Next Article in Journal
Gastrointestinal Incretins—Glucose-Dependent Insulinotropic Polypeptide (GIP) and Glucagon-like Peptide-1 (GLP-1) beyond Pleiotropic Physiological Effects Are Involved in Pathophysiology of Atherosclerosis and Coronary Artery Disease—State of the Art
Previous Article in Journal
Angiogenin Levels and Their Association with Cardiometabolic Indices Following Vitamin D Status Correction in Saudi Adults
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Overexpression of bmp4, dazl, nanos3 and sycp2 in Hu Sheep Leydig Cells Using CRISPR/dcas9 System Promoted Male Germ Cell Related Gene Expression

1
Institute of Sheep and Goat Science, Nanjing Agricultural University, Nanjing 210095, China
2
Taicang Agricultural and Rural Science & Technology Service Center, Graduate Workstation, Taicang 215400, China
*
Author to whom correspondence should be addressed.
Biology 2022, 11(2), 289; https://doi.org/10.3390/biology11020289
Submission received: 5 December 2021 / Revised: 2 February 2022 / Accepted: 5 February 2022 / Published: 11 February 2022
(This article belongs to the Section Cell Biology)

Simple Summary

Male germ cell development plays a crucial role in male reproduction, and gene expression also presents an essential regulatory role in its development. Many studies have been devoted to the induction and differentiation of pluripotent stem cells into germ cells in vitro. However, the culture system for pluripotent stem cells from domestic animals is not stable, especially in sheep. Our study attempted to transdifferentiate sheep somatic cells into germ cells in vitro by the overexpression of key germ cell related genes, with the aim of perfecting the construction of germ cell research models in vitro. Therefore, we explored the expression pattern of four crucial genes, bmp4, dazl, nanos3 and sycp2, in Hu sheep testicular development, and investigated the potential efficiency of overexpression of the four candidate genes using the CRISPR/dcas9 system in Leydig cells. We revealed that the overexpression of bmp4, dazl, nanos3 and sycp2 can promote the expression of male germ cell related genes. To the best of our knowledge, this is the first study to construct an overexpression induction system using CRISPR/dcas9 technology, and to induce sheep somatic cells into germ cells in vitro.

Abstract

Male germ cells directly affect the reproduction of males; however, their accurate isolation and culture in vitro is extremely challenging, hindering the study of germ cell development and function. CRISPR/dcas9, as an efficient gene reprogramming system, has been verified to promote the transdifferentiation of pluripotent stem cells into male germ cells by editing target genes. In our research, we explored the expression pattern of the germ cell related genes bmp4, dazl, nanos3 and sycp2 in Hu sheep testicular development and constructed the overexpression model using the CRISPR/dcas9 system. The results indicated that four genes showed more expression in testis tissue than in other tissues, and that bmp4, dazl and sycp2 present higher expression levels in nine-month-old sheep testes than in three-month-olds, while nanos3 expressed the opposite trend (p < 0.05). In addition, the expression of four potential genes in spermatogenic cells was slightly different, but they were all expressed in sheep Leydig cells. To verify the potential roles of the four genes in the process of inducing differentiation of male germ cells, we performed cell transfection in vitro. We found that the expression of the germ cell related genes Prdm1, Prdm14, Mvh and Sox17 were significantly increased after the overexpression of the four genes in Leydig cells, and the co-transfection effect was the most significant (p < 0.05). Our results illustrate the crucial functions of bmp4, dazl, nanos3 and sycp2 in Hu sheep testis development and verified the effectiveness of the overexpression model that was constructed using the CRISPR/dcas9 system, which provided a basis for further male germ cell differentiation in vitro.

1. Introduction

Infertility is a persistent reproductive health problem worldwide, and approximately half of cases are attributable to males [1,2]. Spermatogenesis is a crucial process in male reproduction, including testicular somatic cell development and germ cell differentiation. Male germ cell development participates in the complex process of mitosis and meiosis, and male germ cells at different developmental stages are difficult to isolate accurately. Disorders of germ cell development can cause many male diseases, which in turn cause male fertility problems [3]. It is important to investigate male germ cell development and regulatory mechanisms.
In many studies, stem cell transdifferentiation is widely used to study the development of germ cells [4,5], including cytokine induction [6], somatic cell co-culture [7] and overexpression of key germ cell genes [8]. With the evolution of single-cell sequencing technology, more studies have focused on the identification of the crucial genes in different cell types of the testes [9,10]. In our previous research, we also explored the cell type clustering and marker gene screening of adult Hu sheep testes [11]. In addition, numerous genes have been demonstrated to be pivotal during testicular development and are involved in the complex process of meiosis. Bmp4 has been reported to be involved in the formation and development of primordial germ cells (PGCs). Bmp4 can enhance the methylation of H3K4me2 by activating the WNT pathway to ensure the formation of PGCs [12]. It was also reported that lncRNA bmp4 promoted bmp4 expression and regulated PGC production [13]. The expressions of dazl and nanos3 were closely related to sheep testicular development [14,15,16]. A previous study indicated that sycp2, as an important factor in transcriptional regulation, can interact with lncRNA and potentially regulate spermatogenesis [17]. In addition, many key spermatogenesis related genes have been proven to play pivotal regulatory roles in germ cell differentiation. Genes such as stra8, boule and dazl were overexpressed in goat bone mesenchymal stem cells (BMSCs), which induce goat male germ cells by RNA transfection [18,19]. Overexpressed cd61 also promoted human umbilical cord mesenchymal stem cell (hUC-MSC) differentiation into male germ-like cells [20]. Tfcp2l1 was proven to play a key regulatory role in the differentiation of human pluripotent stem cells into primordial germ cell-like cells (PGCLCs) by plasmid transfection [21]. In human induced pluripotent stem cells, the overexpression of dazl, boule and daz effectively promotes meiosis progression and haploid formation [22,23]. The activation of stra8 and prm1 in embryonic stem cells induced male germline stem cell differentiation [24]. It was also indicated that Nanog alone promoted the differentiation process of PGCLCs, which showed germline-specific epigenetic modification [25]. Moreover, bmp4, as a key factor for inducing pluripotent stem cells to differentiate into male germ cells [26,27,28], is also essential for the regulation of testicular development and spermatogenesis [29,30]. Previous research also certified that nanos3 played roles in maintaining the number of germ cells and the process of meiosis [31]. Based on our research, sycp2 exhibited sequential expression in the process of male germ cells [11]. Furthermore, the CRISPR/dcas9 system is an effective means of cellular reprogramming [32,33]. It was reported that human foreskin fibroblasts were reprogrammed into Leydig-like cells based on activating nr5a1, gata4 and dmrt1 using the CRISPR/dCas9 SAM system [34].
Since Hu sheep are a traditional breed across China, it is important to study their male germ cell development. In the present study, we first explored the expression pattern and location of four crucial genes, bmp4, dazl, nanos3 and sycp2, in Hu sheep testicular development. Next, the activation system of four genes was constructed using CRISPR/dcas9 and the effectiveness was validated in sheep Leydig cells. Therefore, this study may be valuable for male sheep breeding.

2. Materials and Methods

The experiments performed in our study were approved by the Institutional Animal Care and Use Committees at Nanjing Agricultural University, China (Approval ID: SYXK2011-0036).

2.1. Animals and Sample Collection

Six healthy male three-month-old and three nine-month-old Hu sheep were selected and slaughtered for testes and internal organ tissue (heart, liver, kidney, rumen, jejunum, ileum, hypothalamus, pituitary and ovary) collection. The tissues were immediately transferred into a −80 °C environment for RNA and protein extraction. Samples trimmed from testes tissue were also fixed in 4% paraformaldehyde for 48 h, and then were dehydrated thorough graded alcohol and clarified in xylene. Then, the tissues were embedded in paraffin, and 5 μm-thick tissue sections were cut for immunostaining.

2.2. Total RNA Extraction and qPCR

The total RNA of collected tissues was extracted using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, California, USA) and the concentration and quality were detected using a NanoDrop instrument (NanoDrop Technologies, Wilmington, DE, USA). The qualified RNA was reverse-transcribed into a cDNA template, and further qPCR was performed. The primers of the genes were designed based on the NCBI database and synthesized by Nanjing Tsingke Biotechnology Company (Table 1). The qPCR experiment was carried out following the SYBR qPCR master mix reagent instructions (Vazyme, Nanjing, China). The results of qPCR were analyzed using the 2−ΔΔt method.

2.3. Protein Isolation and Western Blot

The protein of the samples was collected using a RIPA lysis solution that contained 1% PMSF, and the concentration was analyzed using a BCA kit (Beyotime Biotechnology Company, Shanghai, China). Denatured protein samples were electrophoresed using 12% bis-tris gel, then transferred to a polyvinylidene difluoride membrane (PVDF). After blocking the PVDF using 5% skimmed milk powder, the brands were incubated with primer antibodies for 16 h at 4 °C. The antibody usage information is shown in Table 2. Following secondary antibody incubation for 2 h, the bands were imaged in the chemiluminescence detection system, and the grayscale value was calculated using ImageJ software.

2.4. Tissue Immunohistochemistry and Cellular Immunofluorescence

Sheep testes tissue sections of 5 µM were cut and immunohistochemistry was performed. In addition, sheep Leydig cells were seeded in plates and fixed with 4% paraformaldehyde for immunofluorescence. After cell permeabilization and blocking were performed with TritonX-100 and BSA, respectively, the antibody incubation was carried out. The primary antibodies of Bmp4, Dazl, Nanos3 and Sycp2 were incubated in a dilution of 1:100 at 4 °C overnight, excluding the control group. After washing, the secondary antibody incubation was performed, including the HRP-labeled goat anti-rabbit IgG (H + L) (Beyotime Biotechnology Company, Shanghai, China; A0208, 1:200 dilution) for immunohistochemistry, and CoraLite594–conjugated goat anti-rabbit IgG (H + L) (Proteintech, Wuhan, China; SA00013-4, 1:200 dilution) for immunofluorescence. The positive reaction of tissues sections was detected using a DAB kit (Boster, CA, USA, AR1022). In addition, the nuclei of the tissue sections and cells were stained using hematoxylin and DAPI, respectively. Finally, the tissue sections and cells were imaged under the microscope.

2.5. Plasmid Construction and Synthesis of bmp4, dazl, nanos3 and sycp2

To increase gene expression, the sgRNAs of bmp4, dazl, nanos3 and sycp2 were designed on the website (http://chopchop.cbu.uib.no/, 17 Janunary 2021) and listed in Table 3. The pLenti-U6-sgRNA-PGK-Neo backbone, dCas9 Synergistic Activation Mediator Lentivector (K015) and CRISPR Scrambled sgRNA CRISPR Lentiviral Vector (K018) were purchased from Applied Biological Materials Inc. (abm). All of these constructs were confirmed by sequencing.

2.6. Cell Isolation Culture and Transfection

Leydig cells from the ram testes were isolated and the method used was as described in previous research [35]. Briefly, fresh and intact testis tissues were brought back to the lab within 1 h, the testis tissues were chopped into 1 mm2 pieces, and then digested with 1 mg/mL concentration of collagenase IV for 30 min. Then, the cell suspension was filtered with a 70 μm filter. The culture medium contained 90% DMEM/F12 (Gibco Life Technologies, Carlsbad, CA, USA), 10% FBS (Gibco Life Technologies) and 2 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco Life Technologies) was used for cell culture at 37 °C and 5% CO2 atmosphere. The cells were seeded in the dish for 1 h, then non-adherent spermatogenic cells were removed. The cells were confluent to 90% density, cells were digested and passaged for further experiment. The cells were seeded in six-well plates and the plasmids of four genes (the total amount of DNA was 4 ug) were transfected into Leydig cells with 70–80% density following the Lipofectamine™3000 transfection reagent instruction. After 48 h and 72 h, the RNA and the protein of cells were extracted, respectively, and further used for the qPCR and Western blot experiments.

2.7. Data Analysis

All experiments were performed independently at least three times and the data were expressed as mean ± standard error of mean (SEM). The different letters such as a, b, c and *** represent a significant and extremely significant difference between groups (p < 0.05 and p < 0.001, respectively) in qPCR experiment.

3. Results

3.1. The Expression of bmp4, dazl, nanos3 and sycp2 in Sheep Testicular Development

To detect the expression levels of bmp4, dazl, nanos3 and sycp2 in various tissues of sheep, a qPCR experiment was carried out. We found that bmp4, dazl and nanos3 presented the highest expression level in testis tissue (Figure 1, p < 0.05). Sycp2 showed moderate expression in whole tissues. The immature and mature sheep testis tissues were used for qPCR and Western blot analysis to reveal the expression patterns of bmp4, dazl, nanos3 and sycp2 during sheep testicular development. As shown in Figure 2, bmp4, dazl and sycp2 were more extremely increased in the 9M group than in the 3M group (p < 0.001) and nanos3 presented the opposite trend. Thus, these four genes potentially play roles in sheep testicular development.

3.2. Location Analysis of bmp4, dazl, nanos3 and sycp2 in Sheep Testis

For identifying the location of Bmp4, Dazl, Nanos3 and Sycp2 in the sheep testicular development process, an IHC experiment was performed. As shown in Figure 3, Bmp4 was mainly expressed in Leydig cells of the 3M group and abundantly expressed in the spermatocytes and round spermatids of the 9M group. Dazl showed slight expression in 3M testes, but it was strongly expressed in the spermatogonia and spermatocytes of the 9M testes. Nanos3 was expressed in the whole cell types of testes at different stages. Sycp2 expression in the 3M group was similar to that of BMP4, and it was mainly expressed in spermatocytes and spermatids in the 9M group. In total, four genes were expressed in sheep testis Leydig cells.

3.3. The Expression of bmp4, dazl, nanos3 and sycp2 in Sheep Leydig Cells

Sheep Leydig cells were isolated and cultured. As shown in Figure S1, the Leydig cell marker genes Hsd3b and Cyp17a1 were positively expressed in the cytoplasm of the isolated cells, and the expression level of other cell type marker genes were significant lower than Leydig cell markers which confirmed that the isolated cells were of high purity. Figure 4 shows that Bmp4 and Nanos3 were mainly expressed in the cytoplasm, while Dazl and Sycp2 were both expressed in the nucleus and the cytoplasm. These results potentially verified the roles of the four genes in sheep testicular cells.

3.4. sgRNA Transfection and Screening of bmp4, dazl, nanos3 and sycp2

In order to effectively construct overexpression vectors for bmp4, dazl, nanos3 and sycp2, we first isolated Hu sheep fibroblasts from ears, then the dCas9 Synergistic Activation Mediator Lentivector and the CRISPR Scrambled sgRNA CRISPR Lentiviral Vector of the four genes were transfected. Figure 5 shows that the sgRNA2, sgRNA2, sgRNA1 and sgRNA1 of bmp4, dazl, nanos3 and sycp2, respectively, were the most effective in their overexpression levels. In addition, we detected the transfection efficiency of different combinations of sgRNA and found that single sgRNA transfection was more efficient than mixed transfection. Thus, the most effective sgRNA of each gene was selected for further function validation in sheep Leydig cells.

3.5. In Vitro Overexpression of bmp4, dazl, nanos3 and sycp2 in Sheep Leydig Cells

Based on the sgRNA screening, we conducted single gene transfection (C, B, D, N, S) and mixed gene transfection (+) in Leydig cells. The Western blot experiments indicated that, respectively, overexpression of bmp4, dazl, nanos3 and sycp2 can improve the expression of these four genes (Figure S2, p < 0.05). However, overexpression of bmp4, dazl and nanos3, respectively, did not increase the expression of Prdm1 and Prdm14. In B, D, N, S groups, the protein levels of Mvh and Sox17 were significantly increased. Moreover, the mixed group (+) significantly improved the expression of the male germ cell related genes, Prdm1, Prdm14, Mvh and Sox17, and the levels were higher than B, D, N, S groups, except Sox17 (Figure 6, p < 0.05). These results demonstrated that the mixed transfection of four genes was the most effective.

4. Discussion

In the study of male reproduction, germ cell development is crucial and essential. However, the separation of spermatogenic cells at different stages in the process of spermatogenesis remains difficult. Research focused on the differentiation of male germ cells induced by other cells through gene editing methods in vitro has been increasing [36]. Previous studies have revealed multiple functionally redundant genes in mouse testicular development using CRISPR/cas9 genome editing technology [37,38]. Nevertheless, few studies have investigated male sheep germ cell development. In our study, we selected four potential genes, bmp4, dazl, nanos3 and sycp2, to explore their expression pattern in sheep testicular development and construct overexpression vectors for sheep germ cell induction.
To explore gene regulation in the spermatogenesis process, more studies have revealed gene expression profiles in the spermatogenesis process using single-cell sequencing methods [39,40,41]. Previously, we have demonstrated several genes that potentially affect the spermatogenesis process in Hu sheep, and screened out several genes that are expressed sequentially in spermatogenesis [11]. During testicular development, bmp4, as a vital transcription factor, was secreted from Sertoli cells in the prepuberal stage and then produced by spermatogonia in the adult stage, ensuring they were involved in the proliferation and differentiation of spermatogonia [42,43]. However, we found that bmp4 was expressed in Leydig cells during puberty and in spermatogenic cells during sexual maturity in sheep. Dazl, a conserved gene related to meiosis [44], showed higher expression levels in adult testes than in the immature testis tissues of goats and sheep [14,45], which was consistent with our results. Dazl was located in sheep Leydig cells and regulated sheep spermatogenesis in the post-pubertal stage [15]. In our previous research, Nanos3 participated in Hu sheep germ cell development by affecting the synthesis and secretion of testosterone [16]. In embryonic development and the PGC differentiation process, nanos3 displayed crucial functions [46,47] and also maintained the undifferentiated state of spermatogonia [48]. Based on Hu sheep testicular single cell transcriptome analysis [11], sycp2 manifested potential roles in spermatogenesis. Because it is the major component of the synaptonemal complex, it potentially affects the meiosis process in spermatogenesis [49]. However, little attention has focused on its function in testicular development, and we indicated the expression pattern and location of sycp2 in sheep testis tissues. Our results explained the expression patterns of the four candidate genes in Hu sheep testicular development, and we conducted a localization analysis in Leydig cells, providing the basis for further vector construction and verification experiments.
The study of male spermatogenesis disorders always involves the separation of spermatogenic cells. Many studies have focused on the induced differentiation of male germ cells from pluripotent stem cells using the CRISPR/cas9 system [50]. The CRISPR/cas9 system has the advantage of high targeting efficiency, low off-target effects and low technical difficulty, and it also has been successfully used for the treatment of clinical diseases [51]. It has been reported that both c1eis and stra8 gene deletion mediated by CRISPR/cas9 inhibit the differentiation of embryonic stem cells into male germ cells [52,53]. The CRISPR/dcas9 system can effectively activate gene expression through the combination of the vp64 domain and transcriptionally activated dCas9 protein [54,55]. In our study, we used this activation system to construct a multi-gene transcription activation vectors for exploring the importance of gene induction in the differentiation of male germ cells in vitro.
In the present study, we first detected the expression changes and localization analysis of bmp4, dazl, nanos3 and sycp2 in Hu sheep testis development, and isolated testicular Leydig cells in vitro. We then verified the efficacious overexpression of the four genes in vitro by constructing overexpression vectors using the CRISPR/cas9 activation system. Our results will be helpful for further perfecting the differentiation of male germ cells in vitro and providing new insights for livestock breeding.

5. Conclusions

In conclusion, our study focused on the overexpression system construction in sheep testicular somatic cells using CRISPR/cas9 genome editing technology. The results indicated that the candidate genes bmp4, dazl, nanos3 and sycp2 presented different expression changes and locations during testicular development. The expression of germ cell related genes was promoted after the overexpression of the four genes using the CRISPR/cas9 system. The present results proved the feasibility of the overexpression system construction using CRISPR/dcas9 in sheep Leydig cells.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/biology11020289/s1, Figure S1: The expression location of bmp4, dazl, nanos3 and sycp2 in sheep Leydig cells. Figure S2: The complete Western blot images of Figure 2 and Figure 6.

Author Contributions

H.Y. performed the experiments and wrote the main manuscript text; W.L., Z.W. and M.D. checked and revised the manuscript; Y.C. and P.C. analyzed the experiment data; Y.Z. and F.W. designed the project and funded this research. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (31872359).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Institutional Animal Care and Use Committees at Nanjing Agricultural University, China (Approval ID: SYXK2011-0036).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The research for this study was performed in the Institute of Sheep and Goat Science, and we thank all members of the laboratory for experimental suggestions. In addition, we thank the High-Performance Computing Platform of Bioinformatics Center, Nanjing Agricultural University for the data analysis support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Pathak, U.I.; Gabrielsen, J.S.; Lipshultz, L.I. Cutting-edge evaluation of male infertility. Urol. Clin. N. Am. 2020, 47, 129–138. [Google Scholar] [CrossRef] [Scilit]
  2. Inhorn, M.C.; Patrizio, P. Infertility around the globe: New thinking on gender, reproductive technologies and global movements in the 21st century. Hum. Reprod. Update 2015, 21, 411–426. [Google Scholar] [CrossRef] [Scilit]
  3. Stukenborg, J.-B.; Kjartansdóttir, K.R.; Reda, A.; Colon, E.; Albersmeier, J.P.; Söder, O. Male germ cell development in humans. Horm. Res. Paediatr. 2014, 81, 2–12. [Google Scholar] [CrossRef] [Scilit]
  4. Li, L.; Yang, R.; Yin, C.; Kee, K. Studying human reproductive biology through single-cell analysis and in vitro differentiation of stem cells into germ cell-like cells. Hum. Reprod. Update 2020, 26, 670–688. [Google Scholar] [CrossRef] [Scilit]
  5. Zhao, N.; Sheng, M.; Wang, X.; Li, Y.; Farzaneh, M. Differentiation of human induced pluripotent stem cells into male germ cells. Curr. Stem Cell Res. Ther. 2021, 16, 622–629. [Google Scholar] [CrossRef] [Scilit]
  6. Sakai, Y.; Nakamura, T.; Okamoto, I.; Gyobu-Motani, S.; Ohta, H.; Yabuta, Y.; Tsukiyama, T.; Iwatani, C.; Tsuchiya, H.; Ema, M.; et al. Induction of the germ cell fate from pluripotent stem cells in cynomolgus monkeys. Biol. Reprod. 2020, 102, 620–638. [Google Scholar] [CrossRef] [Scilit]
  7. Zhou, Q.; Wang, M.; Yuan, Y.; Wang, X.; Fu, R.; Wan, H.; Xie, M.; Liu, M.; Guo, X.; Zheng, Y.; et al. Complete meiosis from embryonic stem cell-derived germ cells in vitro. Cell Stem Cell 2016, 18, 330–340. [Google Scholar] [CrossRef] [Scilit]
  8. Yu, Z.; Ji, P.; Cao, J.; Zhu, S.; Li, Y.; Zheng, L.; Chen, X.; Feng, L. Dazl promotes germ cell differentiation from embryonic stem cells. J. Mol. Cell Biol. 2009, 1, 93–103. [Google Scholar] [CrossRef] [Scilit]
  9. Wang, M.; Liu, X.; Chang, G.; Chen, Y.; An, G.; Yan, L.; Gao, S.; Xu, Y.; Cui, Y.; Dong, J.; et al. Single-cell RNA sequencing analysis reveals sequential cell fate transition during human spermatogenesis. Cell Stem Cell 2018, 23, 599–614. [Google Scholar] [CrossRef] [Scilit]
  10. Hermann, B.P.; Cheng, K.; Singh, A.; Roa-De La Cruz, L.; Mutoji, K.N.; Chen, I.C.; Gildersleeve, H.; Lehle, J.D.; Mayo, M.; Westernströer, B.; et al. The mammalian spermatogenesis single-cell transcriptome, from spermatogonial stem cells to spermatids. Cell Rep. 2018, 25, 1650–1667. [Google Scholar] [CrossRef] [Scilit]
  11. Yang, H.; Ma, J.; Wan, Z.; Wang, Q.; Wang, Z.; Zhao, J.; Wang, F.; Zhang, Y. Characterization of sheep spermatogenesis through single-cell rna sequencing. FASEB J. 2021, 35, e21187. [Google Scholar] [CrossRef] [Scilit]
  12. Zuo, Q.; Jin, K.; Wang, M.; Zhang, Y.; Chen, G.; Li, B. BMP4 activates the Wnt-Lin28A-Blimp1-Wnt pathway to promote primordial germ cell formation via altering H3K4me2. J. Cell Sci. 2021, 134, jcs249375. [Google Scholar] [CrossRef] [Scilit]
  13. Zuo, Q.; Jing, J.; Zhou, J.; Zhang, Y.; Wei, W.; Chen, G.; Li, B. Dual regulatory actions of LncBMP4 on BMP4 promote chicken primordial germ cell formation. EMBO Rep. 2021, 23, e52491. [Google Scholar] [CrossRef] [Scilit]
  14. Yuan, Z.; Luo, J.; Wang, L.; Li, F.; Li, W.; Yue, X. Expression of DAZL gene in selected tissues and association of its polymorphisms with testicular size in Hu sheep. Animals 2020, 10, 740. [Google Scholar] [CrossRef] [Scilit]
  15. Li, T.; Wang, X.; Zhang, H.; Chen, H.; Liu, N.; Xue, R.; Zhao, X.; Ma, Y. Gene expression patterns and protein cellular localization suggest a novel role for DAZL in developing Tibetan sheep testes. Gene 2020, 731, 144335. [Google Scholar] [CrossRef] [Scilit]
  16. Zhao, J.; Yang, H.; Deng, M.; Ma, J.; Wang, Z.; Meng, F.; Wang, F.; Zhang, Y.-L. Expression pattern and potential role of Nanos3 in regulating testosterone biosynthesis in Leydig cells of sheep. Theriogenology 2020, 154, 31–42. [Google Scholar]
  17. Sun, J.; Lin, Y.; Wu, J. Long non-coding RNA expression profiling of mouse testis during postnatal development. PLoS ONE 2013, 8, e75750. [Google Scholar] [CrossRef] [Scilit]
  18. Li, P.-Z.; Yan, G.-Y.; Han, L.; Pang, J.; Zhong, B.-S.; Zhang, G.-M.; Wang, F.; Zhang, Y.-L. Overexpression of STRA8, BOULE, and DAZL genes promotes goat bone marrow-derived mesenchymal stem cells in vitro transdifferentiation toward putative male germ cells. Reprod. Sci. 2017, 24, 300–312. [Google Scholar] [CrossRef] [Scilit]
  19. Zhang, Y.-L.; Li, P.-Z.; Pang, J.; Wan, Y.-J.; Zhang, G.-M.; Fan, Y.-X.; Wang, Z.-Y.; Tao, N.-H.; Wang, F. Induction of goat bone marrow mesenchymal stem cells into putative male germ cells using mRNA for STRA8, BOULE and DAZL. Cytotechnology 2019, 71, 563–572. [Google Scholar]
  20. Li, B.; Liu, W.; Zhuang, M.; Li, N.; Wu, S.; Pan, S.; Hua, J. Overexpression of CD61 promotes hUC-MSC differentiation into male germ-like cells. Cell Prolif. 2016, 49, 36–47. [Google Scholar]
  21. Zhang, M.; Ji, J.; Wang, X.; Zhang, X.; Zhang, Y.; Li, Y.; Wang, X.; Li, X.; Ban, Q.; Ye, S.-D. The transcription factor Tfcp2l1 promotes primordial germ cell-like cell specification of pluripotent stem cells. J. Biol. Chem. 2021, 297, 101217. [Google Scholar] [CrossRef] [Scilit]
  22. Panula, S.; Medrano, J.V.; Kee, K.; Bergström, R.; Nguyen, H.N.; Byers, B.; Wilson, K.D.; Wu, J.C.; Simon, C.; Hovatta, O.; et al. Human germ cell differentiation from fetal- and adult-derived induced pluripotent stem cells. Hum. Mol. Genet. 2011, 20, 752–762. [Google Scholar] [CrossRef] [Scilit]
  23. Kee, K.; Angeles, V.T.; Flores, M.; Nguyen, H.N.; Reijo Pera, R.A. Human DAZL, DAZ and BOULE genes modulate primordial germ-cell and haploid gamete formation. Nature 2009, 462, 222–225. [Google Scholar] [CrossRef] [Scilit]
  24. Nayernia, K.; Nolte, J.; Michelmann, H.W.; Lee, J.H.; Rathsack, K.; Drusenheimer, N.; Dev, A.; Wulf, G.; Ehrmann, I.E.; Elliott, D.J.; et al. In vitro-differentiated embryonic stem cells give rise to male gametes that can generate offspring mice. Dev. Cell 2006, 11, 125–132. [Google Scholar] [CrossRef] [Scilit]
  25. Murakami, K.; Günesdogan, U.; Zylicz, J.J.; Tang, W.W.C.; Sengupta, R.; Kobayashi, T.; Kim, S.; Butler, R.; Dietmann, S.; Surani, M.A. NANOG alone induces germ cells in primed epiblast in vitro by activation of enhancers. Nature 2016, 529, 403–407. [Google Scholar] [CrossRef] [Scilit]
  26. Yang, S.; Yuan, Q.; Niu, M.; Hou, J.; Zhu, Z.; Sun, M.; Li, Z.; He, Z. BMP4 promotes mouse iPS cell differentiation to male germ cells via Smad1/5, Gata4, Id1 and Id2. Reproduction 2017, 153, 211–220. [Google Scholar] [CrossRef] [Scilit]
  27. Makoolati, Z.; Movahedin, M.; Forouzandeh-Moghadam, M. Bone morphogenetic protein 4 is an efficient inducer for mouse embryonic stem cell differentiation into primordial germ cell. In Vitro Cell Dev. Biol. Anim. 2011, 47, 391–398. [Google Scholar] [CrossRef] [Scilit]
  28. Makoolati, Z.; Movahedin, M.; Forouzandeh-Moghadam, M.; Naghdi, M.; Koruji, M. Embryonic stem cell derived germ cells induce spermatogenesis after transplantation into the testes of an adult mouse azoospermia model. Clin. Sci. 2017, 131, 2381–2395. [Google Scholar] [CrossRef] [Scilit]
  29. Pellegrini, M.; Grimaldi, P.; Rossi, P.; Geremia, R.; Dolci, S. Developmental expression of BMP4/ALK3/SMAD5 signaling pathway in the mouse testis: A potential role of BMP4 in spermatogonia differentiation. J. Cell Sci. 2003, 116, 3363–3372. [Google Scholar] [CrossRef] [Scilit]
  30. Hu, J.; Chen, Y.-X.; Wang, D.; Qi, X.; Li, T.-G.; Hao, J.; Mishina, Y.; Garbers, D.L.; Zhao, G.-Q. Developmental expression and function of Bmp4 in spermatogenesis and in maintaining epididymal integrity. Dev. Biol. 2004, 276, 158–171. [Google Scholar] [CrossRef] [Scilit]
  31. Julaton, V.T.A.; Reijo Pera, R.A. NANOS3 function in human germ cell development. Hum. Mol. Genet. 2011, 20, 2238–2250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Lee, M.-H.; Lin, C.-C.; Thomas, J.L.; Li, J.-A.; Lin, H.-Y. Cellular reprogramming with multigene activation by the delivery of CRISPR/dCas9 ribonucleoproteins via magnetic peptide-imprinted chitosan nanoparticles. Mater. Today Bio 2021, 9, 100091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Agne, M.; Blank, I.; Emhardt, A.J.; Gäbelein, C.G.; Gawlas, F.; Gillich, N.; Gonschorek, P.; Juretschke, T.J.; Krämer, S.D.; Louis, N.; et al. Modularized CRISPR/dCas9 effector toolkit for target-specific gene regulation. ACS Synth. Biol. 2014, 3, 986–989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Huang, H.; Zhong, L.; Zhou, J.; Hou, Y.; Zhang, Z.; Xing, X.; Sun, J. Leydig-like cells derived from reprogrammed human foreskin fibroblasts by CRISPR/dCas9 increase the level of serum testosterone in castrated male rats. J. Cell. Mol. Med. 2020, 24, 3971–3981. [Google Scholar] [CrossRef] [Scilit]
  35. Shi, L.; Song, R.; Yao, X.; Ren, Y. Effects of selenium on the proliferation, apoptosis and testosterone production of sheep Leydig cells in vitro. Theriogenology 2017, 93, 24–32. [Google Scholar] [CrossRef] [Scilit]
  36. Wen, L.; Liu, Q.; Xu, J.; Liu, X.; Shi, C.; Yang, Z.; Zhang, Y.; Xu, H.; Liu, J.; Yang, H.; et al. Recent advances in mammalian reproductive biology. Sci. China Life Sci. 2020, 63, 18–58. [Google Scholar] [CrossRef] [Scilit]
  37. Park, S.; Shimada, K.; Fujihara, Y.; Xu, Z.; Shimada, K.; Larasati, T.; Pratiwi, P.; Matzuk, R.M.; Devlin, D.J.; Yu, Z.; et al. CRISPR/Cas9-mediated genome-edited mice reveal 10 testis-enriched genes are dispensable for male fecundity. Biol. Reprod. 2020, 103, 195–204. [Google Scholar] [CrossRef] [Scilit]
  38. Lu, Y.; Oura, S.; Matsumura, T.; Oji, A.; Sakurai, N.; Fujihara, Y.; Shimada, K.; Miyata, H.; Tobita, T.; Noda, T.; et al. CCRISPR/Cas9-mediated genome editing reveals 30 testis-enriched genes dispensable for male fertility in mice. Biol. Reprod. 2019, 101, 501–511. [Google Scholar] [CrossRef] [Scilit]
  39. Tan, K.; Wilkinson, M.F. A single-cell view of spermatogonial stem cells. Curr. Opin. Cell Biol. 2020, 67, 71–78. [Google Scholar] [CrossRef] [Scilit]
  40. Wen, L.; Tang, F. Human germline cell development: From the perspective of single-cell sequencing. Mol. Cell 2019, 76, 320–328. [Google Scholar] [CrossRef] [Scilit]
  41. Suzuki, S.; Diaz, V.D.; Hermann, B.P. What has single-cell RNA-seq taught us about mammalian spermatogenesis? Biol. Reprod. 2019, 101, 617–634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Rossi, P.; Dolci, S. Paracrine mechanisms involved in the control of early stages of Mammalian spermatogenesis. Front. Endocrinol. 2013, 4, 181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Khanehzad, M.; Abbaszadeh, R.; Holakuyee, M.; Modarressi, M.H.; Nourashrafeddin, S.M. FSH regulates RA signaling to commit spermatogonia into differentiation pathway and meiosis. Reprod. Biol. Endocrinol. 2021, 19, 4. [Google Scholar] [CrossRef] [Scilit]
  44. Fu, X.-F.; Cheng, S.-F.; Wang, L.-Q.; Yin, S.; De Felici, M.; Shen, W. DAZ family proteins, key players for germ cell development. Int. J. Biol. Sci. 2015, 11, 1226–1235. [Google Scholar] [CrossRef] [Scilit]
  45. Niu, Z.; Hu, Y.; Liao, M.; Yu, M.; Zhu, H.; Wang, L.; Wu, J.; Bai, C.; Li, G.; Hua, J. Conservation and function of Dazl in promoting the meiosis of goat male germline stem cells. Mol. Biol. Rep. 2014, 41, 2697–2707. [Google Scholar] [CrossRef] [Scilit]
  46. Suzuki, H.; Tsuda, M.; Kiso, M.; Saga, Y. Nanos3 maintains the germ cell lineage in the mouse by suppressing both Bax-dependent and -independent apoptotic pathways. Dev. Biol. 2008, 318, 133–142. [Google Scholar] [CrossRef] [Scilit]
  47. Han, K.; Chen, S.; Cai, M.; Jiang, Y.; Zhang, Z.; Wang, Y. Nanos3 not nanos1 and nanos2 is a germ cell marker gene in large yellow croaker during embryogenesis. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2018, 218, 13–22. [Google Scholar] [CrossRef] [Scilit]
  48. Lolicato, F.; Marino, R.; Paronetto, M.P.; Pellegrini, M.; Dolci, S.; Geremia, R.; Grimaldi, P. Potential role of Nanos3 in maintaining the undifferentiated spermatogonia population. Dev. Biol. 2008, 313, 725–738. [Google Scholar] [CrossRef] [Scilit]
  49. Fraune, J.; Alsheimer, M.; Redolfi, J.; Brochier-Armanet, C.; Benavente, R. Protein SYCP2 is an ancient component of the metazoan synaptonemal complex. Cytogenet. Genome Res. 2014, 144, 299–305. [Google Scholar] [CrossRef] [Scilit]
  50. Yoshimatsu, S.; Sato, T.; Yamamoto, M.; Sasaki, E.; Nakajima, M.; Nakamura, M.; Shiozawa, S.; Noce, T.; Okano, H. Generation of a male common marmoset embryonic stem cell line DSY127-BV8VT1 carrying double reporters specific for the germ cell linage using the CRISPR-Cas9 and PiggyBac transposase systems. Stem Cell Res. 2020, 44, 101740. [Google Scholar] [CrossRef] [Scilit]
  51. Mulder, C.L.; Zheng, Y.; Jan, S.Z.; Struijk, R.B.; Repping, S.; Hamer, G.; van Pelt, A.M.M. Spermatogonial stem cell autotransplantation and germline genomic editing: A future cure for spermatogenic failure and prevention of transmission of genomic diseases. Hum. Reprod. Update 2016, 22, 561–573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Zuo, Q.; Jin, K.; Wang, Y.; Song, J.; Zhang, Y.; Li, B. CRISPR/Cas9-mediated deletion of C1EIS inhibits chicken embryonic stem cell differentiation into male germ cells (Gallus gallus). J. Cell. Biochem. 2017, 118, 2380–2386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Zhang, Y.; Wang, Y.; Zuo, Q.; Li, D.; Zhang, W.; Wang, F.; Ji, Y.; Jin, J.; Lu, Z.; Wang, M.; et al. CRISPR/Cas9 mediated chicken Stra8 gene knockout and inhibition of male germ cell differentiation. PLoS ONE 2017, 12, e0172207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Liu, Z.; Liao, Z.; Chen, Y.; Han, L.; Yin, Q.; Xiao, H. Application of various delivery methods for CRISPR/dCas9. Mol. Biotechnol. 2020, 62, 355–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Hsu, M.-N.; Chang, Y.-H.; Truong, V.A.; Lai, P.-L.; Nguyen, T.K.N.; Hu, Y.-C. CRISPR technologies for stem cell engineering and regenerative medicine. Biotechnol. Adv. 2019, 37, 107447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. qPCR analysis of mRNA expression of bmp4, dazl, nanos3 and sycp2 in different tissues of sheep. The expression of bmp4, dazl, nanos3 and sycp2 in whole sheep tissues was analyzed using qPCR. The results were expressed relative to the heart tissue as mean values ± the SEM. Different letters represent significant differences between groups, p < 0.05.
Figure 1. qPCR analysis of mRNA expression of bmp4, dazl, nanos3 and sycp2 in different tissues of sheep. The expression of bmp4, dazl, nanos3 and sycp2 in whole sheep tissues was analyzed using qPCR. The results were expressed relative to the heart tissue as mean values ± the SEM. Different letters represent significant differences between groups, p < 0.05.
Biology 11 00289 g001
Figure 2. The expression levels of bmp4, dazl, nanos3 and sycp2 in sheep testicular development. (A,B) represent the mRNA and protein expression levels of bmp4, dazl, nanos3 and sycp2 in the 3M and 9M group using qPCR and Western blot, respectively. qPCR results were expressed relative to the 3M group as mean values ± the SEM. *** indicates extremely significant differences between groups (p < 0.001); 3M and 9M refer to 3-month-old and 9-month-old testis tissues of sheep, respectively.
Figure 2. The expression levels of bmp4, dazl, nanos3 and sycp2 in sheep testicular development. (A,B) represent the mRNA and protein expression levels of bmp4, dazl, nanos3 and sycp2 in the 3M and 9M group using qPCR and Western blot, respectively. qPCR results were expressed relative to the 3M group as mean values ± the SEM. *** indicates extremely significant differences between groups (p < 0.001); 3M and 9M refer to 3-month-old and 9-month-old testis tissues of sheep, respectively.
Biology 11 00289 g002
Figure 3. The expression location of Bmp4, Dazl, Nanos3 and Sycp2 in 3M and 9M sheep testis tissues. Immunohistochemistry was performed to detect the expression location of the four genes in sheep testis tissues. The staining results were observed under a microscope at a magnification of 40×. Control presented the negative staining; Bmp4, Dazl, Nanos3 and Sycp2 presented the positive staining. Blue and brown represented nuclear and gene positive staining, respectively. The terms 3M and 9M refer to the 3-month-old and 9-month-old testis tissues of sheep, respectively.
Figure 3. The expression location of Bmp4, Dazl, Nanos3 and Sycp2 in 3M and 9M sheep testis tissues. Immunohistochemistry was performed to detect the expression location of the four genes in sheep testis tissues. The staining results were observed under a microscope at a magnification of 40×. Control presented the negative staining; Bmp4, Dazl, Nanos3 and Sycp2 presented the positive staining. Blue and brown represented nuclear and gene positive staining, respectively. The terms 3M and 9M refer to the 3-month-old and 9-month-old testis tissues of sheep, respectively.
Biology 11 00289 g003
Figure 4. The expression location of Bmp4, Dazl, Nanos3 and Sycp2 in sheep Leydig cells. To locate the expression of Bmp4, Dazl, Nanos3 and Sycp2 in sheep Leydig cells, immunofluorescence was carried out. DAPI indicated the nuclear staining, and the results were photographed under a laser scanning confocal microscope at a magnification of 40×.
Figure 4. The expression location of Bmp4, Dazl, Nanos3 and Sycp2 in sheep Leydig cells. To locate the expression of Bmp4, Dazl, Nanos3 and Sycp2 in sheep Leydig cells, immunofluorescence was carried out. DAPI indicated the nuclear staining, and the results were photographed under a laser scanning confocal microscope at a magnification of 40×.
Biology 11 00289 g004
Figure 5. Overexpression of bmp4, dazl, nanos3 and sycp2 in sheep fibroblasts. To overexpress the candidate genes bmp4, dazl, nanos3 and sycp2, sgRNAs were designed and transfected in sheep ear fibroblasts. The transfection efficiency was proven by the qPCR experiment, and the results were expressed relative to the control group (NC) as mean values ± the SEM. Different letters mean significant differences between groups (p < 0.05).
Figure 5. Overexpression of bmp4, dazl, nanos3 and sycp2 in sheep fibroblasts. To overexpress the candidate genes bmp4, dazl, nanos3 and sycp2, sgRNAs were designed and transfected in sheep ear fibroblasts. The transfection efficiency was proven by the qPCR experiment, and the results were expressed relative to the control group (NC) as mean values ± the SEM. Different letters mean significant differences between groups (p < 0.05).
Biology 11 00289 g005
Figure 6. Germ cell related gene expression changes after the overexpression of bmp4, dazl, nanos3 and sycp2 in sheep Leydig cells. Western blot analysis was performed to determine the overexpression efficiency of CRISPR/dcas9 system in vitro. C, B, D, N, S, and + represent the control, bmp4, dazl, nanos3, sycp2 and mix of four gene groups, respectively. The results were expressed relative to the control group C as mean values ± the SEM. Different letters mean significant differences between groups (p < 0.05).
Figure 6. Germ cell related gene expression changes after the overexpression of bmp4, dazl, nanos3 and sycp2 in sheep Leydig cells. Western blot analysis was performed to determine the overexpression efficiency of CRISPR/dcas9 system in vitro. C, B, D, N, S, and + represent the control, bmp4, dazl, nanos3, sycp2 and mix of four gene groups, respectively. The results were expressed relative to the control group C as mean values ± the SEM. Different letters mean significant differences between groups (p < 0.05).
Biology 11 00289 g006
Table 1. Primer sequences of genes.
Table 1. Primer sequences of genes.
Primer NamePrimer SequenceProduct Length/bp
gapdhF: GTCAAGGCAGAGAACGGGAA
R: GGTTCACGCCCATCACAAAC232
bmp4F: CACCTCCATCAGACACGGAC
R: CCAGTCATTCCAGCCCACAT258
dazlF: GAGACTCCAAACTCAGCCGT
R: TAGCCTTTGGACACACCAGT227
nanos3F: GACCTTCAACCTGTGGACAGAC
R: CGGTTCTGGCACTGCTTCT258
sycp2F: TTGGAAAGGGCACAACCAAG
R: TGCTCTTCGTGGAAGTCTGG105
Table 2. The antibodies information for western blot.
Table 2. The antibodies information for western blot.
Antibody NameCatalog No.DilutionSource
GapdhProteintech-1E6D91:10,000Mouse
Bmp4Affinity-DF64611:500Rabbit
DazlAbcam-ab2157181:1000Rabbit
Nanos3Abcam-ab700011:500Rabbit
Sycp2Affinity-DF25781:500Rabbit
Table 3. sgRNA sequences of four genes.
Table 3. sgRNA sequences of four genes.
Gene NamesgRNA Sequence
bmp4Target 1: TTTCACCGCCCGCCTCGGGG
Target 2: TATGAGTCACGTGAGCGCAG
Target 3: CTCTGGATGGCACTACGGAA
dazlTarget 1: TCAGCGTCCCGGCCACCCCA
Target 2: GCCGCGCTTGCCTGTCCTGG
nanos3Target 1: TCTTGGAGGACCGGCTTAGG
Target 2: GCTCTAGAGGGAGGGTCCTA
sycp2Target 1: AGTAATAAAGACTTTCTCCT
Target 2: TGAATGAAGTTCCAATTCCA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yang, H.; Deng, M.; Lv, W.; Wei, Z.; Cai, Y.; Cheng, P.; Wang, F.; Zhang, Y. Overexpression of bmp4, dazl, nanos3 and sycp2 in Hu Sheep Leydig Cells Using CRISPR/dcas9 System Promoted Male Germ Cell Related Gene Expression. Biology 2022, 11, 289. https://doi.org/10.3390/biology11020289

AMA Style

Yang H, Deng M, Lv W, Wei Z, Cai Y, Cheng P, Wang F, Zhang Y. Overexpression of bmp4, dazl, nanos3 and sycp2 in Hu Sheep Leydig Cells Using CRISPR/dcas9 System Promoted Male Germ Cell Related Gene Expression. Biology. 2022; 11(2):289. https://doi.org/10.3390/biology11020289

Chicago/Turabian Style

Yang, Hua, Mingtian Deng, Wenli Lv, Zongyou Wei, Yu Cai, Peiyong Cheng, Feng Wang, and Yanli Zhang. 2022. "Overexpression of bmp4, dazl, nanos3 and sycp2 in Hu Sheep Leydig Cells Using CRISPR/dcas9 System Promoted Male Germ Cell Related Gene Expression" Biology 11, no. 2: 289. https://doi.org/10.3390/biology11020289

APA Style

Yang, H., Deng, M., Lv, W., Wei, Z., Cai, Y., Cheng, P., Wang, F., & Zhang, Y. (2022). Overexpression of bmp4, dazl, nanos3 and sycp2 in Hu Sheep Leydig Cells Using CRISPR/dcas9 System Promoted Male Germ Cell Related Gene Expression. Biology, 11(2), 289. https://doi.org/10.3390/biology11020289

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop