Toll-like Receptor Activation Remodels the Polyamine and Tryptophan Metabolism in Porcine Macrophages
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Cell Culture
2.2. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.3. Enzyme Linked Immunosorbent Assay (ELISA)
2.4. Immunoblotting
2.5. Metabolomic Analysis
2.6. Statistical Analysis
3. Results
3.1. TLR Activation Remodeled the Polyamine Metabolism of Porcine Macrophages
3.2. TLR Activation Altered the Tryptophan Metabolism of Porcine Macrophages
3.3. The Expression of Key Genes Involved in the Tryptophan Metabolism Were Impacted by Stimulation Duration
3.4. TLR9 Activation Inhibited Melatonin Production Through the PKA/cAMP/CREB Signaling Cascades
4. Discussion
5. Limitations of This Study
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Han, X.; Hu, X.; Jin, W.; Liu, G. Dietary Nutrition, Intestinal Microbiota Dysbiosis and Post-Weaning Diarrhea in Piglets. Anim. Nutr. 2024, 17, 188–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, L.; Liu, B.; Han, Z.; Xia, Y.; Wu, M.; Liu, S. Melatonin Shapes Bacterial Clearance Function of Porcine Macrophages During Enterotoxigenic Escherichia Coli Infection. Anim. Nutr. 2022, 11, 242–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, J.; Han, Z.; Wu, Z.; Xia, Y.; Yang, G.; Yin, Y.; Ren, W. GABA Regulates IL-1beta Production in Macrophages. Cell Rep. 2022, 41, 111770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gamrekelashvili, J.; Kapanadze, T.; Sablotny, S.; Ratiu, C.; Dastagir, K.; Lochner, M.; Karbach, S.; Wenzel, P.; Sitnow, A.; Fleig, S.; et al. Notch and TLR Signaling Coordinate Monocyte Cell Fate and Inflammation. Elife 2020, 9, e57007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, L.; Xu, H.; Peng, G. TLR-Mediated Metabolic Reprogramming in the Tumor Microenvironment: Potential Novel Strategies for Cancer Immunotherapy. Cell. Mol. Immunol. 2018, 15, 428–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lauterbach, M.A.; Hanke, J.E.; Serefidou, M.; Mangan, M.S.J.; Kolbe, C.C.; Hess, T.; Rothe, M.; Kaiser, R.; Hoss, F.; Gehlen, J.; et al. Toll-like Receptor Signaling Rewires Macrophage Metabolism and Promotes Histone Acetylation via ATP-Citrate Lyase. Immunity 2019, 51, 997–1011.e7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hezaveh, K.; Shinde, R.S.; Klotgen, A.; Halaby, M.J.; Lamorte, S.; Ciudad, M.T.; Quevedo, R.; Neufeld, L.; Liu, Z.Q.; Jin, R.; et al. Tryptophan-Derived Microbial Metabolites Activate the Aryl Hydrocarbon Receptor in Tumor-Associated Macrophages to Suppress Anti-Tumor Immunity. Immunity 2022, 55, 324–340.e8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agus, A.; Planchais, J.; Sokol, H. Gut Microbiota Regulation of Tryptophan Metabolism in Health and Disease. Cell Host Microbe 2018, 23, 716–724. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, Y.; Zhang, Q.; Ye, Y.; Wu, X.; He, F.; Peng, Y.; Yin, Y.; Ren, W. Melatonergic Signalling Instructs Transcriptional Inhibition of IFNGR2 to Lessen Interleukin-1beta-Dependent Inflammation. Clin. Transl. Med. 2022, 12, e716. [Google Scholar] [CrossRef] [Scilit]
- Xia, Y.; Chen, S.; Zeng, S.; Zhao, Y.; Zhu, C.; Deng, B.; Zhu, G.; Yin, Y.; Wang, W.; Hardeland, R.; et al. Melatonin in Macrophage Biology: Current Understanding and Future Perspectives. J. Pineal Res. 2019, 66, e12547. [Google Scholar] [CrossRef] [Scilit]
- Pisani, D.F.; Lettieri-Barbato, D.; Ivanov, S. Polyamine Metabolism in Macrophage-Adipose Tissue Function and Homeostasis. Trends Endocrinol. Metab. 2024, 35, 937–950. [Google Scholar] [CrossRef] [Scilit]
- Nakamura, A.; Kurihara, S.; Takahashi, D.; Ohashi, W.; Nakamura, Y.; Kimura, S.; Onuki, M.; Kume, A.; Sasazawa, Y.; Furusawa, Y.; et al. Symbiotic Polyamine Metabolism Regulates Epithelial Proliferation and Macrophage Differentiation in the Colon. Nat. Commun. 2021, 12, 2105. [Google Scholar] [CrossRef] [Scilit]
- Mondanelli, G.; Bianchi, R.; Pallotta, M.T.; Orabona, C.; Albini, E.; Iacono, A.; Belladonna, M.L.; Vacca, C.; Fallarino, F.; Macchiarulo, A.; et al. A Relay Pathway between Arginine and Tryptophan Metabolism Confers Immunosuppressive Properties on Dendritic Cells. Immunity 2017, 46, 233–244. [Google Scholar] [CrossRef] [Scilit]
- Proietti, E.; Rossini, S.; Grohmann, U.; Mondanelli, G. Polyamines and Kynurenines at the Intersection of Immune Modulation. Trends Immunol. 2020, 41, 1037–1050. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, B.; Yu, D.; Sun, J.; Wu, X.; Xin, Z.; Deng, B.; Fan, L.; Fu, J.; Ge, L.; Ren, W. Characterizing the Influence of Gut Microbiota on Host Tryptophan Metabolism with Germ-Free Pigs. Anim. Nutr. 2022, 11, 190–200. [Google Scholar] [CrossRef] [Scilit]
- Ho, A.K.; Chik, C.L. Modulation of Aanat Gene Transcription in the Rat Pineal Gland. J. Neurochem. 2010, 112, 321–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, Y.; Jiang, H.; Wang, H.Q.; Guo, H.X.; Han, D.X.; Huang, Y.J.; Gao, Y.; Yuan, B.; Zhang, J.B. Identifying Daily Changes in circRNAs and circRNA-associated-ceRNA Networks in the Rat Pineal Gland. Int. J. Med. Sci. 2021, 18, 1225–1239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gay, N.J.; Gangloff, M.; Weber, A.N. Toll-like Receptors as Molecular Switches. Nat. Rev. Immunol. 2006, 6, 693–698. [Google Scholar] [CrossRef] [Scilit]
- Yoo, I.; Han, J.; Lee, S.; Jung, W.; Kim, J.H.; Kim, Y.W.; Kim, H.J.; Hong, M.; Ka, H. Analysis of Stage-Specific Expression of the Toll-like Receptor Family in the Porcine Endometrium Throughout the Estrous Cycle and Pregnancy. Theriogenology 2019, 125, 173–183. [Google Scholar] [CrossRef] [Scilit]
- Rodrigues, C.R.; Balachandran, Y.; Aulakh, G.K.; Singh, B. TLR10: An Intriguing Toll-Like Receptor with Many Unanswered Questions. J. Innate Immun. 2024, 16, 96–104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Z.; Yang, Q.; Zheng, M.; Lv, H.; Kang, K.; Zhang, Y. Classical Swine Fever Virus Non-Structural Proteins Modulate Toll-like Receptor Signaling Pathways in Porcine Monocyte-Derived Macrophages. Vet. Microbiol. 2019, 230, 101–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Casero, R.A., Jr.; Murray Stewart, T.; Pegg, A.E. Polyamine Metabolism and Cancer: Treatments, Challenges and Opportunities. Nat. Rev. Cancer 2018, 18, 681–695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Puleston, D.J.; Villa, M.; Pearce, E.L. Ancillary Activity: Beyond Core Metabolism in Immune Cells. Cell Metab. 2017, 26, 131–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, S.; Gu, J.; Liu, R.; Wei, S.; Wang, Q.; Shen, H.; Dai, Y.; Zhou, H.; Zhang, F.; Lu, L. Spermine Alleviates Acute Liver Injury by Inhibiting Liver-Resident Macrophage Pro-Inflammatory Response Through ATG5-Dependent Autophagy. Front. Immunol. 2018, 9, 948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, W.; Liu, J.; Zhao, X.; Yang, W. Melatonin-Induced Upregulation of Telomerase Activity Interferes with Macrophage Mitochondrial Metabolism and Suppresses NLRP3 Inflammasome Activation in the Treatment of Pneumonia. Heliyon 2024, 10, e29681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cordoba-Moreno, M.O.; Santos, G.C.; Muxel, S.M.; Dos Santos-Silva, D.; Quiles, C.L.; Sousa, K.D.S.; Markus, R.P.; Fernandes, P. IL-10-Induced STAT3/NF-kappaB Crosstalk Modulates Pineal and Extra-Pineal Melatonin Synthesis. J. Pineal Res. 2024, 76, e12923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Z.; Wang, K.; Guo, J.; Zhou, J.; Loor, J.J.; Yang, Z.; Yang, Y. Melatonin Maintains Homeostasis and Potentiates the Anti-Inflammatory Response in Staphylococcus Aureus-Induced Mastitis through microRNA-16b/YAP1. J. Agric. Food Chem. 2022, 70, 15255–15270. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Wang, G.; Ai, L.; Shi, J.; Zhang, J.; Chen, Y.X. Melatonin Suppresses TLR9-Triggered Proinflammatory Cytokine Production in Macrophages by Inhibiting ERK1/2 and AKT Activation. Sci. Rep. 2018, 8, 15579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawai, T.; Akira, S. The Role of Pattern-Recognition Receptors in Innate Immunity: Update on Toll-like Receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishii, M.; Hogaboam, C.M.; Joshi, A.; Ito, T.; Fong, D.J.; Kunkel, S.L. CC Chemokine Receptor 4 Modulates Toll-like Receptor 9-Mediated Innate Immunity and Signaling. Eur. J. Immunol. 2008, 38, 2290–2302. [Google Scholar] [CrossRef] [Scilit]
- Shao, X.; Yang, Y.; Liu, Y.; Wang, Y.; Zhao, Y.; Yu, X.; Liu, J.; Li, Y.X.; Wang, Y.L. Orchestrated Feedback Regulation between Melatonin and Sex Hormones Involving GPER1-PKA-CREB Signaling in the Placenta. J. Pineal Res. 2023, 75, e12913. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karapetyan, L.; Luke, J.J.; Davar, D. Toll-Like Receptor 9 Agonists in Cancer. Onco-Targets Ther. 2020, 13, 10039–10060. [Google Scholar] [CrossRef] [Scilit]
- Qiu, J.; Zhang, J.; Zhou, Y.; Li, X.; Li, H.; Liu, J.; Gou, K.; Zhao, J.; Cui, S. MicroRNA-7 Inhibits Melatonin Synthesis by Acting as a Linking Molecule Between Leptin and Norepinephrine Signaling Pathways in Pig Pineal Gland. J. Pineal Res. 2019, 66, e12552. [Google Scholar] [CrossRef] [Scilit]
- Clokie, S.J.; Lau, P.; Kim, H.H.; Coon, S.L.; Klein, D.C. MicroRNAs in the Pineal Gland: miR-483 Regulates Melatonin Synthesis by Targeting Arylalkylamine N-Acetyltransferase. J. Biol. Chem. 2012, 287, 25312–25324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.; Chen, Q.; Chen, S.; Fan, L.; Gan, Z.; Zhao, M.; Shi, L.; Bin, P.; Yang, G.; Zhou, X.; et al. Serine Synthesis Sustains Macrophage IL-1beta Production via NAD(+)-dependent Protein Acetylation. Mol. Cell 2024, 84, 744–759.e6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, Y.; He, F.; Wu, X.; Tan, B.; Chen, S.; Liao, Y.; Qi, M.; Chen, S.; Peng, Y.; Yin, Y.; et al. GABA Transporter Sustains IL-1beta Production in Macrophages. Sci. Adv. 2021, 7, eabe9274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, Y.; Fan, L.; Bin, P.; Zhu, C.; Chen, Q.; Cai, Y.; Duan, J.; Cai, Q.; Han, W.; Ding, S.; et al. GABA Signaling Enforces Intestinal Germinal Center B Cell Differentiation. Proc. Natl. Acad. Sci. USA 2022, 119, e2215921119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.; Chen, S.; Guo, Y.; He, F.; Fu, J.; Ren, W. Phenylalanine Diminishes M1 Macrophage Inflammation. Sci. China Life Sci. 2023, 66, 2862–2876. [Google Scholar] [CrossRef] [Scilit]
- Fan, L.; Xia, Y.; Wang, Y.; Han, D.; Liu, Y.; Li, J.; Fu, J.; Wang, L.; Gan, Z.; Liu, B.; et al. Gut Microbiota Bridges Dietary Nutrients and Host Immunity. Sci. China Life Sci. 2023, 66, 2466–2514. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene Name | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
|---|---|---|
| β-actin | GCACCGTGTTGGCGTAGAGG | GGACTTCGAGCAGGAGATGG |
| SLC7A8 | TGACAACATGGAGCAGCAGCAG | AGGCAGGGAAGGAGGGAAGAAAG |
| SLC7A5 | GACGCTGATGTACGCCTTCT | GCAGGCCAGGATAAAGAACA |
| SLC16A10 | GCCCAATAGTCAGCGTCTTCACAG | GTCCAACAAATCCAACAGCAGCAC |
| TDO2 | AAGAGCCCAGGTTCCAGGTT | CACTCACTGTTGAGCGCAGA |
| IDO1 | GGTTTCGCTATTGGTGGAAA | CTTTTGCAAAGCATCCAGGT |
| IDO2 | CCGTGCTCCATGCCTTTGAT | TGGCCATCTCCAGAGGACAG |
| KMO | GTTGCCCTCAGCACCACCTA | GGGAGATGCGTCCTATATTTTGG |
| KYNU | TGAGTCGCAGCTTCAACTTCATGG | ACAGGATCACGGCAATTGAGTCAC |
| KYAT1 | GGTCTCCCTGTGTTTGTGTCCTTG | TTGGTGCGAGGCGTGAACTTG |
| KYAT3 | CGGATGGTACGGTTGCTTGACAG | GAGACACGTCGGCGATGATGAAG |
| AADAT | CCAAGACGGTCTGTGCAAGGTG | CCATGCTCATCACTGGCAACGG |
| GOT2 | AACTGGCAGCACATCGTTGACC | GGTGACCTGGTGAATGGCATGG |
| TPH1 | CCGTCCTGTGGCTGGTTACTTATC | GTCCGAACCGTGTCTCACATACTG |
| AANAT | GCCACCTACCATCCCAGAGTCC | TCAAACACGCCAGCAGCATCC |
| ASMTL | TCCGCTTCCTGCCAGGTCAC | GCTTCTGCCACCAGGATGCC |
| ARG1 | CTTTCTCCAAGGGTCAGC | TCCCCGTAATCTTTCACAT |
| ODC1 | TGATGATTCCAAAGCAGTCTGT | AGATACATGCTGAAACCGACCT |
| SRM | CCCTCGCAAGGTGCTGAT | AGTAGCTGACAGCCATGC |
| SMS | GGCAAAGAAGTTGACAGTCTTTTGA | GGCCATCGGCAGTGGG |
| SMOX | CGGCAGTTCACGGGGAAT | CCGAGAACAGCACCTGCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, M.; Du, L.; Shen, Y.; Bin, P. Toll-like Receptor Activation Remodels the Polyamine and Tryptophan Metabolism in Porcine Macrophages. Metabolites 2025, 15, 162. https://doi.org/10.3390/metabo15030162
Zhang M, Du L, Shen Y, Bin P. Toll-like Receptor Activation Remodels the Polyamine and Tryptophan Metabolism in Porcine Macrophages. Metabolites. 2025; 15(3):162. https://doi.org/10.3390/metabo15030162
Chicago/Turabian StyleZhang, Meimei, Lingfei Du, Yinhao Shen, and Peng Bin. 2025. "Toll-like Receptor Activation Remodels the Polyamine and Tryptophan Metabolism in Porcine Macrophages" Metabolites 15, no. 3: 162. https://doi.org/10.3390/metabo15030162
APA StyleZhang, M., Du, L., Shen, Y., & Bin, P. (2025). Toll-like Receptor Activation Remodels the Polyamine and Tryptophan Metabolism in Porcine Macrophages. Metabolites, 15(3), 162. https://doi.org/10.3390/metabo15030162
