RETRACTED: In Vitro Induction of Apoptosis in Isolated Acute Myeloid Leukemia Cells: The Role of Anastatica hierochuntica Methanolic Extract
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.1.1. Plant Material and Extraction
2.1.2. Cisplatin
2.2. Methods
2.2.1. Phytochemical Analysis
1H-NMR Analysis
LC-MS-MS Analysis
2.2.2. In Vitro Anticancer Investigations
Peripheral Blood Leucocyte Isolation and Incubation
Trypan Blue Assay
Acridine Orange/Ethidium Bromide (AO/EB) Dual-Fluorescence Staining
Annexin-V/Propidium Iodide (PI) Dual-Fluorescence Staining of AML
Immunocytochemical Study of AML Cells
Quantitative Real-Time Polymerase Chain Reaction
2.2.3. Statistical Analysis
3. Results
3.1. UPLC-MS-QTOF and Molecular Networking Analysis
3.2. Assessment of Methanolic Extract’s 1H-NMR Spectra
3.3. Assessment of A. hierochuntica’s Effect on NHPL and AML Viability
3.4. Qualitative Determination of Cell Death Stages by Annexin-V/PI Dual-Fluorescent Staining in AML Cells
3.5. Immunocytochemical Reactivity of Apoptosis-Related Proteins in AML Cells
3.6. The mRNA Expression of Apoptosis-Related Genes in AML Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shah, A.H.; Bhandari, M.P.; Al-Harbi, N.O.; Al-Ashban, R.M. Kaff-E-Maryam (Anastatica hierochuntica L.): Evaluation of Gastro-Protective Activity and Toxicity in Different Experimental Models. Biol. Med. 2014, 6, 1. [Google Scholar]
- El-Seedi, H.R.; Burman, R.; Mansour, A.; Turki, Z.; Boulos, L.; Gullbo, J.; Göransson, U. The Traditional Medical Uses and Cytotoxic Activities of Sixty-One Egyptian Plants: Discovery of an Active Cardiac Glycoside from Urginea Maritima. J. Ethnopharmacol. 2013, 145, 746–757. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eman, A.S.; Tailang, M.; Benyounes, S.; Gauthaman, K. Antimalarial and Hepatoprotective Effects of Entire Plants of Anastatica Hierochuntica. Int. J. Res. Phytoch. Pharm. 2011, 1, 24–27. [Google Scholar]
- Yoshikawa, M.; Xu, F.; Morikawa, T.; Ninomiya, K.; Matsuda, H. Anastatins A and B, New Skeletal Flavonoids with Hepatoprotective Activities from the Desert Plant Anastatica hierochuntica. Bioorg. Med. Chem. Lett. 2003, 13, 1045–1049. [Google Scholar] [CrossRef] [Scilit]
- Fu, Y.; Zhao, C.; Saxu, R.; Yao, C.; Zhao, L.; Zheng, W.; Yu, P.; Teng, Y. Anastatin Derivatives Alleviate Myocardial Ischemia-Reperfusion Injury via Antioxidative Properties. Molecules 2021, 26, 4779. [Google Scholar] [CrossRef] [Scilit]
- Marzouk, M.M.; Al-Nowaihi, A.-S.M.; Kawashty, S.A.; Saleh, N.A.M. Chemosystematic Studies on Certain Species of the Family Brassicaceae (Cruciferae) in Egypt. Biochem. Syst. Ecol. 2010, 38, 680–685. [Google Scholar] [CrossRef] [Scilit]
- Zin, S.R.M.; Alshawsh, M.A.; Mohamed, Z. Multiple Skeletal Anomalies of Sprague Dawley Rats Following Prenatal Exposure to Anastatica hierochuntica, as Delineated by a Modified Double-Staining Method. Children 2022, 9, 763. [Google Scholar] [CrossRef] [Scilit]
- AlGamdi, N.; Mullen, W.; Crozier, A. Tea Prepared from Anastatica hirerochuntica Seeds Contains a Diversity of Antioxidant Flavonoids, Chlorogenic Acids and Phenolic Compounds. Phytochemistry 2011, 72, 248–254. [Google Scholar] [CrossRef] [Scilit]
- Almundarij, T.I.; Alharbi, Y.M.; Abdel-Rahman, H.A.; Barakat, H. Antioxidant Activity, Phenolic Profile, and Nephroprotective Potential of Anastatica hierochuntica Ethanolic and Aqueous Extracts against Ccl4-Induced Nephrotoxicity in Rats. Nutrients 2021, 13, 2973. [Google Scholar] [CrossRef] [Scilit]
- Zin, S.R.M.; Kassim, N.M.; Mohamed, Z.; Fateh, A.H.; Alshawsh, M.A. Potential Toxicity Effects of Anastatica hierochuntica Aqueous Extract on Prenatal Development of Sprague-Dawley Rats. J. Ethnopharmacol. 2019, 245, 112180. [Google Scholar] [CrossRef] [Scilit]
- Rameshbabu, S.; Messaoudi, S.A.; Alehaideb, Z.I.; Ali, M.S.; Venktraman, A.; Alajmi, H.; Al-Eidi, H.; Matou-Nasri, S. Anastatica hierochuntica (L.) Methanolic and Aqueous Extracts Exert Antiproliferative Effects through the Induction of Apoptosis in MCF-7 Breast Cancer Cells. Saudi Pharm. J. 2020, 28, 985–993. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zivarpour, P.; Hallajzadeh, J.; Asemi, Z.; Sadoughi, F.; Sharifi, M. Chitosan as Possible Inhibitory Agents and Delivery Systems in Leukemia. Cancer Cell Int. 2021, 21, 544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pizzato, M.; Li, M.; Vignat, J.; Laversanne, M.; Singh, D.; La Vecchia, C.; Vaccarella, S. The Epidemiological Landscape of Thyroid Cancer Worldwide: GLOBOCAN Estimates for Incidence and Mortality Rates in 2020. Lancet Diabetes Endocrinol. 2022, 10, 264–272. [Google Scholar] [CrossRef] [Scilit]
- El-Garawani, I.; El-Seedi, H.; Khalifa, S.; El Azab, I.H.; Abouhendia, M.; Mahmoud, S. Enhanced Antioxidant and Cytotoxic Potentials of Lipopolysaccharides-Injected Musca domestica Larvae. Pharmaceutics 2020, 12, 1111. [Google Scholar] [CrossRef] [Scilit]
- El-Nabi, S.H.; Dawoud, G.T.M.; El-Garawani, I.; El-Shafey, S. HPLC Analysis of Phenolic Acids, Antioxidant Activity and in Vitro Effectiveness of Green and Roasted Caffea Arabica Bean Extracts: A Comparative Study. Anticancer. Agents Med. Chem. 2018, 18, 1281–1288. [Google Scholar] [CrossRef] [Scilit]
- Sakr, S.A.; Nabi, S.H.; Okdah, Y.A.; Garawani, I.M.; El Shabka, A.M. Cytoprotective Effects of Aqueous Ginger (Zingiber Officinale) Extract against Carbimazole-Induced Toxicity in Albino Rats. Ejpmr 2016, 3, 489–497. [Google Scholar]
- El-Garawani, I.; Emam, M.; Elkhateeb, W.; El-Seedi, H.; Khalifa, S.; Oshiba, S.; Abou-Ghanima, S.; Daba, G. In Vitro Antigenotoxic, Antihelminthic and Antioxidant Potentials Based on the Extracted Metabolites from Lichen, Candelariella vitellina. Pharmaceutics 2020, 12, 477. [Google Scholar] [CrossRef] [Scilit]
- Tohamy, A.A.; El-Garawani, I.M.; Ibrahim, S.R.; Abdel Moneim, A.E. The Apoptotic Properties of Salvia aegyptiaca and Trigonella foenum-graecum Extracts on Ehrlich Ascites Carcinoma Cells: The Effectiveness of Combined Treatment. Res. J. Pharm. Biol. Chem. Sci. 2016, 7, 1872–1883. [Google Scholar]
- El-Garawani, I.M.; El-Nabi, S.H.; El-Shafey, S.; Elfiky, M.; Nafie, E. Coffea Arabica Bean Extracts and Vitamin C: A Novel Combination Unleashes MCF-7 Cell Death. Curr. Pharm. Biotechnol. 2019, 21, 23–36. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, A.; Ali, M.; El-Kholie, E.; El-Garawani, I.; Sherif, N. Anticancer Activity of Morus Nigra on Human Breast Cancer Cell Line (MCF-7): The Role of Fresh and Dry Fruit Extracts. J. Biosci. Appl. Res. 2016, 2, 352–361. [Google Scholar]
- El-Seedi, H.R.; Khalifa, S.A.M.; Yosri, N.; Khatib, A.; Chen, L.; Saeed, A.; Efferth, T.; Verpoorte, R. Plants Mentioned in the Islamic Scriptures (Holy Qur’ân and Ahadith): Traditional Uses and Medicinal Importance in Contemporary Times. J. Ethnopharmacol. 2019, 243, 112007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abosedera, D.A.; Emara, S.A.; Tamam, O.A.S.; Badr, O.M.; Khalifa, S.A.M.; El-seedi, H.R.; Refaey, M.S. Metabolomic Profile and in Vitro Evaluation of the Cytotoxic Activity of Asphodelus microcarpus against Human Malignant Melanoma Cells A375. Arab. J. Chem. 2022, 15, 104174. [Google Scholar] [CrossRef] [Scilit]
- Ali, K.; Ali, A.; Khan, M.N.; Rahman, S.; Faizi, S.; Ali, M.S.; Khalifa, S.A.M.; El-Seedi, H.R.; Musharraf, S.G. Rapid Identification of Common Secondary Metabolites of Medicinal Herbs Using High-Performance Liquid Chromatography with Evaporative Light Scattering Detector in Extracts. Metabolites 2021, 11, 489. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abd El-Gaber, A.S.; El Gendy, A.N.G.; Elkhateeb, A.; Saleh, I.A.; El-Seedi, H.R. Microwave Extraction of Essential Oil from Anastatica hierochuntica (L.): Comparison with Conventional Hydro-Distillation and Steam Distillation. J. Essent. Oil Bear. Plants 2018, 21, 1003–1010. [Google Scholar] [CrossRef] [Scilit]
- El-Din, M.I.G.; Fahmy, N.M.; Wu, F.; Salem, M.M.; Khattab, O.M.; El-Seedi, H.R.; Korinek, M.; Hwang, T.-L.; Osman, A.K.; El-Shazly, M. Comparative LC–LTQ–MS–MS Analysis of the Leaf Extracts of Lantana camara and Lantana montevidensis Growing in Egypt with Insights into Their Antioxidant, Anti-Inflammatory, and Cytotoxic Activities. Plants 2022, 11, 1699. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Garawani, I.M.; El-Sabbagh, S.M.; Abbas, N.H.; Ahmed, H.S.; Eissa, O.A.; Abo-Atya, D.M.; Khalifa, S.A.M.; El-Seedi, H.R. A Newly Isolated Strain of Halomonas sp.(HA1) Exerts Anticancer Potential via Induction of Apoptosis and G2/M Arrest in Hepatocellular Carcinoma (HepG2) Cell Line. Sci. Rep. 2020, 10, 14076. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Syed, M.; Khan, M.N.; Khadim, A.; Shadab, H.; Perveen, A.; El-Seedi, H.R.; Musharraf, S.G. Chemical Fingerprinting of Three Anemone Species and an Adulteration Study to Detect Cross Mixing of Medicinal Plants by HPLC-HR-ESI-MS/MS Method. J. King Saud. Univ. 2021, 33, 101461. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Carver, J.J.; Phelan, V.V.; Sanchez, L.M.; Garg, N.; Peng, Y.; Nguyen, D.D.; Watrous, J.; Kapono, C.A.; Luzzatto-Knaan, T. Sharing and Community Curation of Mass Spectrometry Data with Global Natural Products Social Molecular Networking. Nat. Biotechnol. 2016, 34, 828–837. [Google Scholar] [CrossRef] [Scilit]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A Software Environment for Integrated Models of Biomolecular Interaction Networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [Scilit]
- Dawod, A.; Fathalla, S.I.; Elkhatam, A.; Osman, N.; Sheraiba, N.; Hammad, M.A.; El-Seedi, H.R.; Shehata, A.A.; Anis, A. UPLC-QToF Nanospray MS and NMR Analysis of Ficus sycomorus Stem Bark and Its Effects on Rabbit. Processes 2021, 9, 1201. [Google Scholar] [CrossRef] [Scilit]
- El-Garawani, I.; Hassab El-Nabi, S.; El Kattan, A.; Sallam, A.; Elballat, S.; Abou-Ghanima, S.; El Azab, I.H.; El-Seedi, R.H.; Khalifa, S.A.M.; El-Shamy, S. The Ameliorative Role of Acacia senegal Gum against the Oxidative Stress and Genotoxicity Induced by the Radiographic Contrast Medium (Ioxitalamate) in Albino Rats. Antioxidants 2021, 10, 221. [Google Scholar] [CrossRef] [Scilit]
- Yedjou, C.G.; Saeed, M.A.; Hossain, M.; Dorsey, W.; Yu, H.; Tchounwou, P.B. Basic Apoptotic and Necrotic Cell Death in Human Liver Carcinoma (HepG2) Cells Induced by Synthetic Azamacrocycle. Environ. Toxicol. 2014, 29, 605–611. [Google Scholar] [CrossRef] [Scilit]
- Mishell, B.B.; Shiigi, S.M. Selected Methods in Cellular Immunology; WH Freeman: New York, NY, USA, 1980; ISBN 0716711060. [Google Scholar]
- Kasibhatla, S.; Amarante-Mendes, G.P.; Finucane, D.; Brunner, T.; Bossy-Wetzel, E.; Green, D.R. Acridine Orange/Ethidium Bromide (AO/EB) Staining to Detect Apoptosis. Cold Spring Harb. Protoc. 2006, 2006, pdb-prot4493. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.; Brouha, B.; Grossman, D. Rapid Induction of Mitochondrial Events and Caspase-Independent Apoptosis in Survivin-Targeted Melanoma Cells. Oncogene 2004, 23, 39–48. [Google Scholar] [CrossRef] [Scilit]
- Sak, K. Cytotoxicity of Dietary Flavonoids on Different Human Cancer Types. Pharmacogn. Rev. 2014, 8, 122. [Google Scholar] [CrossRef] [Scilit]
- Noreen, Y.; El-Seedi, H.; Perera, P.; Bohlin, L. Two New Isoflavones from Ceiba Pentandra and Their Effect on Cyclooxygenase-Catalyzed Prostaglandin Biosynthesis. J. Nat. Prod. 1998, 61, 8–12. [Google Scholar] [CrossRef] [Scilit]
- Odontuya, G.; Hoult, J.R.S.; Houghton, P.J. Structure-activity Relationship for Antiinflammatory Effect of Luteolin and Its Derived Glycosides. Phyther. Res. 2005, 19, 782–786. [Google Scholar] [CrossRef] [Scilit]
- Plochmann, K.; Korte, G.; Koutsilieri, E.; Richling, E.; Riederer, P.; Rethwilm, A.; Schreier, P.; Scheller, C. Structure–Activity Relationships of Flavonoid-Induced Cytotoxicity on Human Leukemia Cells. Arch. Biochem. Biophys. 2007, 460, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Amić, D.; Davidović-Amić, D.; Bešlo, D.; Trinajstić, N. Structure-Radical Scavenging Activity Relationships of Flavonoids. Croat. Chem. Acta 2003, 76, 55–61. [Google Scholar]
- Cushnie, T.P.T.; Lamb, A.J. Antimicrobial Activity of Flavonoids. Int. J. Antimicrob. Agents 2005, 26, 343–356. [Google Scholar] [CrossRef] [Scilit]
- Halder, A.; Das, S.; Bera, T.; Mukherjee, A. Rapid Synthesis for Monodispersed Gold Nanoparticles in Kaempferol and Anti-Leishmanial Efficacy against Wild and Drug Resistant Strains. RSC Adv. 2017, 7, 14159–14167. [Google Scholar] [CrossRef] [Scilit]
- Živković, J.Č.; Barreira, J.; Šavikin, K.P.; Alimpić, A.Z.; Stojković, D.S.; Dias, M.I.; Santos-Buelga, C.; Duletić-Laušević, S.N.; Ferreira, I.C.F.R. Chemical Profiling and Assessment of Antineurodegenerative and Antioxidant Properties of Veronica teucrium, L. and Veronica jacquinii BAUMG. Chem. Biodivers. 2017, 14, e1700167. [Google Scholar] [CrossRef] [Scilit]
- López-Lázaro, M. Distribution and Biological Activities of the Flavonoid Luteolin. Mini Rev. Med. Chem. 2009, 9, 31–59. [Google Scholar] [CrossRef] [Scilit]
- Shawky, E.; Nada, A.A.; Ibrahim, R.S. Potential Role of Medicinal Plants and Their Constituents in the Mitigation of SARS-CoV-2: Identifying Related Therapeutic Targets Using Network Pharmacology and Molecular Docking Analyses. RSC Adv. 2020, 10, 27961–27983. [Google Scholar] [CrossRef] [Scilit]
- Nakashima, S.; Matsuda, H.; Oda, Y.; Nakamura, S.; Xu, F.; Yoshikawa, M. Melanogenesis Inhibitors from the Desert Plant Anastatica hierochuntica in B16 Melanoma Cells. Bioorg. Med. Chem. 2010, 18, 2337–2345. [Google Scholar] [CrossRef] [Scilit]
- Jasim, R.Z.; Ali, B.H.; Mashhadani, Z.I.A.L. The Extract of Anastatica hirerochuntica (Kaff Maryam) Flavonoids Creates a Novel Pharmacophore at the Position of Inflammation in Iraqi Female with Type 2 Diabetes Mellitus. Res. J. Pharm. Biol. Chem. Sci. 2017, 8, 1086–1093. [Google Scholar]
- Saranya, R.; Ali, M.S.; Anuradha, V.; Safia, M. Pharmacognosy and Radical Scavenging Potential of Different Plant Parts of Anastatica hierochuntica. J. Pharmacogn. Phytochem. 2019, 8, 1764–1771. [Google Scholar]
- Spagnuolo, C.; Russo, M.; Bilotto, S.; Tedesco, I.; Laratta, B.; Russo, G.L. Dietary Polyphenols in Cancer Prevention: The Example of the Flavonoid Quercetin in Leukemia. Ann. N. Y. Acad. Sci. 2012, 1259, 95–103. [Google Scholar] [CrossRef] [Scilit]
- Cheng, A.-C.; Huang, T.-C.; Lai, C.-S.; Pan, M.-H. Induction of Apoptosis by Luteolin through Cleavage of Bcl-2 Family in Human Leukemia HL-60 Cells. Eur. J. Pharmacol. 2005, 509, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Moradzadeh, M.; Tabarraei, A.; Sadeghnia, H.R.; Ghorbani, A.; Mohamadkhani, A.; Erfanian, S.; Sahebkar, A. Kaempferol Increases Apoptosis in Human Acute Promyelocytic Leukemia Cells and Inhibits Multidrug Resistance Genes. J. Cell. Biochem. 2018, 119, 2288–2297. [Google Scholar] [CrossRef] [Scilit]
- Ruela-de-Sousa, R.R.; Fuhler, G.M.; Blom, N.; Ferreira, C.V.; Aoyama, H.; Peppelenbosch, M.P. Cytotoxicity of Apigenin on Leukemia Cell Lines: Implications for Prevention and Therapy. Cell Death Dis. 2010, 1, e19. [Google Scholar] [CrossRef] [Scilit]
- Yu, S.; Li, J.; Guo, L.; Di, C.; Qin, X.; Li, Z. Integrated Liquid Chromatography-Mass Spectrometry and Nuclear Magnetic Resonance Spectra for the Comprehensive Characterization of Various Components in the Shuxuening Injection. J. Chromatogr. A 2019, 1599, 125–135. [Google Scholar] [CrossRef] [Scilit]
- Kaur, M.; Mandair, R.; Agarwal, R.; Agarwal, C. Grape Seed Extract Induces Cell Cycle Arrest and Apoptosis in Human Colon Carcinoma Cells. Nutr. Cancer 2008, 60, 2–11. [Google Scholar] [CrossRef] [Scilit]
- El Sayed, R.A.A.; Hanafy, Z.E.M.; Abd El Fattah, H.F.; Mohamed, A.K. Possible Antioxidant and Anticancer Effects of Plant Extracts from Anastatica hierochuntica, Lepidium sativum and Carica papaya against Ehrlich Ascites Carcinoma Cells. Cancer Biol. 2020, 10, 1–16. [Google Scholar]
- Al-Eisawi, Z.; Abderrahman, S.M.; Abdelrahim, Y.; Al-Abbassi, R.; Bustanji, Y.K. Anastatica hierochuntica Extracts: Promising, Safe and Selective Anticancer Agents. Nat. Prod. J. 2022, 12, 78–87. [Google Scholar] [CrossRef] [Scilit]
- Denecker, G.; Dooms, H.; Van Loo, G.; Vercammen, D.; Grooten, J.; Fiers, W.; Declercq, W.; Vandenabeele, P. Phosphatidyl Serine Exposure during Apoptosis Precedes Release of Cytochrome c and Decrease in Mitochondrial Transmembrane Potential. FEBS Lett. 2000, 465, 47–52. [Google Scholar] [CrossRef] [Scilit]
- El-Garawani, I.; El, S.H.N.; Nafie, E.; Almeldin, S. Foeniculum Vulgare and Pelargonium Graveolens Essential Oil Mixture Trigger the Cell Cycle Arrest and Apoptosis in MCF-7 Cells. Anticancer Agents Med. Chem. 2019, 19, 1103–1113. [Google Scholar] [CrossRef] [Scilit]
- Vélez, J.; Hail, N., Jr.; Konopleva, M.; Zeng, Z.; Kojima, K.; Samudio, I.; Andreeff, M. Mitochondrial Uncoupling and the Reprograming of Intermediary Metabolism in Leukemia Cells. Front. Oncol. 2013, 3, 67. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.E.; Ha, T.K.; Yoon, J.H.; Lee, J.S. Myricetin Induces Cell Death of Human Colon Cancer Cells via BAX/BCL2-Dependent Pathway. Anticancer Res. 2014, 34, 701–706. [Google Scholar]
- Kulsoom, B.; Shamsi, T.S.; Afsar, N.A.; Memon, Z.; Ahmed, N.; Hasnain, S.N. Bax, Bcl-2, and Bax/Bcl-2 as Prognostic Markers in Acute Myeloid Leukemia: Are We Ready for Bcl-2-Directed Therapy? Cancer Manag. Res. 2018, 10, 403. [Google Scholar]
- Lopez-Lazaro, M. Flavonoids as Anticancer Agents: Structure-Activity Relationship Study. Curr. Med. Chem. Agents 2002, 2, 691–714. [Google Scholar] [CrossRef] [Scilit]
- Dorta, D.J.; Pigoso, A.A.; Mingatto, F.E.; Rodrigues, T.; Prado, I.M.R.; Helena, A.F.C.; Uyemura, S.A.; Santos, A.C.; Curti, C. The Interaction of Flavonoids with Mitochondria: Effects on Energetic Processes. Chem. Biol. Interact. 2005, 152, 67–78. [Google Scholar] [CrossRef] [Scilit]
- Sriskanthadevan, S.; Jeyaraju, D.V.; Chung, T.E.; Prabha, S.; Xu, W.; Skrtic, M.; Jhas, B.; Hurren, R.; Gronda, M.; Wang, X. AML Cells Have Low Spare Reserve Capacity in Their Respiratory Chain That Renders Them Susceptible to Oxidative Metabolic Stress. Blood J. Am. Soc. Hematol. 2015, 125, 2120–2130. [Google Scholar] [CrossRef] [Scilit]
- Panina, S.B.; Baran, N.; Brasil da Costa, F.H.; Konopleva, M.; Kirienko, N.V. A Mechanism for Increased Sensitivity of Acute Myeloid Leukemia to Mitotoxic Drugs. Cell Death Dis. 2019, 10, 617. [Google Scholar] [CrossRef] [Scilit]
- Jitschin, R.; Hofmann, A.D.; Bruns, H.; Gießl, A.; Bricks, J.; Berger, J.; Saul, D.; Eckart, M.J.; Mackensen, A.; Mougiakakos, D. Mitochondrial Metabolism Contributes to Oxidative Stress and Reveals Therapeutic Targets in Chronic Lymphocytic Leukemia. Blood J. Am. Soc. Hematol. 2014, 123, 2663–2672. [Google Scholar] [CrossRef] [Scilit]










| Name | Accession Number | Sense (5′–3′) | Antisense (5′–3′) |
|---|---|---|---|
| GAPDH | NM_001289745.2 | GGATTTGGTCGTATTGGG | GGAAGATGGTGATGGGATT |
| P53 | NM 001289746.1 | GGATTTGGTCGTATTGGG | GGAAGATGGTGATGGGATT |
| BCL-2 | NM_001114735.1 | TACAGGCTGGCTCAGGACTAT | CGCAACATTTTGTAGCACTCTG |
| BAX | NM_001291431.1 | CCCGAGAGGTCTTTTTCCGAG | CCAGCCCATGATGGTTCTGAT |
| Caspase-3 | NM_001354777.1 | GGCGCTCTGGTTTTCGTTAAT | CAGTTCTGTACCACGGCAGG |
| Peak No. | RT (min.) | [M+H]+ | m/z Fragment | Tentative Identification | GNPS Link | Literature Review of the Biological Activities of the Compounds |
|---|---|---|---|---|---|---|
| L1 | 20.92 | 611.24 | 270.97, 286.95, 449.05 | Luteolin-O-glucoside-O-rhamoside | Literature | Anti-inflammatory and antioxidant [39]; cytotoxic [40] |
| L2 | 21.95 | 597.48 | 301.18, 463.53 | Diosmetin-C-glucoside-O-pentoside | Literature | DPPH activity [41] |
| L3 | 22.93 | 594.54 | 433.024, 271.13 | Apigenin-C-glucoside-O-glucoside | Literature | Antimicrobial activity [42]; antioxidant [39]; cytotoxic [40] |
| L4 | 24.591 | 597.39 | 449.31, 287.14 | Kaempferol-O-glucoside-O-rhamnoside | Literature | Anti-leishmania [43] |
| L5 | 27.617 | 609.24 | 433.026, 270.97 | Apigenin-O-glucoside-O-glucuronide | Literature | Anti-neurodegenerative and antioxidant [44]; cytotoxic [40] |
| L6 | 16.8 | 449.31 | 153.05, 287.009 | Luteolin-O-glucoside | http://gnps.ucsd.edu/ProteoSAFe/gnpslibraryspectrum.jsp?SpectrumID=CCMSLIB00003136499 (accessed on 25 July 2022) | Anticancer potency (inhibition of melanogenesis and proliferation in B16 melanoma 4A5 cells) [4,44,45,46,47,48] |
| L7 | 21.4 | 273.25 | 152.95, 146.96 | Naringenin | http://gnps.ucsd.edu/ProteoSAFe/gnpslibraryspectrum.jsp?SpectrumID=CCMSLIB00003136767 (accessed on 25 July 2022) | |
| L8 | 19.6 | 303.19 | 132.1, 153.001, 229.02, 257.02, 275.09, 285.03 | Quercetin | http://gnps.ucsd.edu/ProteoSAFe/gnpslibraryspectrum.jsp?SpectrumID=CCMSLIB00000205749 (accessed on 25 July 2022) | |
| L9 | 14.2 | 287.27 | 135, 52.9, 164.9, 177, 213, 227.1, 241, 259.1 | Kaempferol | http://gnps.ucsd.edu/ProteoSAFe/gnpslibraryspectrum.jsp?SpectrumID=CCMSLIB00005720284 (accessed on 25 July 2022) | |
| L10 | 12.8 | 627.22 | 287.97, 302.98, 465.01 | Quercetin-O-diglucoside | Literature | |
| L11 | 21.65 | 303.18 | 286.01, 272.99, 144.99, 152.99, 177 | Diosmetin | Literature | DPPH activity [41] |
| L12 | 17.85 | 465.37 | 165.10, 229.12, 257.08, 303.03 | Hyperoside | http://gnps.ucsd.edu/ProteoSAFe/gnpslibraryspectrum.jsp?SpectrumID=CCMSLIB00000213809 (accessed on 25 July 2022) | Inhibition of melanogenesis and proliferation in B16 melanoma 4A5 cells [47] |
| L13 | 15.8 | 463.36 | 300.97 | Isoquercitin | http://gnps.ucsd.edu/ProteoSAFe/gnpslibraryspectrum.jsp?SpectrumID=CCMSLIB00003136664 (accessed on 25 July 2022) | |
| L14 | 21.7 | 433.476 | 119.10, 153.06, 271.13 | Apigenin-O-glucoside | http://gnps.ucsd.edu/ProteoSAFe/gnpslibraryspectrum.jsp?SpectrumID=CCMSLIB00000222717 (accessed on 25 July 2022) | [38,46,48,49] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
El-Garawani, I.M.; Abd El-Gaber, A.S.; Algamdi, N.A.; Saeed, A.; Zhao, C.; Khattab, O.M.; AlAjmi, M.F.; Guo, Z.; Khalifa, S.A.M.; El-Seedi, H.R. RETRACTED: In Vitro Induction of Apoptosis in Isolated Acute Myeloid Leukemia Cells: The Role of Anastatica hierochuntica Methanolic Extract. Metabolites 2022, 12, 878. https://doi.org/10.3390/metabo12090878
El-Garawani IM, Abd El-Gaber AS, Algamdi NA, Saeed A, Zhao C, Khattab OM, AlAjmi MF, Guo Z, Khalifa SAM, El-Seedi HR. RETRACTED: In Vitro Induction of Apoptosis in Isolated Acute Myeloid Leukemia Cells: The Role of Anastatica hierochuntica Methanolic Extract. Metabolites. 2022; 12(9):878. https://doi.org/10.3390/metabo12090878
Chicago/Turabian StyleEl-Garawani, Islam M., Amira S. Abd El-Gaber, Noura A. Algamdi, Aamer Saeed, Chao Zhao, Omar M. Khattab, Mohamed F. AlAjmi, Zhiming Guo, Shaden A. M. Khalifa, and Hesham R. El-Seedi. 2022. "RETRACTED: In Vitro Induction of Apoptosis in Isolated Acute Myeloid Leukemia Cells: The Role of Anastatica hierochuntica Methanolic Extract" Metabolites 12, no. 9: 878. https://doi.org/10.3390/metabo12090878
APA StyleEl-Garawani, I. M., Abd El-Gaber, A. S., Algamdi, N. A., Saeed, A., Zhao, C., Khattab, O. M., AlAjmi, M. F., Guo, Z., Khalifa, S. A. M., & El-Seedi, H. R. (2022). RETRACTED: In Vitro Induction of Apoptosis in Isolated Acute Myeloid Leukemia Cells: The Role of Anastatica hierochuntica Methanolic Extract. Metabolites, 12(9), 878. https://doi.org/10.3390/metabo12090878

