | 1.63 | Yes | Yes |
R146H | No activity | No activity | No binding | No binding | No | n.d.* |
R45W | ||||||
F162V | 232 ± 32 | 3.01 | No | No | ||
P187R | 1.1 ± 1 | 7 | n.d. * | n.d. * | No | No |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khrabrova, D.A.; Loiko, A.G.; Tolkacheva, A.A.; Cherepanova, N.A.; Zvereva, M.I.; Kirsanova, O.V.; Gromova, E.S. Functional Analysis of DNMT3A DNA Methyltransferase Mutations Reported in Patients with Acute Myeloid Leukemia. Biomolecules 2020, 10, 8. https://doi.org/10.3390/biom10010008
Khrabrova DA, Loiko AG, Tolkacheva AA, Cherepanova NA, Zvereva MI, Kirsanova OV, Gromova ES. Functional Analysis of DNMT3A DNA Methyltransferase Mutations Reported in Patients with Acute Myeloid Leukemia. Biomolecules. 2020; 10(1):8. https://doi.org/10.3390/biom10010008
Chicago/Turabian StyleKhrabrova, Daria A., Andrei G. Loiko, Anastasia A. Tolkacheva, Natalia A. Cherepanova, Maria I. Zvereva, Olga V. Kirsanova, and Elizaveta S. Gromova. 2020. "Functional Analysis of DNMT3A DNA Methyltransferase Mutations Reported in Patients with Acute Myeloid Leukemia" Biomolecules 10, no. 1: 8. https://doi.org/10.3390/biom10010008
APA StyleKhrabrova, D. A., Loiko, A. G., Tolkacheva, A. A., Cherepanova, N. A., Zvereva, M. I., Kirsanova, O. V., & Gromova, E. S. (2020). Functional Analysis of DNMT3A DNA Methyltransferase Mutations Reported in Patients with Acute Myeloid Leukemia. Biomolecules, 10(1), 8. https://doi.org/10.3390/biom10010008