Antibiotic Resistance in Lactic Acid Bacteria from Dairy Products in Northern Italy
Abstract
1. Introduction
2. Results
2.1. Strain Isolation and Identification
2.2. In Vitro Antimicrobial Susceptibility Testing
2.3. PCR Analysis
2.4. Agreement Between Antimicrobial Susceptibility Testing and Resistance Genotyping
3. Discussion
4. Materials and Methods
4.1. Dairy Samples
4.2. Strain Isolation and Identification
4.3. In Vitro Antimicrobial Susceptibility Testing
4.4. PCR Analysis
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Aslam, B.; Khurshid, M.; Arshad, M.I.; Muzammil, S.; Rasool, M.; Yasmeen, N.; Shah, T.; Chaudhry, T.H.; Rasool, M.H.; Shahid, A.; et al. Antibiotic Resistance: One Health One World Outlook. Front. Cell. Infect. Microbiol. 2021, 11, 771510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, H.; Ozogul, F.; Bartkiene, E.; Rocha, J.M. Impact of Lactic Acid Bacteria and Their Metabolites on the Techno-Functional Properties and Health Benefits of Fermented Dairy Products. Crit. Rev. Food Sci. Nutr. 2023, 63, 4819–4841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ağagündüz, D.; Şahin, T.Ö.; Ayten, Ş.; Yılmaz, B.; Güneşliol, B.E.; Russo, P.; Spano, G.; Özogul, F. Lactic acid bacteria as pro-technological, bioprotective and health-promoting cultures in the dairy food industry. Food Biosci. 2022, 47, 101617. [Google Scholar] [CrossRef] [Scilit]
- Zheng, X.; Shi, X.; Wang, B. A Review on the General Cheese Processing Technology, Flavor Biochemical Pathways and the Influence of Yeasts in Cheese. Front. Microbiol. 2021, 12, 703284. [Google Scholar] [CrossRef] [Scilit]
- Parente, E.; Ricciardi, A.; Zotta, T. The Microbiota of Dairy Milk: A Review. Int. Dairy J. 2020, 107, 104714. [Google Scholar] [CrossRef] [Scilit]
- Rama, G.R.; Bucker, F.; Salazar, M.M.; Ray, S.; Granada, C.E. Lactic Acid Bacteria: Taxonomy, Characteristic Features, Physiology, and Diversity. In Antimicrobial Peptides from Lactic Acid Bacteria; Ray, S., Kumar, P., Mandal, M., Eds.; Springer Nature: Singapore, 2024; pp. 1–32. ISBN 978-981-9734-12-2. [Google Scholar]
- Coelho, M.C.; Malcata, F.X.; Silva, C.C.G. Lactic Acid Bacteria in Raw-Milk Cheeses: From Starter Cultures to Probiotic Functions. Foods 2022, 11, 2276. [Google Scholar] [CrossRef] [Scilit]
- Ayivi, R.D.; Gyawali, R.; Krastanov, A.; Aljaloud, S.O.; Worku, M.; Tahergorabi, R.; Silva, R.C.d.; Ibrahim, S.A. Lactic Acid Bacteria: Food Safety and Human Health Applications. Dairy 2020, 1, 202–232. [Google Scholar] [CrossRef] [Scilit]
- Vinayamohan, P.G.; Pellissery, A.J.; Venkitanarayanan, K. Role of horizontal gene transfer in the dissemination of antimicrobial resistance in food animal production. Curr. Opin. Food Sci. 2022, 47, 100882. [Google Scholar] [CrossRef] [Scilit]
- Michaelis, C.; Grohmann, E. Horizontal Gene Transfer of Antibiotic Resistance Genes in Biofilms. Antibiotics 2023, 12, 328. [Google Scholar] [CrossRef] [Scilit]
- Bhat, B.A.; Mir, R.A.; Qadri, H.; Dhiman, R.; Almilaibary, A.; Alkhanani, M.; Mir, M.A. Integrons in the development of antimicrobial resistance: Critical review and perspectives. Front. Microbiol. 2023, 14, 1231938. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Wu, Y.; Shao, J.; Shi, J.; Sun, L.; Hong, Y.; Wang, X. Stresses in the food chain and their impact on antibiotic resistance of foodborne pathogens: A review. Food Microbiol. 2025, 128, 104741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galgano, M.; Pellegrini, F.; Catalano, E.; Capozzi, L.; Del Sambro, L.; Sposato, A.; Lucente, M.S.; Vasinioti, V.I.; Catella, C.; Odigie, A.E.; et al. Acquired Bacterial Resistance to Antibiotics and Resistance Genes: From Past to Future. Antibiotics 2025, 14, 222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haubert, L.; Cunha, C.E.P.D.; Lopes, G.V.; Silva, W.P.D. Food isolate Listeria monocytogenes harboring tetM gene plasmid-mediated exchangeable to Enterococcus faecalis on the surface of processed cheese. Food Res. Int. 2018, 107, 503–508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miranda, C.; Contente, D.; Igrejas, G.; Câmara, S.P.A.; Dapkevicius, M.d.L.E.; Poeta, P. Role of Exposure to Lactic Acid Bacteria from Foods of Animal Origin in Human Health. Foods 2021, 10, 2092. [Google Scholar] [CrossRef] [Scilit]
- Moradi, J.; Fathollahi, M.; Halimi, S.; Alvandi, A.; Abiri, R.; Vaziri, S.; Rezaei, A. Characterization of the resistome in Lactobacillus genomic sequences from the human gut. J. Glob. Antimicrob. Resist. 2022, 30, 451–458. [Google Scholar] [CrossRef] [Scilit]
- Chaves, C.R.S.; Salamandane, A.; Vieira, E.J.F.; Salamandane, C. Antibiotic Resistance in Fermented Foods Chain: Evaluating the Risks of Emergence of Enterococci as an Emerging Pathogen in Raw Milk Cheese. Int. J. Microbiol. 2024, 2024, 2409270. [Google Scholar] [CrossRef] [Scilit]
- Samtiya, M.; Matthews, K.R.; Dhewa, T.; Puniya, A.K. Antimicrobial Resistance in the Food Chain: Trends, Mechanisms, Pathways, and Possible Regulation Strategies. Foods 2022, 11, 2966. [Google Scholar] [CrossRef] [Scilit]
- CLSI. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria, 3rd ed.; CLSI Guideline M45; Wayne, P.A., Ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2015. [Google Scholar]
- EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP). Guidance on the Assessment of Bacterial Susceptibility to Antimicrobials of Human and Veterinary Importance. EFSA J. 2012, 10, 2740. [Google Scholar] [CrossRef] [Scilit]
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 14.0; The European Committee on Antimicrobial Susceptibility Testing: Växjö, Sweden, 2024; Available online: http://www.eucast.org (accessed on 10 February 2025).
- European Parliament and the Council of the European Union. Commission Regulation (EU) No 37/2010. Off. J. Eur. Union. 2010, L15, 1–72. [Google Scholar]
- Murphy, S.C.; Martin, N.H.; Barbano, D.M.; Wiedmann, M. Influence of Raw Milk Quality on Processed Dairy Products: How Do Raw Milk Quality Test Results Relate to Product Quality and Yield? J. Dairy Sci. 2016, 99, 10128–10149. [Google Scholar] [CrossRef] [Scilit]
- Sharun, K.; Dhama, K.; Tiwari, R.; Gugjoo, M.B.; Iqbal Yatoo, M.; Patel, S.K.; Pathak, M.; Karthik, K.; Khurana, S.K.; Singh, R.; et al. Advances in Therapeutic and Managemental Approaches of Bovine Mastitis: A Comprehensive Review. Vet. Q. 2021, 41, 107–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, L.; Meng, L.; Liu, H.; Wu, H.; Schroyen, M.; Zheng, N.; Wang, J. Effect of Cephalosporin Treatment on the Microbiota and Antibiotic Resistance Genes in Feces of Dairy Cows with Clinical Mastitis. Antibiotics 2022, 11, 117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashraf, A.; Imran, M. Causes, Types, Etiological Agents, Prevalence, Diagnosis, Treatment, Prevention, Effects on Human Health and Future Aspects of Bovine Mastitis. Anim. Health Res. Rev. 2020, 21, 36–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, C.; Rokana, N.; Chandra, M.; Singh, B.P.; Gulhane, R.D.; Gill, J.P.S.; Ray, P.; Puniya, A.K.; Panwar, H. Antimicrobial Resistance: Its Surveillance, Impact, and Alternative Management Strategies in Dairy Animals. Front. Vet. Sci. 2018, 4, 237. [Google Scholar] [CrossRef] [Scilit]
- Crits-Christoph, A.; Hallowell, H.A.; Koutouvalis, K.; Suez, J. Good Microbes, Bad Genes? The Dissemination of Antimicrobial Resistance in the Human Microbiome. Gut Microbes 2022, 14, 2055944. [Google Scholar] [CrossRef] [Scilit]
- Shahali, A.; Soltani, R.; Akbari, V. Probiotic Lactobacillus and the Potential Risk of Spreading Antibiotic Resistance: A Systematic Review. Res. Pharm. Sci. 2023, 18, 468–477. [Google Scholar] [CrossRef] [Scilit]
- Schjørring, S.; Krogfelt, K.A. Assessment of Bacterial Antibiotic Resistance Transfer in the Gut. Int. J. Microbiol. 2011, 2011, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Jacobsen, L.; Wilcks, A.; Hammer, K.; Huys, G.; Gevers, D.; Andersen, S.R. Horizontal Transfer of Tet(M) and Erm(B) Resistance Plasmids from Food Strains of Lactobacillus Plantarum to Enterococcus Faecalis JH2-2 in the Gastrointestinal Tract of Gnotobiotic Rats: In Vivo Transfer of R-Plasmids from Lactobacillus Plantarum. FEMS Microbiol. Ecol. 2007, 59, 158–166. [Google Scholar] [CrossRef] [Scilit]
- Gevers, D.; Huys, G.; Swings, J. In Vitro Conjugal Transfer of Tetracycline Resistance from Lactobacillus Isolates to Other Gram-Positive Bacteria. FEMS Microbiol. Lett. 2003, 225, 125–130. [Google Scholar] [CrossRef] [Scilit]
- Taye, Y.; Degu, T.; Fesseha, H.; Mathewos, M. Isolation and Identification of Lactic Acid Bacteria from Cow Milk and Milk Products. Sci. World J. 2021, 2021, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Soda, M.; Ahmed, N.; Omran, N.; Osman, G.; Morsi, A. Isolation, Identification and Selection of Lactic Acid Bacteria Cultures for Cheesemaking. Emir. J. Food Agric. 2003, 15, 51–71. [Google Scholar] [CrossRef] [Scilit]
- Corry, J.E.L.; Curtis, G.D.W.; Baird, R.M. (Eds.) Handbook of Culture Media for Food and Water Microbiology, 3rd ed.; RSC Publ: Cambridge, UK, 2012; ISBN 978-1-84755-916-6. [Google Scholar]
- Yu, J.; Wang, W.H.; Menghe, B.L.G.; Jiri, M.T.; Wang, H.M.; Liu, W.J.; Bao, Q.H.; Lu, Q.; Zhang, J.C.; Wang, F.; et al. Diversity of Lactic Acid Bacteria Associated with Traditional Fermented Dairy Products in Mongolia. J. Dairy Sci. 2011, 94, 3229–3241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Terzić-Vidojević, A.; Veljović, K.; Tolinački, M.; Živković, M.; Lukić, J.; Lozo, J.; Fira, Đ.; Jovčić, B.; Strahinić, I.; Begović, J.; et al. Diversity of Non-Starter Lactic Acid Bacteria in Autochthonous Dairy Products from Western Balkan Countries—Technological and Probiotic Properties. Food Res. Int. 2020, 136, 109494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anisimova, E.A.; Yarullina, D.R. Antibiotic Resistance of LACTOBACILLUS Strains. Curr. Microbiol. 2019, 76, 1407–1416. [Google Scholar] [CrossRef] [Scilit]
- Colautti, A.; Arnoldi, M.; Comi, G.; Iacumin, L. Antibiotic Resistance and Virulence Factors in Lactobacilli: Something to Carefully Consider. Food Microbiol. 2022, 103, 103934. [Google Scholar] [CrossRef] [Scilit]
- Toomey, N.; Bolton, D.; Fanning, S. Characterisation and Transferability of Antibiotic Resistance Genes from Lactic Acid Bacteria Isolated from Irish Pork and Beef Abattoirs. Res. Microbiol. 2010, 161, 127–135. [Google Scholar] [CrossRef] [Scilit]
- Danielsen, M.; Wind, A. Susceptibility of Lactobacillus spp. to Antimicrobial Agents. Int. J. Food Microbiol. 2003, 82, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Nunziata, L.; Brasca, M.; Morandi, S.; Silvetti, T. Antibiotic Resistance in Wild and Commercial Non-Enterococcal Lactic Acid Bacteria and Bifidobacteria Strains of Dairy Origin: An Update. Food Microbiol. 2022, 104, 103999. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization (WHO). AWaRe (access, watch, reserve) classification of antibiotics for evaluation and monitoring of use, 2023. In Proceedings of the Selection and Use of Essential Medicines 2023: Executive Summary of the Report of the 24th WHO Expert Committee on the Selection and Use of Essential Medicines, Geneva, Switzerland, 24–28 April 2023. (WHO/MHP/HPS/EML/2023.04). [Google Scholar]
- World Health Organization. WHO List of Medically Important Antimicrobials: A risk Management Tool for Mitigating Antimicrobial Resistance due to Non-Human Use; World Health Organization: Geneva, Switzerland, 2024. [Google Scholar]
- Flórez, A.B.; Delgado, S.; Mayo, B. Antimicrobial Susceptibility of Lactic Acid Bacteria Isolated from a Cheese Environment. Can. J. Microbiol. 2005, 51, 51–58. [Google Scholar] [CrossRef] [Scilit]
- Flórez, A.B.; Campedelli, I.; Delgado, S.; Alegría, Á.; Salvetti, E.; Felis, G.E.; Mayo, B.; Torriani, S. Antibiotic Susceptibility Profiles of Dairy Leuconostoc, Analysis of the Genetic Basis of Atypical Resistances and Transfer of Genes In Vitro and in a Food Matrix. PLoS ONE 2016, 11, e0145203. [Google Scholar] [CrossRef] [Scilit]
- Ojha, A.K.; Shah, N.P.; Mishra, V.; Emanuel, N.; Taneja, N.K. Prevalence of Antibiotic Resistance in Lactic Acid Bacteria Isolated from Traditional Fermented Indian Food Products. Food Sci. Biotechnol. 2023, 32, 2131–2143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morandi, S.; Cremonesi, P.; Silvetti, T.; Brasca, M. Technological Characterisation, Antibiotic Susceptibility and Antimicrobial Activity of Wild-Type Leuconostoc Strains Isolated from North Italian Traditional Cheeses. J. Dairy Res. 2013, 80, 457–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flórez, A.B.; Mayo, B. Antibiotic Resistance-Susceptibility Profiles of Streptococcus Thermophilus Isolated from Raw Milk and Genome Analysis of the Genetic Basis of Acquired Resistances. Front. Microbiol. 2017, 8, 2608. [Google Scholar] [CrossRef] [Scilit]
- Tóth, A.G.; Judge, M.F.; Nagy, S.Á.; Papp, M.; Solymosi, N. A Survey on Antimicrobial Resistance Genes of Frequently Used Probiotic Bacteria, 1901 to 2022. Eurosurveillance 2023, 28, 2200272. [Google Scholar] [CrossRef] [Scilit]
- Deekshit, V.K.; Srikumar, S. ‘To Be, or Not to Be’—The Dilemma of ‘Silent’ Antimicrobial Resistance Genes in Bacteria. J. Appl. Microbiol. 2022, 133, 2902–2914. [Google Scholar] [CrossRef] [Scilit]
- Wagner, T.M.; Howden, B.P.; Sundsfjord, A.; Hegstad, K. Transiently Silent Acquired Antimicrobial Resistance: An Emerging Challenge in Susceptibility Testing. J. Antimicrob. Chemother. 2023, 78, 586–598. [Google Scholar] [CrossRef] [Scilit]
- Lipszyc, A.; Szuplewska, M.; Bartosik, D. How Do Transposable Elements Activate Expression of Transcriptionally Silent Antibiotic Resistance Genes? Int. J. Mol. Sci. 2022, 23, 8063. [Google Scholar] [CrossRef] [Scilit]
- Stasiak, M.; Maćkiw, E.; Kowalska, J.; Kucharek, K.; Postupolski, J. Silent Genes: Antimicrobial Resistance and Antibiotic Production. Pol. J. Microbiol. 2021, 70, 421–429. [Google Scholar] [CrossRef] [Scilit]
- Oliveira, A.S.; Rolo, J.; Gaspar, C.; Cavaleiro, C.; Salgueiro, L.; Palmeira-de-Oliveira, R.; Ferraz, C.; Coelho, S.; Pastorinho, M.R.; Sousa, A.C.; et al. Chemical Characterization and Bioactive Potential of Thymus × Citriodorus (Pers.) Schreb. Preparations for Anti-Acne Applications: Antimicrobial, Anti-Biofilm, Anti-Inflammatory and Safety Profiles. J. Ethnopharmacol. 2022, 287, 114935. [Google Scholar] [CrossRef] [Scilit]
- Schwan, C.L.; Lomonaco, S.; Bastos, L.M.; Cook, P.W.; Maher, J.; Trinetta, V.; Bhullar, M.; Phebus, R.K.; Gragg, S.; Kastner, J.; et al. Genotypic and Phenotypic Characterization of Antimicrobial Resistance Profiles in Non-Typhoidal Salmonella Enterica Strains Isolated From Cambodian Informal Markets. Front. Microbiol. 2021, 12, 711472. [Google Scholar] [CrossRef] [Scilit]
- Casaux, M.L.; D’Alessandro, B.; Vignoli, R.; Fraga, M. Phenotypic and Genotypic Survey of Antibiotic Resistance in Salmonella Enterica Isolates from Dairy Farms in Uruguay. Front. Vet. Sci. 2023, 10, 1055432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suzuki, S.; Horinouchi, T.; Furusawa, C. Prediction of Antibiotic Resistance by Gene Expression Profiles. Nat. Commun. 2014, 5, 5792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, J.; Shi, C.; Song, M.; Xu, X.; Yang, P.; Paoli, G.; Shi, X. Phenotypic and Genotypic Antimicrobial Resistance Traits of Foodborne Staphylococcus aureus Isolates from Shanghai. J. Food Sci. 2014, 79, M635–M642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, M.; Satola, S.W.; Read, T.D. Genome-Based Prediction of Bacterial Antibiotic Resistance. J. Clin. Microbiol. 2019, 57, e01405-18. [Google Scholar] [CrossRef] [Scilit]
- Punina, N.V.; Makridakis, N.M.; Remnev, M.A.; Topunov, A.F. Whole-Genome Sequencing Targets Drug-Resistant Bacterial Infections. Hum. Genom. 2015, 9, 19. [Google Scholar] [CrossRef] [Scilit]
- Ransom, E.M.; Potter, R.F.; Dantas, G.; Burnham, C.-A.D. Genomic Prediction of Antimicrobial Resistance: Ready or Not, Here It Comes! Clin. Chem. 2020, 66, 1278–1289. [Google Scholar] [CrossRef] [Scilit]
- Martinez, J.L.; Fajardo, A.; Garmendia, L.; Hernandez, A.; Linares, J.F.; Martínez-Solano, L.; Sánchez, M.B. A Global View of Antibiotic Resistance. FEMS Microbiol. Rev. 2009, 33, 44–65. [Google Scholar] [CrossRef] [Scilit]
- Leinyuy, J.F.; Ali, I.M.; Ousenu, K.; Tume, C.B. Molecular Characterization of Antimicrobial Resistance Related Genes in E. coli, Salmonella and Klebsiella Isolates from Broilers in the West Region of Cameroon. PLoS ONE 2023, 18, e0280150. [Google Scholar] [CrossRef] [Scilit]
- Yu, L.; Zhao, Y.; Zhang, S.; Ni, W.; Zhang, L.; Xue, C.; Wang, P.; Zhang, X. Antimicrobial Resistance and Virulence Factors Analysis of a Multidrug-Resistant Acinetobacter Baumannii Isolated from Chickens Using Whole-Genome Sequencing. BMC Microbiol. 2024, 24, 526. [Google Scholar] [CrossRef] [Scilit]
- Song, H.; Yoo, J.S.; Unno, T. Discerning the Dissemination Mechanisms of Antibiotic Resistance Genes through Whole Genome Sequencing of Extended-Spectrum Beta-Lactamase (ESBL)-Producing E. coli Isolated from Veterinary Clinics and Farms in South Korea. Sci. Total Environ. 2024, 926, 172068. [Google Scholar] [CrossRef] [Scilit]
- Parveen, S.; Lukasik, J.; Scott, T.M.; Tamplin, M.L.; Portier, K.M.; Sheperd, S.; Braun, K.; Farrah, S.R. Geographical Variation in Antibiotic Resistance Profiles of Escherichia coli Isolated from Swine, Poultry, Beef and Dairy Cattle Farm Water Retention Ponds in Florida1. J. Appl. Microbiol. 2006, 100, 50–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karzis, J.; Petzer, I.-M.; Donkin, E.F.; Naidoo, V.; Etter, E.M.C. Climatic and Regional Antibiotic Resistance Patterns of Staphylococcus aureus in South African Dairy Herds. Onderstepoort J. Vet. Res. 2019, 86, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.P.; Chang, S.K.; Chou, C.C. Characterization of Bacterial Susceptibility Isolates in Sixteen Dairy Farms in Taiwan. J. Dairy Sci. 2006, 89, 4573–4582. [Google Scholar] [CrossRef] [Scilit]
- Adamski, P.; Byczkowska-Rostkowska, Z.; Gajewska, J.; Zakrzewski, A.J.; Kłębukowska, L. Prevalence and Antibiotic Resistance of Bacillus Sp. Isolated from Raw Milk. Microorganisms 2023, 11, 1065. [Google Scholar] [CrossRef] [Scilit]
- Gołaś-Prądzyńska, M.; Łuszczyńska, M.; Rola, J.G. Dairy Products: A Potential Source of Multidrug-Resistant Enterococcus faecalis and Enterococcus faecium Strains. Foods 2022, 11, 4116. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Zhu, Y.; Jay-Russell, M.; Lemay, D.G.; Mills, D.A. Reservoirs of Antimicrobial Resistance Genes in Retail Raw Milk. Microbiome 2020, 8, 99. [Google Scholar] [CrossRef] [Scilit]
- Farrukh, M.; Munawar, A.; Nawaz, Z.; Hussain, N.; Hafeez, A.B.; Szweda, P. Antibiotic Resistance and Preventive Strategies in Foodborne Pathogenic Bacteria: A Comprehensive Review. Food Sci. Biotechnol. 2025, 1–29. [Google Scholar] [CrossRef] [Scilit]
- Ng, L.-K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the Detection of Tetracycline Resistant Genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [Scilit]
- Fang, H.; Ataker, F.; Hedin, G.; Dornbusch, K. Molecular Epidemiology of Extended-Spectrum β-Lactamases among Escherichia coli Isolates Collected in a Swedish Hospital and Its Associated Health Care Facilities from 2001 to 2006. J. Clin. Microbiol. 2008, 46, 707–712. [Google Scholar] [CrossRef] [Scilit]
- Salah, F.D.; Soubeiga, S.T.; Ouattara, A.K.; Sadji, A.Y.; Metuor-Dabire, A.; Obiri-Yeboah, D.; Banla-Kere, A.; Karou, S.; Simpore, J. Distribution of Quinolone Resistance Gene (Qnr) in ESBL-Producing Escherichia coli and Klebsiella spp. in Lomé, Togo. Antimicrob. Resist. Infect. Control 2019, 8, 104. [Google Scholar] [CrossRef] [Scilit]
- Ghanbari, F.; Ghajavand, H.; Havaei, R.; Jami, M.-S.; Khademi, F.; Heydari, L.; Shahin, M.; Havaei, S. Distribution of Erm Genes among Staphylococcus aureus Isolates with Inducible Resistance to Clindamycin in Isfahan, Iran. Adv. Biomed. Res. 2016, 5, 62. [Google Scholar] [CrossRef] [Scilit]
- QIAxcel Advanced User Manual. Available online: https://www.qiagen.com/us/resources/resourcedetail?id=e3edf734-1e5a-4ebf-957e-a35e120d6290&lang=en (accessed on 3 February 2025).
- StataCorp. Stata Statistical Software: Release 17; StataCorp LLC: College Station, TX, USA, 2021. [Google Scholar]

| ID | LAB Strain | Sample Type | AMP 1 | CHL 2 | CLI 1 | DAP1 | ERY 1 | GEN 2 | KAN 2 | LZD 1 | PEN 1 | STR 2 | TET 2 | VAN 1 | Antibiotic Resistance Gene |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | L. delbrueckii | Cow milk | S | S | S | S | S | S | S | S | S | S | S | S | tetM |
| 2 | L. fermentum | Cow milk | S | S | S | S | S | S | S | S | S | S | S | R | - |
| 3 | L. curvatus | Goat cheese | S | S | S | S | S | S | S | S | S | S | S | R | - |
| 4 | L. paracasei | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | R | - |
| 5 | L. paracasei | Goat cheese | S | S | S | S | S | S | S | S | S | S | S | R | - |
| 6 | L. plantarum | Cow cheese | S | S | S | S | S | S | S | S | S | / | S | R | - |
| 7 | L. paracasei | Cow cheese | S | S | S | S | S | S | S | S | S | S | R | R | - |
| 8 | L. plantarum | Cow cheese | S | S | S | S | S | S | S | S | S | / | S | R | - |
| 9 | L. brevis | Goat cheese | S | S | S | S | S | S | S | S | S | S | R | R | - |
| 10 | L. paracasei | Cow milk | S | S | S | S | S | S | S | S | S | S | S | R | blaTEM |
| 11 | L. plantarum | Cow cheese | S | S | S | S | S | S | S | S | S | / | R | R | tetK |
| 12 | L. paracasei | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | R | - |
| 13 | L. paracasei | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | R | - |
| 14 | L. paracasei | Cow cheese | S | I | S | S | S | S | S | S | S | S | S | R | blaTEM |
| 15 | L. curvatus | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | R | blaTEM |
| Resistance rate (%) | 20.0 | 93.3 |
| ID | LAB Strain | Sample Type | AMP 1 | CHL 2 | CLI 1 | ERY 1 | GEN 2 | KAN 2 | LEVO 1 | PEN 1 | STR 2 | SXT 1 | TET 1 | VAN 1 | Antibiotic Resistance Genes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | L. lactis | Cow cheese | S | S | S | S | S | S | S | S | S | R | S | S | - |
| 2 | L. lactis | Cow cheese | S | S | S | S | S | S | S | S | S | R | R | S | tetS |
| 3 | L. lactis | Cow curd | S | S | S | S | S | S | S | S | S | R | S | S | tetK |
| 4 | L. lactis | Cow milk | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 5 | L. lactis | Cow curd | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 6 | L. lactis | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 7 | L. lactis | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 8 | L. lactis | Goat cheese | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 9 | L. lactis | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | tetK |
| 10 | L. lactis | Goat cheese | S | S | S | S | S | S | S | S | S | S | S | S | tetK |
| 11 | L. lactis | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | tetK |
| 12 | L. lactis | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | tetM |
| 13 | L. garvieae | Cow cheese | S | / | R | R | / | / | S | S | / | R | S | S | tetB, ermB |
| 14 | L. lactis | Cow milk | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 15 | L. raffinolactis | Cow milk | S | / | S | S | / | / | S | S | / | S | S | S | - |
| 16 | L. lactis | Cow curd | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 17 | L. lactis | Cow milk | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 18 | L. lactis | Cow curd | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 19 | L. lactis | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 20 | L. lactis | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 21 | L. lactis | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 22 | L. garvieae | Cow cheese | S | / | S | R | / | / | S | S | / | R | S | S | tetK, ermB |
| 23 | L. lactis | Cow cheese | S | S | S | R | S | S | S | S | S | S | S | S | tetK, ermA |
| 24 | L. lactis | Cow cheese | S | S | R | R | S | S | S | S | S | S | S | S | ermB |
| Resistance rate (%) | 8.3 | 12.5 | 21.0 | 4.2 |
| ID | LAB Strain | Sample Type | AMP 1 | CHL 1 | CLI 1 | DAP 1 | ERY 1 | GEN 2 | LEVO 1 | LZD 1 | MXF 2 | PEN 1 | RIF 2 | SYN 1 | TET 1 | VAN 1 | Antibiotic Resistance Genes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | S. salivarius spp. thermophilus | Cow curd | S | S | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 2 | S. salivarius spp. thermophilus | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 3 | S. salivarius spp. thermophilus | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 4 | S. equinus | Cow milk | S | S | S | S | S | S | S | S | S | S | S | S | S | S | blaCTX-M, ermB |
| 5 | S. salivarius spp. thermophilus | Cow curd | S | S | S | S | S | S | S | S | S | S | S | S | S | S | tetK, tetL, blaCTX-M |
| 6 | S. salivarius spp. thermophilus | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | S | S | - |
| 7 | S. salivarius spp. thermophilus | Cow cheese | S | S | S | S | S | S | S | S | S | S | S | S | S | S | - |
| ID | LAB Strain | Sample Type | AMP 1 | CHL 1 | ERY 1 | GEN 1 | PEN 1 | TET 1 | VAN 1 | Antibiotic Resistance Genes |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | L. mesenteroides | Cow Cheese | S | S | S | S | S | S | R | tetS |
| 2 | L. mesenteroides | Goat cheese | S | S | S | S | S | S | R | - |
| 3 | L. pseudomesenteroides | Cow curd | S | S | S | S | S | S | R | tetK |
| 4 | L. mesenteroides | Cow curd | S | S | S | S | S | S | R | qnrS |
| 5 | L. mesenteroides | Cow curd | S | S | S | S | S | S | R | - |
| 6 | L. mesenteroides | Cow Cheese | S | S | S | S | S | S | R | tetK |
| 7 | L. pseudomesenteroides | Cow Cheese | S | S | S | S | S | S | R | tetM |
| 8 | L. mesenteroides | Cow Cheese | S | S | S | S | S | S | R | - |
| Resistance rate (%) | 100.0 |
| LAB Strains | Resistance Genes | |||
|---|---|---|---|---|
| Tetracycline | β-Lactamase | Erythromycin | Quinolone | |
| Lactococcus lactis (n = 21) | 5/22 tetK, 1/22 tetM, 1/22 tetS | - | 1/22 ermA, 1/22 ermB | - |
| Lactobacillus delbrueckii (n = 1) | 1/1 tetM | - | - | - |
| Lactobacillus fermentum (n = 1) | - | - | - | - |
| Streptococcus salivarius ssp thermophilus (n = 6) | 1/6 tetK, 1/6 tetL | 1/6 blaCTX-M | - | - |
| Leuconostoc mesenteroides (n = 6) | 1/6 tetK, 1/6 tetS | - | - | 1/6 qnrS |
| Lactobacillus curvatus (n = 2) | - | 1/2 blaTEM | - | - |
| Lactococcus garvieae (n = 2) | 1/2 tetB, 1/2 tetK | - | 2/2 ermB | - |
| Lactobacillus plantarum (n = 3) | 1/3 tetK | - | - | - |
| Lactobacillus paracasei (n = 3) | - | - | - | - |
| Lactobacillus brevis (n = 1) | - | - | - | - |
| Streptococcus equinus (n = 1) | - | 1/1 blaCTX-M | 1/1 ermB | - |
| Lacticaseibacillus paracasei (n = 4) | - | 2/4 blaTEM | - | -- |
| Lactococcus raffinolactis (n = 1) | - | - | - | |
| Leuconostoc pseudomesenteroides (n = 2) | 1/2 tetM, 1/2 tetK | - | - | - |
| Target Genes | Primer Sequence (5′–3′) | Annealing Temperature | Amplified Size (bp) | References |
|---|---|---|---|---|
| tetB | TTG GTT AGG GGC AAG TTT TG | 55 °C | 659 | [74] |
| GTA ATG GGC CAA TAA CAC CG | ||||
| tetA | GCT ACA TCC TGC TTG CCT TC | 55 °C | 210 | [74] |
| CAT AGA TCG CCG TGA AGA GG | ||||
| tetK | TCG ATA GGA ACA GCA GTA | 55 °C | 169 | [74] |
| CAG CAG ATC CTA CTC CTT | ||||
| tetL | TCGTTA GCGTGC TGTCAT TC | 55 °C | 267 | [74] |
| GTATCCCACCAATGTAGCCG | ||||
| tetM | GTGGACAAAGGT ACA ACGAG | 55 °C | 406 | [74] |
| CGGTAAAGTTCGTCA CACAC | ||||
| tetO | AACTTAGGCATTCTGGCTCAC | 55 °C | 515 | [74] |
| TCC CACTGTTCC ATATCGTCA | ||||
| tetS | CAT AGA CAA GCCGTT GACC | 55 °C | 667 | [74] |
| ATG TTT TTG GAACGC CAG AG | ||||
| blaCTX-M | ATG TGCAGYACCAGTAARGTKATGGC | 62 °C | 593 | [75] |
| TGG GTRAARTARGTSACCAGAAYCAGCGG | ||||
| blaTEM | CGCCGCATACACTATTCTCAGAATGA | 62 °C | 445 | [75] |
| ACGCTCACCGGCTCCAGATTTAT | ||||
| qnrA | ATTTCTCACGCCAGGATTTG | 53 °C | 516 | [76] |
| GATCGGCAAAGGTTAGGTCA | ||||
| qnrB | GATCGTGAAAGCCAGAAAGG | 53 °C | 469 | [76] |
| ACGATGCCTGGTAGTTGTCC | ||||
| qnrS | ACGACATTCGTCAACTGCAA | 53 °C | 417 | [76] |
| TAAATTGGCACCCTGTAGGC | ||||
| ermA | GTTCAAGAACAATCAATACAGAG GGATCAGGAAAAGGACATTTTAC | 53 °C | 421 | [77] |
| ermB | CCGTTTACGAAATTGGAACAGGTAAAGGGC GAATCGAGACTTGAGTGTGC | 53 °C | 359 | [77] |
| ermC | GCTAATATTGTTTAAATCGTCAATTCC GGATCAGGAAAAGGACATTTTAC | 53 °C | 572 | [77] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Floris, I.; Battistini, R.; Tramuta, C.; Garcia-Vozmediano, A.; Musolino, N.; Scardino, G.; Masotti, C.; Brusa, B.; Orusa, R.; Serracca, L.; et al. Antibiotic Resistance in Lactic Acid Bacteria from Dairy Products in Northern Italy. Antibiotics 2025, 14, 375. https://doi.org/10.3390/antibiotics14040375
Floris I, Battistini R, Tramuta C, Garcia-Vozmediano A, Musolino N, Scardino G, Masotti C, Brusa B, Orusa R, Serracca L, et al. Antibiotic Resistance in Lactic Acid Bacteria from Dairy Products in Northern Italy. Antibiotics. 2025; 14(4):375. https://doi.org/10.3390/antibiotics14040375
Chicago/Turabian StyleFloris, Irene, Roberta Battistini, Clara Tramuta, Aitor Garcia-Vozmediano, Noemi Musolino, Giulia Scardino, Chiara Masotti, Beatrice Brusa, Riccardo Orusa, Laura Serracca, and et al. 2025. "Antibiotic Resistance in Lactic Acid Bacteria from Dairy Products in Northern Italy" Antibiotics 14, no. 4: 375. https://doi.org/10.3390/antibiotics14040375
APA StyleFloris, I., Battistini, R., Tramuta, C., Garcia-Vozmediano, A., Musolino, N., Scardino, G., Masotti, C., Brusa, B., Orusa, R., Serracca, L., Razzuoli, E., Martucci, F., & Bianchi, D. M. (2025). Antibiotic Resistance in Lactic Acid Bacteria from Dairy Products in Northern Italy. Antibiotics, 14(4), 375. https://doi.org/10.3390/antibiotics14040375

