Galectin Domain Containing Protein from Haemonchus contortus Modulates the Immune Functions of Goat PBMCs and Regulates CD4+ T-Helper Cells In Vitro
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Animals and Parasites
2.3. Cloning and Sequence Analysis of Hc-GDC
2.4. Purification of Recombinant Hc-GDC
2.5. Generation of Polyclonal Antibodies
2.6. Western Blot Assay
2.7. Localization of rHc-GDC in Adult H. contortus Worms
2.8. Separation of PBMCs
2.9. PBMC Binding Assay
2.10. Cell Proliferation Assay
2.11. Cell Apoptosis Assay
2.12. Cell Migration Assay
2.13. Nitric Oxide Production Assay
2.14. Determination of Cytokine Expression
2.15. Intracellular Cytokine Staining and Flow Cytometry
2.16. Statistical Analysis
3. Results
3.1. Molecular Cloning, Expression, and Purification of Hc-GDC
3.2. Western Blot Assay of rHc-GDC
3.3. Binding of rHc-GDC to Goat PBMCs
3.4. Localization of rHc-GDC on surface of Adult H. contortus Worm
3.5. Effect of rHc-GDC on PBMC Proliferation
3.6. Effect of rHc-GDC on PBMC Viability and Apoptosis
3.7. PBMC Migration Assay
3.8. Nitric Oxide Production Assay
3.9. Protein rHc-GDC Modulated Cytokine Secretion by PBMCs
3.10. Effect of rHc-GDC on Th1, Th2, and Th9 Cell Differentiation
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
| Gene Name | Forward 5 → 3 | Reverse 5 → 3 | Amplification Size (bp) | Amplification Efficiency (%) |
|---|---|---|---|---|
| Beta-Actin | CACCACACCTTCTACAAC | TCTGGGTCATCTTCTCAC | 106 | 95.41 |
| IFN-γ | GAACGGCAGCTCTGAGAAAC | GGTTAGATTTTGGCGACAGG | 131 | 98.02 |
| IL-4 | GTACCAGCCACTTCGTCCAT | GCTGCTGAGATTCCTGTCAA | 148 | 97.11 |
| IL-9 | GATGCGGCTGATTGTTT | CTCGTGCTCACTGTGGAGT | 103 | 98.68 |
References
- Kasai, K.I.; Hirabayashi, J. Galectins: A family of animal lectins that decipher glycocodes. J. Biochem. 1996, 119, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Yuan, C.; Zhang, H.; Wang, W.; Li, Y.; Yan, R.; Xu, L.; Song, X.; Li, X. Transmembrane protein 63A is a partner protein of Haemonchus contortus galectin in the regulation of goat peripheral blood mononuclear cells. Parasites Vectors 2015, 8, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perone, M.J.; Larregina, A.T.; Shufesky, W.J.; Papworth, G.D.; Sullivan, M.L.G.; Zahorchak, A.F.; Stolz, D.B.; Baum, L.G.; Watkins, S.C.; Thomson, A.W.; et al. Transgenic Galectin-1 Induces Maturation of Dendritic Cells That Elicit Contrasting Responses in Naive and Activated T Cells. J. Immunol. 2006, 176, 7207–7220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stowell, S.R.; Qian, Y.; Karmakar, S.; Koyama, N.S.; Dias-Baruffi, M.; Leffler, H.; McEver, R.P.; Cummings, R.D. Differential Roles of Galectin-1 and Galectin-3 in Regulating Leukocyte Viability and Cytokine Secretion. J. Immunol. 2008, 180, 3091–3102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vasta, G.R. Roles of galectins in infection. Nat. Rev. Microbiol. 2009, 7, 424–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rabinovich, G.A.; Gruppi, A. Galectins as immunoregulators during infectious processes: From microbial invasion to the resolution of the disease. Parasite Immunol. 2005, 27, 103–114. [Google Scholar] [CrossRef] [Scilit]
- Young, A.R.; Meeusen, E.N. Galectins in parasite infection and allergic inflammation. Glycoconj. J. 2002, 19, 601–606. [Google Scholar] [CrossRef] [Scilit]
- Yang, R.Y.; Rabinovich, G.A.; Liu, F.T. Galectins: Structure, function and therapeutic potential. Expert Rev. Mol. Med. 2008, 10, 1–24. [Google Scholar] [CrossRef] [Scilit]
- Kuwabara, T.; Ishikawa, F.; Kondo, M.; Kakiuchi, T. The Role of IL-17 and Related Cytokines in Inflammatory Autoimmune Diseases. Mediators Inflamm. 2017, 2017, 3908061. [Google Scholar] [CrossRef] [Scilit]
- Sato, S.; Nieminen, J. Seeing strangers or announcing “danger”: Galectin-3 in two models of innate immunity. Glycoconj. J. 2002, 19, 583–591. [Google Scholar] [CrossRef] [Scilit]
- Klion, A.D.; Donelson, J.E. OvGalBP, a filarial antigen with homology to vertebrate galactoside-binding proteins. Mol. Biochem. Parasitol. 1994, 65, 305–315. [Google Scholar] [CrossRef] [Scilit]
- Greenhalgh, C.J.; Loukas, A.; Newton, S.E. The organization of a galectin gene from Teladorsagia circumcincta. Mol. Biochem. Parasitol. 1999, 101, 199–206. [Google Scholar] [CrossRef] [Scilit]
- Newlands, G.F.J.; Skuce, P.J.; Knox, D.P.; Smith, S.K.; Smith, W.D. Cloning and characterization of a β-galactoside-binding protein (galectin) from the gut of the gastrointestinal nematode parasite Haemonchus contortus. Parasitology 1999, 119, 483–490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaplan, M.H. Davies Th9 cells: Differentiation and disease. Bone 2013, 252, 104–115. [Google Scholar]
- Clark, R.A.; Schlapbach, C. TH9 cells in skin disorders. Semin. Immunopathol. 2017, 39, 47–54. [Google Scholar] [CrossRef] [Scilit]
- Elyaman, W.; Khoury, S.J. Th9 cells in the pathogenesis of EAE and multiple sclerosis. Semin. Immunopathol. 2017, 39, 79–87. [Google Scholar] [CrossRef] [Scilit]
- Licona-Limón, P.; Arias-Rojas, A.; Olguín-Martínez, E. IL-9 and Th9 in parasite immunity. Semin. Immunopathol. 2017, 39, 29–38. [Google Scholar] [CrossRef] [Scilit]
- Rivera Vargas, T.; Humblin, E.; Végran, F.; Ghiringhelli, F.; Apetoh, L. TH9 cells in anti-tumor immunity. Semin. Immunopathol. 2017, 39, 39–46. [Google Scholar] [CrossRef] [Scilit]
- Sun, B. Advances in Experimental Medicine and Biology, 841st ed.; Springer: Basel, Switzerland, 2014; ISBN 9789401794862. [Google Scholar]
- Pan, H.F.; Leng, R.X.; Li, X.P.; Zheng, S.G.; Ye, D.Q. Targeting T-helper 9 cells and interleukin-9 in autoimmune diseases. Cytokine Growth Factor Rev. 2013, 24, 515–522. [Google Scholar] [CrossRef] [Scilit]
- Richard, M.; Grencis, R.K.; Humphreys, N.E.; Renauld, J.C.; Van Snick, J. Anti-IL-9 vaccination prevents worm expulsion and blood eosinophilia in Trichuris muris-infected mice. Proc. Natl. Acad. Sci. USA 2000, 97, 767–772. [Google Scholar] [CrossRef] [Scilit]
- Tian, X.; Lu, M.; Wang, W.; Jia, C.; Muhammad, E.; Yan, R.; Xu, L.; Song, X.; Li, X. HcTTR: A novel antagonist against goat interleukin 4 derived from the excretory and secretory products of Haemonchus contortus. Vet. Res. 2019, 50, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gessner, A.; Blum, H.; Röllinghoff, M. Differential Regulation of IL-9-Expression after Infection with Leishmania major in Susceptible and Resistant Mice. Immunobiology 1993, 189, 419–435. [Google Scholar] [CrossRef] [Scilit]
- Faulkner, H.; Renauld, J.C.; Van Snick, J.; Grencis, R.K. Interleukin-9 enhances resistance to the intestinal nematode Trichuds muris. Infect. Immun. 1998, 66, 3832–3840. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fallon, P.G.; Smith, P.; Richardson, E.J.; Jones, F.J.; Faulkner, H.C.; Van Snick, J.; Renauld, J.C.; Grencis, R.K.; Dunne, D.W. Expression of interleukin-9 leads to Th2 cytokine-dominated responses and fatal enteropathy in mice with chronic Schistosoma mansoni infections. Infect. Immun. 2000, 68, 6005–6011. [Google Scholar] [CrossRef] [Scilit]
- Gadahi, J.A.; Wang, S.; Bo, G.; Ehsan, M.; Yan, R.; Song, X. Proteomic Analysis of the Excretory and Secretory Proteins of Haemonchus contortus (HcESP) Binding to Goat PBMCs In Vivo Revealed Stage-Specific Binding Profiles. PLoS ONE 2016, 11, e0159796. [Google Scholar] [CrossRef] [Scilit]
- Dey, A.R.; Zhang, Z.; Begum, N.; Alim, M.A.; Hu, M.; Alam, M.Z. Genetic diversity patterns of Haemonchus contortus isolated from sheep and goats in Bangladesh. Infect. Genet. Evol. 2019, 68, 177–184. [Google Scholar] [CrossRef] [Scilit]
- Sorobetea, D.; Svensson-Frej, M.; Grencis, R. Immunity to gastrointestinal nematode infections. Mucosal Immunol. 2018, 11, 304–315. [Google Scholar] [CrossRef] [Scilit]
- Prussin, C.; Metcalfe, D.D. Detection of intracytoplasmic cytokine using flow cytometry and directly conjugated anti-cytokine antibodies. J. Immunol. Methods 1995, 188, 117–128. [Google Scholar] [CrossRef] [Scilit]
- Gadahi, J.A.; Li, B.; Ehsan, M.; Wang, S.; Zhang, Z.; Wang, Y.; Hasan, M.W.; Yan, R.; Song, X.; Xu, L.; et al. Recombinant Haemonchus contortus 24 kDa excretory/secretory protein (rHcES-24) modulate the immune functions of goat PBMCs in vitro. Oncotarget 2016, 7, 83926–83937. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.C.; Huang, J.W.; Li, M.H.; Sui, Y.X.; Wang, S.; Liu, L.R.; Xu, L.X.; Yan, R.F.; Song, X.K.; Li, X.R. Identification and molecular characterization of microneme 5 of Eimeria acervulina. PLoS ONE 2014, 9, 1–19. [Google Scholar] [CrossRef] [Scilit]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteian-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Flecknell, P.; Lofgren, J.L.S.; Dyson, M.C.; Marini, R.R.; Michael Swindle, M.; Wilson, R.P. Preanesthesia, Anesthesia, Analgesia, and Euthanasia. In Laboratory Animal Medicine; Academic Press: Cambridge, MA, USA, 2015; ISBN 9780124095274. [Google Scholar]
- El-Hassan, E.M.; El-Bahr, S.M. Antigenic and immunogenic components of Haemonchus longistipes identified by western Immunobloting. Am. J. Biochem. Biotechnol. 2013, 8, 164–170. [Google Scholar]
- Naqvi, M.A.U.H.; Jamil, T.; Naqvi, S.Z.; Memon, M.A.; Aimulajiang, K.; Aleem, M.T.; Ehsan, M.; Xu, L.; Song, X.; Li, X.; et al. Immunodiagnostic potential of recombinant tropomyosin during prepatent Haemonchus contortus infection in goat. Res. Vet. Sci. 2020, 128, 197–204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naqvi, M.A.; Naqvi, S.Z.; Memon, M.A.; Aimulajiang, K.; Haseeb, M.; Xu, L.; Song, X.; Li, X.; Ruofeng, Y. Combined Use of Indirect ELISA and Western Blotting with Recombinant Hepatocellular Carcinoma-Associated Antigen 59 Is a Potential Immunodiagnostic Tool for the Detection of Prepatent Haemonchus contortus Infection in Goat. Animals 2019, 9, 548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adefegha, S.A.; Leal, D.B.R.; Doleski, P.H.; Ledur, P.C.; Ecker, A. Peripheral blood mononuclear cells from rat model of pleurisy: The effects of hesperidin on ectoenzymes activity, apoptosis, cell cycle and reactive oxygen species production. Biomed. Pharmacother. 2017, 91, 278–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr. Protoc. Immunol. 1997, 21, 1–2. [Google Scholar]
- Ehsan, M.; Gao, W.X.; Gadahi, J.A.; Lu, M.M.; Liu, X.C.; Wang, Y.J.; Yan, R.F.; Xu, L.; Song, X.K.; Li, X.R. Arginine kinase from Haemonchus contortus decreased the proliferation and increased the apoptosis of goat PBMCs in vitro. Parasites Vectors 2017, 10, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Taylor, A.; Verhagen, J.; Blaser, K.; Akdis, M.; Akdis, C.A. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-β: The role of T regulatory cells. Immunology 2006, 117, 433–442. [Google Scholar] [CrossRef] [Scilit]
- Ye, Z.J.; Yuan, M.L.; Zhou, Q.; Du, R.H.; Yang, W.B.; Xiong, X.Z.; Zhang, J.C.; Wu, C.; Qin, S.M.; Shi, H.Z. Differentiation and recruitment of Th9 cells stimulated by pleural mesothelial cells in human mycobacterium tuberculosis infection. PLoS ONE 2012, 7, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Anuradha, R.; Munisankar, S.; Bhootra, Y.; Jagannathan, J.; Dolla, C.; Kumaran, P.; Nutman, T.B.; Babu, S. IL-10- and TGFβ-mediated Th9 Responses in a Human Helminth Infection. PLoS Negl. Trop. Dis. 2016, 10, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arthur, C.M.; Baruffi, M.D.; Cummings, R.D.; Stowell, S.R. Evolving Mechanistic Insights into Galectin Functions; Humana Press: New York, NY, USA, 2015; Volume 1207, ISBN 9781493913954. [Google Scholar]
- Ochieng, J.; Furtak, V.; Lukyanov, P. Extracellular functions of galectin-3. Glycoconj. J. 2002, 19, 527–535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elola, M.T.; Wolfenstein-Todel, C.; Troncoso, M.F.; Vasta, G.R.; Rabinovich, G.A. Galectins: Matricellular glycan-binding proteins linking cell adhesion, migration, and survival. Cell. Mol. Life Sci. 2007, 64, 1679–1700. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Yuan, C.; Wang, L.; Lu, M.; Wang, Y.; Wen, Y.; Yan, R.; Xu, L.; Song, X.; Li, X. Transmembrane protein 147 (TMEM147): Another partner protein of Haemonchus contortus galectin on the goat peripheral blood mononuclear cells (PBMC). Parasites Vectors 2016, 9, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Kuphal, S.; Bosserhoff, A. Recent progress in understanding the pathology. J. Pathol. 2009, 219, 400–409. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; Wang, S.; Zhang, H.; Yuan, C.; Yan, R.F.; Song, X.K.; Xu, L.X.; Li, X.R. Galectin Hco-gal-m from Haemonchus contortus modulates goat monocytes and T cell function in different patterns. Parasites Vectors 2014, 7, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Arata, Y.; Akimoto, Y.; Hirabayashi, J.; Kasai, K.I.; Hirano, H. An immunohistochemical study of the 32-kDa galectin (β-galactoside-binding lectin) in the nematode Caenorhabditis elegans. Histochem. J. 1996, 28, 201–207. [Google Scholar] [CrossRef] [Scilit]
- Wu, Z.; Nagano, I.; Takahashi, Y. Candidate genes responsible for common and different pathology of infected muscle tissues between Trichinella spiralis and T. pseudospiralis infection. Parasitol. Int. 2008, 57, 368–378. [Google Scholar] [CrossRef] [Scilit]
- Turner, D.G.; Wildblood, L.A.; Inglis, N.F.; Jones, D.G. Characterization of a galectin-like activity from the parasitic nematode, Haemonchus contortus, which modulates ovine eosinophil migration in vitro. Vet. Immunol. Immunopathol. 2008, 122, 138–145. [Google Scholar] [CrossRef] [Scilit]
- Espelt, M.V.; Croci, D.O.; Bacigalupo, M.L.; Carabias, P.; Manzi, M.; Elola, M.T.; Muñoz, M.C.; Dominici, F.P.; Wolfenstein-Todel, C.; Rabinovich, G.A.; et al. Novel roles of galectin-1 in hepatocellular carcinoma cell adhesion, polarization, and in vivo tumor growth. Hepatology 2011, 53, 2097–2106. [Google Scholar] [CrossRef] [Scilit]
- Kuroda, J.; Yamamoto, M.; Nagoshi, H.; Kobayashi, T.; Sasaki, N.; Shimura, Y.; Horiike, S.; Kimura, S.; Yamauchi, A.; Hirashima, M.; et al. Targeting activating transcription factor 3 by Galectin-9 induces apoptosis and overcomes various types of treatment resistance in chronic myelogenous leukemia. Mol. Cancer Res. 2010, 8, 994–1001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tribulatti, M.V.; Figini, M.G.; Carabelli, J.; Cattaneo, V.; Campetella, O. Redundant and Antagonistic Functions of Galectin-1, -3, and -8 in the Elicitation of T Cell Responses. J. Immunol. 2012, 188, 2991–2999. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loke, P.; MacDonald, A.S.; Robb, A.; Maizels, R.M.; Allen, J.E. Alternatively activated macrophages induced by nematode infection inhibit proliferation via cell-to-cell contact. Eur. J. Immunol. 2000, 30, 2669–2678. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; Yuan, C.; Wang, S.; Song, X.; Xu, L.; Yan, R.; Hasson, I.A.; Li, X. Transcriptional and proteomic analysis reveal recombinant galectins of Haemonchus contortus down-regulated functions of goat PBMC and modulation of several signaling cascades in vitro. J. Proteom. 2014, 98, 123–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.Q.; Wu, L.Y.; Hasan, M.W.; Lu, M.M.; Wang, W.J.; Yan, R.F.; Xu, L.X.; Song, X.K.; Li, X.R. Hepatocellular carcinoma-associated antigen 59 of Haemonchus contortus modulates the functions of PBMCs and the differentiation and maturation of monocyte-derived dendritic cells of goats in vitro. Parasites Vectors 2019, 12, 105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gadahi, J.A.; Ehsan, M.; Wang, S.; Zhang, Z.; Yan, R.; Song, X.; Xu, L.; Li, X. Recombinant protein of Haemonchus contortus small GTPase ADP-ribosylation factor 1 (HcARF1) modulate the cell mediated immune response in vitro. Oncotarget 2017, 8, 112211–112221. [Google Scholar] [CrossRef] [Scilit]
- James, S.L. Role of nitric oxide in parasitic infections. Microbiol. Rev. 1995, 59, 533–547. [Google Scholar] [CrossRef] [Scilit]
- Zhu, D.; Ding, R.; Li, L.J.; Zheng, Y.M.; Wang, H. Effects of T cell subsets with different proportions on renal function and blood lipids in patients with preeclampsia. J. Biol. Regul. Homeost. Agents 2019, 33, 73–80. [Google Scholar]
- Hu, Z.X.; Song, W.N.; Lu, X.D.; Zhou, M.L.; Shao, J.H. Peripheral T lymphocyte immunity and l-dopamine in patients with Parkinson’s disease. J. Biol. Regul. Homeost. Agents 2018, 32, 687–691. [Google Scholar]
- Ebrahimpour, S.; Shahbazi, M.; Khalili, A.; Tahoori, M.T.; Zavaran Hosseinp, A.; Amari, A.; Aghili, B.; Abediankenarp, S.; Mohammadizad, H.; Mohammadnia-Afrouzi, M. Elevated levels of IL-2 and IL-21 produced by CD4+ T cells in inflammatory bowel disease. J. Biol. Regul. Homeost. Agents 2017, 31, 279–287. [Google Scholar]
- Lu, L.F.; Lind, E.F.; Gondek, D.C.; Bennett, K.A.; Gleeson, M.W.; Pino-Lagos, K.; Scott, Z.A.; Coyle, A.J.; Reed, J.L.; Van Snick, J.; et al. Mast cells are essential intermediaries in regulatory T-cell tolerance. Nature 2006, 442, 997–1002. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koch, S.; Sopel, N.; Finotto, S. Th9 and other IL-9-producing cells in allergic asthma. Semin. Immunopathol. 2017, 39, 55–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ridolo, E.; Martignago, I.; Masieri, S. Mechanisms of allergic diseases in otorhinolaryngology. J. Biol. Regul. Homeost. Agents 2018, 32, 9–12. [Google Scholar]
- Veldhoen, M.; Uyttenhove, C.; van Snick, J.; Helmby, H.; Westendorf, A.; Buer, J.; Martin, B.; Wilhelm, C.; Stockinger, B. Transforming growth factor-β “reprograms” the differentiation of T helper 2 cells and promotes an interleukin 9-producing subset. Nat. Immunol. 2008, 9, 1341–1346. [Google Scholar] [CrossRef] [Scilit]
- Nowak, E.C.; Weaver, C.T.; Turner, H.; Begum-Haque, S.; Becher, B.; Schreiner, B.; Coyle, A.J.; Kasper, L.H.; Noelle, R.J. IL-9 as a mediator of Th17-driven inflammatory disease. J. Exp. Med. 2009, 206, 1653–1660. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimbara, A.; Christodoulopoulos, P.; Soussi-Gounni, A.; Olivenstein, R.; Nakamura, Y.; Levitt, R.C.; Nicolaides, N.C.; Holroyd, K.J.; Tsicopoulos, A.; Lafitte, J.J.; et al. IL-9 and its receptor in allergic and nonallergic lung disease: Increased expression in asthma. J. Allergy Clin. Immunol. 2000, 105, 108–115. [Google Scholar] [CrossRef] [Scilit]
- Steenwinckel, V.; Louahed, J.; Orabona, C.; Huaux, F.; Warnier, G.; McKenzie, A.; Lison, D.; Levitt, R.; Renauld, J.-C. IL-13 Mediates In Vivo IL-9 Activities on Lung Epithelial Cells but Not on Hematopoietic Cells. J. Immunol. 2007, 178, 3244–3251. [Google Scholar] [CrossRef] [Scilit]
- Whittaker, L.; Niu, N.; Temann, U.A.; Stoddard, A.; Flavell, R.A.; Ray, A.; Homer, R.J.; Cohn, L. Interleukin-13 mediates a fundamental pathway for airway epithelial mucus induced by CD4 T cells and interleukin-9. Am. J. Respir. Cell Mol. Biol. 2002, 27, 593–602. [Google Scholar] [CrossRef] [Scilit]
- Cheng, G.; Arima, M.; Honda, K.; Hirata, H.; Eda, F.; Yoshida, N.; Fukushima, F.; Ishii, Y.; Fukuda, T. Anti-interleukin-9 antibody treatment inhibits airway inflammation and hyperreactivity in mouse asthma model. Am. J. Respir. Crit. Care Med. 2002, 166, 409–416. [Google Scholar] [CrossRef] [Scilit]
- Osterfeld, H.; Ahrens, R.; Strait, R.; Finkelman, F.D.; Renauld, J.C.; Hogan, S.P. Differential roles for the IL-9/IL-9 receptor α-chain pathway in systemic and oral antigen-induced anaphylaxis. J. Allergy Clin. Immunol. 2010, 125, 469–476.e2. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Nourbakhsh, B.; Ciric, B.; Zhang, G.-X.; Rostami, A. Neutralization of IL-9 Ameliorates Experimental Autoimmune Encephalomyelitis by Decreasing the Effector T Cell Population. J. Immunol. 2010, 185, 4095–4100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elyaman, W.; Bradshaw, E.M.; Uyttenhove, C.; Dardalhon, V.; Awasthi, A.; Imitola, J.; Bettelli, E.; Oukka, M.; Van Snick, J.; Renauld, J.C.; et al. IL-9 induces differentiation of TH17 cells and enhances function of FoxP3+ natural regulatory T cells. Proc. Natl. Acad. Sci. USA 2009, 106, 12885–12890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beriou, G.; Bradshaw, E.M.; Lozano, E.; Costantino, C.M.; Hastings, W.D.; Orban, T.; Elyaman, W.; Khoury, S.J.; Kuchroo, V.K.; Baecher-Allan, C.; et al. TGF-β Induces IL-9 Production from Human Th17 Cells. J. Immunol. 2010, 185, 46–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, W.I.; Richard, M.; Akiho, H.; Blennerhasset, P.A.; Humphreys, N.E.; Grencis, R.K.; Van Snick, J.; Collins, S.M. Modulation of intestinal muscle contraction by interleukin-9 (IL-9) or IL-9 neutralization: Correlation with worm expulsion in murine nematode infections. Infect. Immun. 2003, 71, 2430–2438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Townsend, M.J.; Fallon, P.G.; Matthews, D.J.; Smith, P.; Jolin, H.E.; McKenzie, A.N.J. IL-9-deficient mice establish fundamental roles for IL-9 in pulmonary mastocytosis and goblet cell hyperplasia but not T cell development. Immunity 2000, 13, 573–583. [Google Scholar] [CrossRef] [Scilit]
- De Vries, V.C.; Wasiuk, A.; Bennett, K.A.; Benson, M.J.; Elgueta, R.; Waldschmidt, T.J.; Noelle, R.J. Mast cell degranulation breaks peripheral tolerance. Am. J. Transplant. 2009, 9, 2270–2280. [Google Scholar] [CrossRef] [Scilit] [PubMed]










© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Naqvi, M.A.-u.-H.; Memon, M.A.; Jamil, T.; Naqvi, S.Z.; Aimulajiang, K.; Gadahi, J.A.; Xu, L.; Song, X.; Li, X.; Yan, R. Galectin Domain Containing Protein from Haemonchus contortus Modulates the Immune Functions of Goat PBMCs and Regulates CD4+ T-Helper Cells In Vitro. Biomolecules 2020, 10, 116. https://doi.org/10.3390/biom10010116
Naqvi MA-u-H, Memon MA, Jamil T, Naqvi SZ, Aimulajiang K, Gadahi JA, Xu L, Song X, Li X, Yan R. Galectin Domain Containing Protein from Haemonchus contortus Modulates the Immune Functions of Goat PBMCs and Regulates CD4+ T-Helper Cells In Vitro. Biomolecules. 2020; 10(1):116. https://doi.org/10.3390/biom10010116
Chicago/Turabian StyleNaqvi, Muhammad Ali-ul-Husnain, Muhammad Ali Memon, Tahseen Jamil, Sana Zahra Naqvi, Kalibixiati Aimulajiang, Javaid Ali Gadahi, Lixin Xu, Xiaokai Song, Xiangrui Li, and Ruofeng Yan. 2020. "Galectin Domain Containing Protein from Haemonchus contortus Modulates the Immune Functions of Goat PBMCs and Regulates CD4+ T-Helper Cells In Vitro" Biomolecules 10, no. 1: 116. https://doi.org/10.3390/biom10010116
APA StyleNaqvi, M. A.-u.-H., Memon, M. A., Jamil, T., Naqvi, S. Z., Aimulajiang, K., Gadahi, J. A., Xu, L., Song, X., Li, X., & Yan, R. (2020). Galectin Domain Containing Protein from Haemonchus contortus Modulates the Immune Functions of Goat PBMCs and Regulates CD4+ T-Helper Cells In Vitro. Biomolecules, 10(1), 116. https://doi.org/10.3390/biom10010116

