Antimicrobial Resistance, Serologic and Molecular Characterization of E. coli Isolated from Calves with Severe or Fatal Enteritis in Bavaria, Germany
Abstract
1. Introduction
2. Results
2.1. Antimicrobial Susceptibility
2.2. Serologic Characterization
2.3. Molecular Characterization
3. Discussion
Limits of the Study
4. Materials and Methods
4.1. Study Design and Bacterial Isolates
4.2. Antimicrobial Susceptibility Testing
4.3. Phenotypic Analysis and Serotyping
4.4. Molecular Investigation
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Quinn, P.J.; Markey, B.K.; Leonard, F.C.; Fitzpatrick, E.S.; Fanning, S.; Hartigan, P.J. Veterinary Microbiology and Microbial Disease; Wiley: Chichester, UK, 2011. [Google Scholar]
- Kaper, J.B.; Nataro, J.P.; Mobley, H.L. Pathogenic Escherichia coli. Nat. Rev. Genet. 2004, 2, 123–140. [Google Scholar] [CrossRef] [PubMed]
- Foster, D.M.; Smith, G.W. Pathophysiology of Diarrhea in Calves. Veter Clin. North Am. Food Anim. Pract. 2009, 25, 13–36. [Google Scholar] [CrossRef] [PubMed]
- Kolenda, R.; Burdukiewicz, M.; Schierack, P. A systematic review and meta-analysis of the epidemiology of pathogenic Escherichia coli of calves and the role of calves as reservoirs for human pathogenic E. coli. Front. Cell. Infect. Microbiol. 2015, 5, 23. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.-I.; Yoon, K.-J. An overview of calf diarrhea—Infectious etiology, diagnosis, and intervention. J. Veter Sci. 2014, 15, 1–17. [Google Scholar] [CrossRef]
- Linton, A.H.; Hinton, M.H. Enterobacteriaceae associated with animals in health and disease. Soc. Appl. Bacteriol. Symp. Ser. 1988, 65, S71–S85. [Google Scholar] [CrossRef]
- Ewers, C.; Schüffner, C.; Weiss, R.; Baljer, G.; Wieler, L.H. Molecular characteristics ofEscherichia coli serogroup O78 strains isolated from diarrheal cases in bovines urge further investigations on their zoonotic potential. Mol. Nutr. Food Res. 2004, 48, 504–514. [Google Scholar] [CrossRef]
- Nagy, B.; Fekete, P.Z. Enterotoxigenic Escherichia coli in veterinary medicine. Int. J. Med. Microbiol. 2005, 295, 443–454. [Google Scholar] [CrossRef]
- Sting, R.; Stermann, M. Duplex real-time PCr assays for rapid detection of virulence genes in E. coli isolated from post-weaning pigs and calves with diarrhoea Duplex Real-Time PCR-Assays für den raschen Nachweis von Virulenz-Genen in E. Coli-Isolaten durchfallerkrankter Absatzferkel und Kälber. Dtsch. Tierärztliche Wochenschr. 2008, 115, 231–238. [Google Scholar]
- Dubreuil, J.D.; Isaacson, R.E.; Schifferli, D.M. Animal Enterotoxigenic Escherichia coli. EcoSal Plus 2016, 7. [Google Scholar] [CrossRef]
- Gyles, C.L. Escherichia coli cytotoxins and enterotoxins. Can. J. Microbiol. 1992, 38, 734–746. [Google Scholar] [CrossRef]
- Field, M.; Graf, L.H., Jr.; Laird, W.J.; Smith, P.L. Heat-stable enterotoxin of Escherichia coli: In vitro effects on guanylate cyclase activity, cyclic GMP concentration, and ion transport in small intestine. Proc. Natl. Acad. Sci. USA 1978, 75, 2800–2804. [Google Scholar] [CrossRef]
- Gyles, C.L. Shiga toxin-producing Escherichia coli: An overview. J. Anim. Sci. 2007, 85, E45–E62. [Google Scholar] [CrossRef]
- Beutin, L.; Geier, D.; Steinrück, H.; Zimmermann, S.; Scheutz, F. Prevalence and some properties of verotoxin (Shiga-like toxin)-producing Escherichia coli in seven different species of healthy domestic animals. J. Clin. Microbiol. 1993, 31, 2483–2488. [Google Scholar] [CrossRef]
- Montenegro, M.A.; Bülte, M.; Trumpf, T.; Aleksić, S.; Reuter, G.; Bulling, E.; Helmuth, R. Detection and characterization of fecal verotoxin-producing Escherichia coli from healthy cattle. J. Clin. Microbiol. 1990, 28, 1417–1421. [Google Scholar] [CrossRef]
- Blanco, M.; Blanco, J.; Blanco, J.E.; González, E.A.; Gomes, T.; Zerbini, L.; Yano, T.; de Castro, A. Genes coding for Shiga-like toxins in bovine verotoxin-producing Escherichia coli (VTEC) strains belonging to different O:K:H serotypes. Veter Microbiol. 1994, 42, 105–110. [Google Scholar] [CrossRef]
- Wieler, L.H.; Bauernfeind, R. E coli: Shiga Toxin Methods and Protocols; Philpott, D., Ebel, F., Eds.; Humana Press Inc.: Totowa, NJ, USA, 2003; ISBN 978-1-59259-316-3. [Google Scholar] [CrossRef]
- Dean-Nystrom, E.A.; Bosworth, B.T.; Moon, H.W. Pathogenesis of Escherichia Coli O157:H7 in Weaned Calves. Adv. Exp. Med. Biol. 1999, 473, 173–177. [Google Scholar] [CrossRef]
- Dean-Nystrom, E.A.; Bosworth, B.T.; Cray, W.C., Jr.; Moon, H.W. Pathogenicity of Escherichia coli O157:H7 in the intestines of neonatal calves. Infect. Immun. 1997, 65, 1842–1848. [Google Scholar] [CrossRef]
- Dean-Nystrom, E.A.; Bosworth, B.T.; Moon, H.W.; O’Brien, A.D. Escherichia coli O157:H7 requires intimin for enteropathogenicity in calves. Infect. Immun. 1998, 66, 4560–4563. [Google Scholar] [CrossRef]
- Taneike, I.; Zhang, H.-M.; Wakisaka-Saito, N.; Yamamoto, T. Enterohemolysin operon of Shiga toxin-producingEscherichia coli: A virulence function of inflammatory cytokine production from human monocytes. FEBS Lett. 2002, 524, 219–224. [Google Scholar] [CrossRef]
- Beutin, L.; Aleksic’, S.; Zimmermann, S.; Gleier, K. Virulence factors and phenotypical traits of verotoxigenic strains of Escherichia coli isolated from human patients in Germany. Med. Microbiol. Immunol. 1994, 183, 13–21. [Google Scholar] [CrossRef]
- Boerlin, P.; McEwen, S.A.; Boerlin-Petzold, F.; Wilson, J.B.; Johnson, R.P.; Gyles, C.L. Associations between Virulence Factors of Shiga Toxin-Producing Escherichia coli and Disease in Humans. J. Clin. Microbiol. 1999, 37, 497–503. [Google Scholar] [CrossRef]
- Nataro, J.P.; Kaper, J.B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201. [Google Scholar] [CrossRef]
- Croxen, M.A.; Law, R.J.; Scholz, R.; Keeney, K.M.; Wlodarska, M.; Finlay, B.B. Recent Advances in Understanding Enteric Pathogenic Escherichia coli. Clin. Microbiol. Rev. 2013, 26, 822–880. [Google Scholar] [CrossRef]
- Mayer, C.L.; Leibowitz, C.S.; Kurosawa, S.; Stearns-Kurosawa, D.J. Shiga Toxins and the Pathophysiology of Hemolytic Uremic Syndrome in Humans and Animals. Toxins 2012, 4, 1261–1287. [Google Scholar] [CrossRef] [PubMed]
- Federal Office of Consumer Protection and Food Safety, Paul-Ehrlich-Gesellschaft für Chemotherapie e.V. Report on the Consumption of Antimicrobials and the Spread of Antimicrobial Resistance in Human and Veterinary Medicine in Germany. Available online: https://www.bvl.bund.de/SharedDocs/Downloads/05_Tierarzneimittel/germap2015_EN.pdf?__blob=publicationFile&v=5 (accessed on 23 December 2021).
- Constable, P.D. Treatment of Calf Diarrhea: Antimicrobial and Ancillary Treatments. Veter Clin. North Am. Food Anim. Pract. 2009, 25, 101–120. [Google Scholar] [CrossRef] [PubMed]
- Vetsuisse-Fakultät. Umsichtiger Einsatz von Antibiotika bei Rindern, Schweinen und kleinen Wiederkäuern, Therapieleitfaden für Tierärztinnen und Tierärzte; Gesellschaft Schweizer Tierärztinnen und Tierärzte; Bundesamt für Lebensmittelsicherheit und Veterinärwesen: Bern, Switzerland, 2019; Available online: https://www.blv.admin.ch/blv/de/home/tiere/tierarzneimittel/antibiotika/nationale-strategie-antibiotikaresistenzen--star--/sachgemaesser-antibiotikaeinsatz.html (accessed on 23 December 2021).
- De Briyne, N.; Atkinson, J.; Borriello, S.P.; Pokludová, L. Antibiotics used most commonly to treat animals in Europe. Vet. Rec. 2014, 175, 325. [Google Scholar] [CrossRef] [PubMed]
- De Verdier, K.; Nyman, A.; Greko, C.; Bengtsson, B. Antimicrobial resistance and virulence factors in Escherichia coli from swedish dairy calves. Acta Veter Scand. 2012, 54, 2. [Google Scholar] [CrossRef] [PubMed]
- Khachatryan, A.R.; Hancock, D.D.; Besser, T.E.; Call, D.R. Role of Calf-Adapted Escherichia coli in Maintenance of Antimicrobial Drug Resistance in Dairy Calves. Appl. Environ. Microbiol. 2004, 70, 752–757. [Google Scholar] [CrossRef]
- Cao, H.; Pradhan, A.K.; Karns, J.S.; Hovingh, E.; Wolfgang, D.R.; Vinyard, B.T.; Kim, S.W.; Salaheen, S.; Haley, B.J.; Van Kessel, J.A.S. Age-Associated Distribution of Antimicrobial-Resistant Salmonella enterica and Escherichia coli Isolated from Dairy Herds in Pennsylvania, 2013–2015. Foodborne Pathog. Dis. 2019, 16, 60–67. [Google Scholar] [CrossRef]
- Federal Office of Consumer Protection and Food Safety. Report on the Resistance Monitoring Study 2018. 2020. Available online: https://www.bvl.bund.de/EN/Home/home_node.html (accessed on 23 December 2021).
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- Murphy, D.; Ricci, A.; Auce, Z.; Beechinor, J.G.; Bergendahl, H.; Breathnach, R.; Bureš, J.; Duarte Da Silva, J.P.; Hederová, J.; Hekman, P.; et al. EMA and EFSA Joint Scientific Opinion on measures to reduce the need to use antimicrobial agents in animal husbandry in the European Union, and the resulting impacts on food safety (RONAFA). EFSA J. 2017, 15, 4666. [Google Scholar] [CrossRef]
- Astorga, F.; Navarrete-Talloni, M.J.; Miró, M.P.; Bravo, V.; Toro, M.; Blondel, C.J.; Hervé-Claude, L.P. Antimicrobial resistance in E. coli isolated from dairy calves and bedding material. Heliyon 2019, 5, e02773. [Google Scholar] [CrossRef]
- Ørskov, F.; Ørskov, I. Escherichia coli serotyping and disease in man and animals. Can. J. Microbiol. 1992, 38, 699–704. [Google Scholar] [CrossRef]
- Perelle, S.; Dilasser, F.; Grout, J.; Fach, P. Detection by 5′-nuclease PCR of Shiga-toxin producing Escherichia coli O26, O55, O91, O103, O111, O113, O145 and O157:H7, associated with the world’s most frequent clinical cases. Mol. Cell. Probes 2004, 18, 185–192. [Google Scholar] [CrossRef]
- Nielsen, E.M.; Andersen, M.T. Detection and Characterization of Verocytotoxin-Producing Escherichia coli by Automated 5′ Nuclease PCR Assay. J. Clin. Microbiol. 2003, 41, 2884–2893. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 5th ed.; CLSI standard Vet01; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 4th ed.; CLSI supplement Vet08; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- Franklin, A.; Acar, J.; Anthony, F.; Gupta, R.; Nicholls, T.; Tamura, Y.; Thompson, S.; Threlfall, E.; Vose, D.; Van Vuuren, M.; et al. Antimicrobial resistance: Harmonisation of national antimicrobial resistance monitoring and surveillance programmes in animals and in animal-derived food. Rev. Sci. Tech. 2001, 20, 859–870. [Google Scholar] [CrossRef]
- German Federal Government. DART 2020—Fighting Antibiotic Resistance for the Good of Both Humans and Animals. Available online: https://www.bmel.de/SharedDocs/Downloads/EN/Publications/DART2020.html (accessed on 23 December 2021).
- Awosile, B.B.; Heider, L.C.; Saab, M.E.; McClure, J.T. Antimicrobial resistance in mastitis, respiratory and enteric bacteria isolated from ruminant animals from the Atlantic Provinces of Canada from 1994-2013. Can. Veter J. 2018, 59, 1099–1104. [Google Scholar]
- Tadesse, D.A.; Zhao, S.; Tong, E.; Ayers, S.; Singh, A.; Bartholomew, M.J.; McDermott, P.F. Antimicrobial Drug Resistance inEscherichia colifrom Humans and Food Animals, United States, 1950–2002. Emerg. Infect. Dis. 2012, 18, 741–749. [Google Scholar] [CrossRef]
- Tenhagen, B.-A.; Käsbohrer, A.; Grobbel, M.; Hammerl, J.; Kaspar, H. Antibiotikaresistenz von E. coli aus Rinderpopulationen in Deutschland. Tierärztliche Prax. Ausg. G Großtiere Nutztiere 2020, 48, 218–227. [Google Scholar] [CrossRef]
- Insitute for Pharmacology, Pharmacy and Toxicology, Veterinary Faculty, University Leipzig. Vetidata Veterinary Information Service. Available online: https://www.vetidata.de/public/index.php (accessed on 19 February 2021).
- World Health Organization. Critically Important Antimicrobials for Human Medicine, 5th Revision 2016. Available online: https://www.who.int/foodsafety/publications/antimicrobials-fifth/en/ (accessed on 10 October 2020).
- Federal Ministry of Justice and Consumer Protection. Verordnung über tierärztliche Hausapotheken; 2018. Available online: https://www.gesetze-im-internet.de/t_hav/BJNR021150975.html (accessed on 23 December 2021).
- Umpiérrez, A.; Bado, I.; Oliver, M.; Acquistapace, S.; Etcheverría, A.; Padola, N.L.; Vignoli, R.; Zunino, P. Zoonotic Potential and Antibiotic Resistance of Escherichia coli in Neonatal Calves in Uruguay. Microbes Environ. 2017, 32, 275–282. [Google Scholar] [CrossRef]
- Sawant, A.A.; Hegde, N.V.; Straley, B.A.; Donaldson, S.C.; Love, B.C.; Knabel, S.J.; Jayarao, B.M. Antimicrobial-Resistant Enteric Bacteria from Dairy Cattle. Appl. Environ. Microbiol. 2007, 73, 156–163. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, H.; Stürenburg, E.; Heesemann, J.; Roggenkamp, A. Prevalence of extended-spectrum β-lactamases in isolates of the Enterobacter cloacae complex from German hospitals. Clin. Microbiol. Infect. 2006, 12, 322–330. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Schmid, A.; Hörmansdorfer, S.; Messelhäusser, U.; Käsbohrer, A.; Sauter-Louis, C.; Mansfeld, R. Prevalence of Extended-Spectrum β-Lactamase-Producing Escherichia coli on Bavarian Dairy and Beef Cattle Farms. Appl. Environ. Microbiol. 2013, 79, 3027–3032. [Google Scholar] [CrossRef] [PubMed]
- Werckenthin, C.; Seidl, S.; Riedl, J.; Kiossis, E.; Wolf, G.; Stolla, R.; Kaaden, O.-R. Escherichia coli Isolates from Young Calves in Bavaria: In Vitro Susceptibilities to 14 Anti-microbial Agents. J. Veter Med. Ser. B 2002, 49, 61–65. [Google Scholar] [CrossRef]
- Blanco, J.; Gonzalez, E.; Garcia, S.; Blanco, M.; Regueiro, B.; Bernardez, I. Production of toxins by Escherichia coli strains isolated from calves with diarrhoea in Galicia (North-western Spain). Veter Microbiol. 1988, 18, 297–311. [Google Scholar] [CrossRef]
- Holland, R.E.; Wilson, R.A.; Holland, M.S.; Yuzbasiyan-Gurkan, V.; Mullaney, T.P.; White, D.G. Characterization of eae+ Escherichia coli isolated from healthy and diarrheic calves. Veter Microbiol. 1999, 66, 251–263. [Google Scholar] [CrossRef]
- Bielaszewska, M.; Mellmann, A.; Bletz, S.; Zhang, W.; Köck, R.; Kossow, A.; Prager, R.; Fruth, A.; Orth-Höller, D.; Marejková, M.; et al. Enterohemorrhagic Escherichia coli O26:H11/H−: A New Virulent Clone Emerges in Europe. Clin. Infect. Dis. 2013, 56, 1373–1381. [Google Scholar] [CrossRef]
- Casey, T.A.; Bosworth, B.T. Design and Evaluation of a Multiplex Polymerase Chain Reaction Assay for the Simultaneous Identification of Genes for Nine Different Virulence Factors Associated with Escherichia Coli that Cause Diarrhea and Edema Disease in Swine. J. Veter Diagn. Investig. 2009, 21, 25–30. [Google Scholar] [CrossRef]
- Bavarian Health and Food Safety Authority. Available online: https://www.lgl.bayern.de/ (accessed on 16 December 2021).
- Frydendahl, K. Prevalence of serogroups and virulence genes in Escherichia coli associated with postweaning diarrhoea and edema disease in pigs and a comparison of diagnostic approaches. Veter Microbiol. 2002, 85, 169–182. [Google Scholar] [CrossRef]
- Khac, H.V.; Holoda, E.; Pilipcinec, E.; Blanco, M.; Blanco, J.E.; Mora, A.; Dahbi, G.; López, C.; González, E.A.; Blanco, J. Serotypes, virulence genes, and PFGE profiles of Escherichia coliisolated from pigs with postweaning diarrhoea in Slovakia. BMC Veter Res. 2006, 2, 10. [Google Scholar] [CrossRef][Green Version]
- Schierack, P.; Steinrück, H.; Kleta, S.; Vahjen, W. Virulence Factor Gene Profiles of Escherichia coli Isolates from Clinically Healthy Pigs. Appl. Environ. Microbiol. 2006, 72, 6680–6686. [Google Scholar] [CrossRef]
- Coura, F.M.; Diniz, S.D.A.; Mussi, J.M.S.; Silva, M.X.; Lage, A.P.; Heinemann, M.B. Characterization of virulence factors and phylogenetic group determination of Escherichia coli isolated from diarrheic and non-diarrheic calves from Brazil. Folia Microbiol. 2016, 62, 139–144. [Google Scholar] [CrossRef]
- Nguyen, T.D.; Vo, T.T.; Vu-Khac, H. Virulence factors inEscherichia coliisolated from calves with diarrhea in Vietnam. J. Veter Sci. 2011, 12, 159–164. [Google Scholar] [CrossRef]
- Yadegari, Z.; Brujeni, G.N.; Ghorbanpour, R.; Moosakhani, F.; Lotfollahzadeh, S. Molecular characterization of enterotoxigenic Escherichia coli isolated from neonatal calves diarrhea. Veter Res. Forum 2019, 10, 73–78. [Google Scholar] [CrossRef]
- World Health Organization. Escherichia coli diarrhoea. Bull. World Health Organ. 1980, 58, 23–36. [Google Scholar]
- Mainil, J.G.; Duchesnes, C.J.; Whipp, S.C.; Marques, L.R.; O’Brien, A.D.; Casey, T.A.; Moon, H.W. Shiga-like toxin production and attaching effacing activity of Escherichia coli associated with calf diarrhea. Am. J. Veter Res. 1987, 48, 743–748. [Google Scholar]
- Wieler, L.H.; Bauerfeind, R.; Baljer, G. Characterization of Shiga-like Toxin Producing Escherichia coli (SLTEC) Isolated from Calves with and without Diarrhoea. Zent. Für Bakteriol. 1992, 276, 243–253. [Google Scholar] [CrossRef]
- Mainil, J.G.; Jacquemin, E.R.; Kaeckenbeeck, A.E.; Pohl, P.H. Association between the effacing (eae) gene and the Shiga-like toxin-encoding genes in Escherichia coli isolates from cattle. Am. J. Veter Res. 1993, 54, 1064–1068. [Google Scholar]
- Wells, J.G.; Shipman, L.D.; Greene, K.D.; Sowers, E.G.; Green, J.H.; Cameron, D.N.; Downes, F.P.; Martin, M.L.; Griffin, P.M.; Ostroff, S.M. Isolation of Escherichia coli serotype O157:H7 and other Shiga-like-toxin-producing E. coli from dairy cattle. J. Clin. Microbiol. 1991, 29, 985–989. [Google Scholar] [CrossRef]
- Chanter, N.; Morgan, J.H.; Bridger, J.C.; Hall, G.A.; Reynolds, D.J. Dysentery in gnotobiotic calves caused by atypical Escherichia coli. Veter Rec. 1984, 114, 71. [Google Scholar] [CrossRef]
- Hall, G.A.; Reynolds, D.J.; Chanter, N.; Morgan, J.H.; Parsons, K.R.; Debney, T.G.; Bland, A.P.; Bridger, J.C. Dysentery Caused by Escherichia coli (S102-9) in Calves: Natural and Experimental Disease. Veter Pathol. 1985, 22, 156–163. [Google Scholar] [CrossRef]
- Ngeleka, M.; Godson, D.; Vanier, G.; Desmarais, G.; Wojnarowicz, C.; Sayi, S.; Huang, Y.; Movasseghi, R.; Fairbrother, J.M. Frequency of Escherichia colivirotypes in calf diarrhea and intestinal morphologic changes associated with these virotypes or other diarrheagenic pathogens. J. Veter Diagn. Investig. 2019, 31, 611–615. [Google Scholar] [CrossRef]
- Luhofer, G.; Böttner, M.; Hafez, H.; Kaske, M. Vorschläge der Arbeitsgruppe "Antibiotikaresistenz" für die Belegung von Mikrotiterplatten zur Empfindlichkeitsprüfung von Bakterien gegenüber antimikrobiellen Wirkstoffen in der Routinediagnostik—Mastitis- und Großtierlayouts. Berl. Munch. Tierarztl. Wochenschr 2004, 117, 245–251. [Google Scholar]
- Guinée, P.A.; Jansen, W.H.; Agterberg, C.M. Detection of the K99 antigen by means of agglutination and immunoelectrophoresis in Escherichia coli isolates from calves and its correlation with entertoxigenicity. Infect. Immun. 1976, 13, 1369–1377. [Google Scholar] [CrossRef] [PubMed]
- Pasayo, R.A.G.; Sanz, M.E.; Padola, N.L.; Moreira, A.R. Phenotypic and genotypic characterization of enterotoxigenic Escherichia coli isolated from diarrheic calves in Argentina. Open Veter J. 2019, 9, 65–73. [Google Scholar] [CrossRef] [PubMed]



| Antimicrobial | Years | OR | CI (95%) |
|---|---|---|---|
| amoxicillin-clavulanate | 2015–2019 | 0.95 | 0.92–0.98 1 |
| enrofloxacin | 2015–2019 | 0.91 | 0.88–0.94 1 |
| 2015–2017 | 0.92 | 0.85–1.0 1 | |
| trimethoprim-sulfamethoxazole | 2015–2019 | 1.0 | 0.97–1.03 |
| 2017–2019 | 1.11 | 1.03–1.19 1 |
| Serotype | Additionally Known for Pathogenicity in | Number of Isolates | Non-Virulent | Molecular Results | |||
|---|---|---|---|---|---|---|---|
| F17 | F5ST-I | F5F41ST-I | stx1 | ||||
| O9:K35 | 6 | 5 | 1 | ||||
| O9:K35/F5 | 1 | 1 | |||||
| O101:K28 | 6 | 6 | |||||
| O101:K28/F5 | 3 | 3 | |||||
| O101:K30 | 1 | 1 | |||||
| O101:K30/F5 | 3 | 3 | |||||
| O101:K32 | 3 | 3 | |||||
| O78:K80 | Human/sheep | 3 | 3 | ||||
| O8:K87 | Swine | 3 | 3 | ||||
| O139:K82 | Swine | 2 | 2 | ||||
| O139:K82/F4 | Swine | 5 | 4 | 1 | |||
| O141:K85 | Swine | 1 | 1 | ||||
| O147:K89 | Swine | 1 | 1 | ||||
| untypeable | 29 | 20 | 7 | 2 | |||
| seronegative | 41 | 37 | 4 | ||||
| Total | 108 | 84 | 15 | 3 | 4 | 2 | |
| Antiserum for Initial Screening | Respective Follow Up Agglutination | Specific Serotypes Occur in Cattle, but Are Found as Well/Especially in |
|---|---|---|
| Polyvalent anti-E. coli C | ||
| O9:K35, mono | ||
| O101:K28, mono | ||
| O101:K30, mono | ||
| O101:K32, mono | ||
| F5, mono | ||
| O78:K80, mono | Human, sheep | |
| Polyvalent anti-E. coli P | Swine | |
| O8:K87, mono | ||
| O138:K81, mono | ||
| O139:K82, mono | ||
| O141:K85, mono | ||
| O147:K89, mono | ||
| O149:K91, mono | ||
| F4, mono | ||
| O157:H7, mono | Association with food-poisoning |
| Target Protein | Gene(s) | Primer | Oligo Sequence (5’ -> 3’) | Size (bp) | Melting Temperature (°C) ± 0.2 °C | Reference | Reference Isolate |
|---|---|---|---|---|---|---|---|
| F4 | F4_F | GGTGGAACCAAACTGACCATTAC | 102 | 81.0 | [9] | 7156 | |
| Fimbria/outer membrane protein | F4_R | TCCATCTACACCACCAGTTACTGG | |||||
| F5 | F5_F | TTGGAAGCACCTTGCTTTAACC | 101 | 77.4 | [9] | 7159 | |
| F5_R | TCACTTGAGGGTATATGCGATCTTT | ||||||
| F6 | F6_F | GCGGATTAGCTCTTTCAGACCA | 102 | 83.2 | [9] | 7155 | |
| F6_R | TGACAGTACCGGCCGTAACTC | ||||||
| F17 | F17_F | ACTGAGGATTCTATGCRGAAAATTCAA | 83 | 79.7 | [9] | 5397 | |
| F17_R | CCGTCATAAGCAAGCGTAGCAG | ||||||
| F18 | F18_F | CCTGCTAAGCAAGAGAATATATCCAGA | 82 | 73.3 | [9] | 7160 | |
| F18_R | AGAACATATACTCAGTGCCAACAGAGAT | ||||||
| F41 | F41_F | CCTTTGTCATTTGGTGCGG | 101 | 81.5 | [9] | 7159 | |
| F41_R | TCAAATACTGTACCAGCAGAACCAC | ||||||
| O157 (rfbE) | O157_F | CGATGAGTTTATCTGCAAGGTGAT | 88 | 78.3 | [39] | DSMZ 19206 | |
| O157_R | TTTCACACTTATTGGATGGTCTCAA | ||||||
| Adhesin | intimin (eaeA) | Intimin_F | CCAGCTTCAGTCGCGATCTC | 91 | 86.1 | [9] | 7158 |
| Intimin_R | GGCCTGCAACTGTGACGAA | ||||||
| Hemolysin | enterohemolysin (ehxA) | ehec-F2 | CGTTAAGGAACAGGAGGTGTCAGTA | 142 | 79.5 | [40] | DSMZ 19206 |
| ehec-R | ATCATGTTTTCCGCCAATGAG | ||||||
| Toxin | heat-labile toxin (LT) | LT_F | CTGCCATCGATTCCGTATATGAT | 81 | 75.3 | [9] | 7157 |
| LT_R | CAGAACTATGTTCGGAATATCGCA | ||||||
| heat-stabile toxin (ST-I) | ST-I_F | TACCTCCCGTCATGTTGTTTCAC | 101 | 76.1 | [9] | 7155 | |
| ST-I_R | CCTCGACATATAACATGATGCAACTC | ||||||
| heat-stabile toxin (ST-II) | St-II_F | TTTTTCTATTGCTACAAATGCCTATGC | 101 | 75.9 | [9] | 7156 | |
| St-II_R | AACCTTTTTTACAACTTTCCTTGGC | ||||||
| Shiga toxin 1 (stx1) | Stx1_F | TCCCCAGTTCAATGTAAGATCAAC | 81 | 79.0 | [9] | 7158 | |
| Stx1_R | TTTCGTACAACACTGGATGATCTCA | ||||||
| Shiga toxin 2 (stx2) | Stx2_F | GAGTGACGACTGATTTGCATTCC | 82 | 84.6 | [9] | 7158 | |
| Stx2_R | CCATGACAACGGACAGCAGTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feuerstein, A.; Scuda, N.; Klose, C.; Hoffmann, A.; Melchner, A.; Boll, K.; Rettinger, A.; Fell, S.; Straubinger, R.K.; Riehm, J.M. Antimicrobial Resistance, Serologic and Molecular Characterization of E. coli Isolated from Calves with Severe or Fatal Enteritis in Bavaria, Germany. Antibiotics 2022, 11, 23. https://doi.org/10.3390/antibiotics11010023
Feuerstein A, Scuda N, Klose C, Hoffmann A, Melchner A, Boll K, Rettinger A, Fell S, Straubinger RK, Riehm JM. Antimicrobial Resistance, Serologic and Molecular Characterization of E. coli Isolated from Calves with Severe or Fatal Enteritis in Bavaria, Germany. Antibiotics. 2022; 11(1):23. https://doi.org/10.3390/antibiotics11010023
Chicago/Turabian StyleFeuerstein, Andrea, Nelly Scuda, Corinna Klose, Angelika Hoffmann, Alexander Melchner, Kerstin Boll, Anna Rettinger, Shari Fell, Reinhard K. Straubinger, and Julia M. Riehm. 2022. "Antimicrobial Resistance, Serologic and Molecular Characterization of E. coli Isolated from Calves with Severe or Fatal Enteritis in Bavaria, Germany" Antibiotics 11, no. 1: 23. https://doi.org/10.3390/antibiotics11010023
APA StyleFeuerstein, A., Scuda, N., Klose, C., Hoffmann, A., Melchner, A., Boll, K., Rettinger, A., Fell, S., Straubinger, R. K., & Riehm, J. M. (2022). Antimicrobial Resistance, Serologic and Molecular Characterization of E. coli Isolated from Calves with Severe or Fatal Enteritis in Bavaria, Germany. Antibiotics, 11(1), 23. https://doi.org/10.3390/antibiotics11010023

