Escherichia coli Antibiotic Resistance Patterns from Co-Grazing and Non-Co-Grazing Livestock and Wildlife Species from Two Farms in the Western Cape, South Africa
Abstract
1. Introduction
2. Results
2.1. Phenotypic Antibiotic Resistance
2.2. Genotypic Antibiotic Resistance
3. Discussion
3.1. Phenotypic Antibiotic Resistance
3.2. Genotypic Antibiotic Resistance
4. Materials and Methods
4.1. Study Area and Sample Collection
4.2. Isolation of Escherichia coli
4.3. Antibiotic Susceptibility Testing
4.4. Statistical Analysis
4.5. Gene Detection
5. Conclusions
6. Limitations of Study
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Vittecoq, M.; Godreuil, S.; Prugnolle, F.; Durand, P.; Renaud, N.; Arnal, A.; Aberkane, S.; Gauthier-Clerc, M. Antimicrobial resistance in wildlife. J. Appl. Ecol. 2016, 53, 519–529. [Google Scholar] [CrossRef]
- Woolhouse, M.; Ward, M.; van Bunnik, B.; Farrar, J. Antimicrobial resistance in humans, livestock and the wider environment. Philos. Trans. R. Soc. B Biol. Sci. 2015, 370, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Bekker, J.L. A Food Safety Plan for the Game Meat Industry in South Africa. Ph.D. Thesis, Stellenbosch University, Stellenbosch, South Africa, 2011. [Google Scholar]
- Dias, D.; Torres, R.T.; Kronvall, G.; Fonsec, C.; Mendo, S.; Caetano, T. Assessment of antibiotic resistance of Escherichia coli isolates and screening of Salmonella spp. in wild ungulates from Portugal. Res. Microbiol. 2015, 166, 584–593. [Google Scholar] [CrossRef] [PubMed]
- King, T.L.B.; Schmidt, S. Assessment of three indigenous South African herbivores as potential reservoirs and vectors of antibiotic-resistant Escherichia coli. Eur. J. Wildl. Res. 2017, 63, 44. [Google Scholar] [CrossRef]
- Silva, N.; Igrejas, G.; Figueiredo, N.; Gonçalves, A.; Radhouani, H.; Rodrigues, J.; Poeta, P. Molecular characterization of antimicrobial resistance in Enterococci and Escherichia coli isolates from European wild rabbit Oryctolagus cuniculus. Sci. Total Environ. 2010, 408, 4871–4876. [Google Scholar] [CrossRef] [PubMed]
- Bengis, R.G.; Kock, R.A.; Fischer, J. Infectious animal diseases: The wildlife/livestock interface. Rev. Sci. Tech. 2002, 21, 53–65. [Google Scholar] [PubMed]
- Food and Agricultural Organization. Bushmeat Consumption, Wildlife Trade and Global Public Health Risks. Available online: http://www.fao.org/ag/againfo/programmes/en/empres/news_151010.html (accessed on 30 March 2020).
- Mercat, M.; Clermont, O.; Massot, M.; Ruppe, E.; Garine-wichatitsky, M.; De Miguel, E. Escherichia coli population structure and antibiotic resistance at a buffalo/cattle interface in Southern Africa. Appl. Environ. Microbiol. 2016, 82, 1459–1467. [Google Scholar] [CrossRef] [PubMed]
- Allen, H.K.; Donato, J.J. Call of the wild: Antibiotic resistance genes in natural environments. Nat. Rev. Microbiol. 2010, 10, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Rhyan, J.C.; Spraker, T.R. Emergence of diseases from wildlife reserviours. Vet. Pathol. 2010, 47, 34–39. [Google Scholar] [CrossRef] [PubMed]
- Morgan, E.R.; Lundervold, M.; Medley, G.F.; Shaikenov, B.S.; Torgerson, P.R.; Milner-Gulland, E.J. Assessing risks of disease transmission between wildlife and livestock: The Saiga antelope as a case study. Biol. Conserv. 2016, 131, 244–254. [Google Scholar] [CrossRef]
- Metzler-Zebeli, B.U.; Lawlor, P.G.; Magowan, E.; Zebeli, Q. Effect of freezing conditions on fecal bacterial composition in pigs. Animals 2016, 6, 18. [Google Scholar] [CrossRef]
- Radhouani, H.; Silva, N.; Poeta, P.; Torres, C.; Correia, S.; Igrejas, G. Potential impact of antimicrobial resistance in wildlife, environment, and human health. Front. Microbiol. 2014, 5, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Boerlin, P.; Travis, R.; Gyles, C.L.; Reid-Smith, R.; Janecko, N.; Lim, H.; Nicholson, V.; McEwen, S.A.; Friendship, R.; Archambault, M. Antimicrobial resistance and virulence genes of Escherichia coli isolates from swine in Ontario. Appl. Environ. Microbiol. 2005, 71, 6753–6761. [Google Scholar] [CrossRef]
- Sunde, M.; Norström, M. The genetic background for streptomycin resistance in Escherichia coli influences the distribution of MICs. J. Antimicrob. Chemother. 2005, 56, 89–90. [Google Scholar] [CrossRef]
- Wilkerson, C.; Samadpour, M. Antibiotic resistance and distribution of tetracycline resistance genes in Escherichia coli O157:H7 isolates from humans and bovines. Antimicrob. Agents Chemother. 2004, 48, 1066–1067. [Google Scholar] [CrossRef]
- Frank, T.; Gautier, V.; Talarmin, A.; Bercion, R.; Arlet, G. Characterisation of sulphonamide resistance genes and class integrin gene cassettes in Enterobacteriaceae, Central African Republic (CAR). J. Antimicrob. Chemother. 2007, 59, 742–745. [Google Scholar] [CrossRef]
- Tadesse, D.A.; Zhao, S.; Tong, E.; Ayers, S.; Singh, A.; Bartholomew, M.J.; McDermott, P.F. Antimicrobial drug resistance in Escherichia coli from humans and food animals, United States, 1950–2002. Emerg. Infect. Dis. 2012, 18, 741–749. [Google Scholar] [CrossRef] [PubMed]
- Lachmayr, K.L.; Kerkhof, L.J.; DiRienzo, A.G.; Cavanaugh, C.M.; Ford, T.E. Quantifying nonspecific TEM β-lactamase (blaTEM) genes in a wastewater stream. Appl. Environ. Microbiol. 2009, 75, 203–211. [Google Scholar] [CrossRef] [PubMed]
- Mirzaagha, P.; Louie, M.; Read, R.R.; Sharma, R.; Yanke, L.J.; Topp, E.; McAllister, T.A. Characterization of tetracycline- and ampicillin-resistant Escherichia coli isolated from the feces of feedlot cattle over the feeding period. Can. J. Microbiol. 2009, 55, 750–761. [Google Scholar] [CrossRef]
- Bischoff, M.K.; White, D.G.; McDermott, P.F.; Zhao, S.; Gaines, S.; Maurer, J.J.; Nisbet, D.J. Characterisation of chloramphenicol resistance in beta-hemolytic Escherichia coli associated with diarrhoea in neonatal swine. J. Clin. Microbiol. 2002, 40, 389–394. [Google Scholar] [CrossRef] [PubMed]
- Sáenz, Y.; Briñas, L.; Domíngue, E.; Ruiz, J.; Zarazage, M.; Vila, J.; Torres, C. Mechanisms of resistance in multiple-antibiotic-resistant Escherichia coli strains of human, animal, and food origins. Antimicrob. Agents Chemother. 2004, 48, 3996–4001. [Google Scholar] [CrossRef]
- Gonçalves, A.; Igrejas, G.; Radhouani, H.; Santos, T.; Monteiro, R.; Pacheco, R.; Alcaide, E.; Zorrilla, I.; Serra, R.; Torres, C.; et al. Detection of antibiotic resistance Enterococci and Escherichia coli in free range Inberian Lynx Lynx Pardinus. Sci. Total Environ. 2013, 456–457, 115–119. [Google Scholar] [CrossRef] [PubMed]
- Kozak, G.K.; Boerlin, P.; Janecko, N.; Reid-Smith, R.J.; Jardine, C. Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl. Environ. Microbiol. 2009, 75, 559–566. [Google Scholar] [CrossRef] [PubMed]
- Sousa, M.; Silva, N.; Igrejas, G.; Silva, F.; Sargo, R.; Alegria, N.; Benito, D.; Go, P.; Torres, C.; Lozano, C.; et al. Antimicrobial resistance determinants in Staphylococcus spp. recovered from birds of prey in Portugal. Vet. Microbiol. 2014, 171, 436–440. [Google Scholar] [CrossRef] [PubMed]
- Bemier, S.P.; Surette, M.G. Concentration-dependent activity of antibiotics in natural environments. Front. Microbiol. 2013, 4, 1–14. [Google Scholar]
- Berglund, B. Environmental dissemination of antibiotic resistance genes and correlation to anthropogenic contamination with antibiotics. Infect. Ecol. Epidemiol. 2015, 5, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Martinez, J.L. Natural antibiotic resistance and contamination by antibiotic resistance determinants: The two ages in the evolution of resistance to antimicrobials. Front. Microbiol. 2012, 3, 1–3. [Google Scholar] [CrossRef]
- Cole, D.; Drum, D.J.V.; Stallknecht, D.E.; White, D.G.; Lee, M.D.; Ayers, S.; Sobsey, M.; Maurer, J.J. Free-living Canada geese and antimicrobial resistance. Emerg. Infect. Dis. 2005, 11, 935–939. [Google Scholar] [CrossRef]
- Mariano, V.; McCrindle, C.M.E.; Cenci-Goga, B.; Picard, J.A. Case-control study to determine whether river water can spread tetracycline resistance to unexposed Impala Aepyceros melampus in Kruger National Park South Africa. Appl. Environ. Microbiol. 2009, 75, 113–118. [Google Scholar] [CrossRef]
- World Health Organisation. Use of Quinolones in Food Animals and Potential Impact on Human Health; World Health Organisation: Geneva, Switzerland, 1998; pp. 1–129. [Google Scholar]
- Costa, D.; Poeta, P.; Sáenz, Y.; Vinué, L.; Coelho, A.C.; Matos, M.; Rojo-Bezares Rodrigues, J.; Torres, C. Mechanisms of antibiotic resistance in Escherichia coli isolates recovered from wild animals. Microb. Drug Resist. 2008, 14, 71–78. [Google Scholar] [CrossRef]
- Lillehaug, A.; Bergsjø, B.; Schau, J.; Bruheim, T.; Vikøren, T.; Handeland, K. Campylobacter spp., Salmonella spp., verocytotoxic Escherichia coli, and antibiotic resistance in indicator organisms in wild cervids. Acta Vet. Scand. 2005, 46, 23–32. [Google Scholar] [CrossRef]
- Rolland, R.M.; Hausfater, G.; Marshall, B.; Levy, S.B. Antibiotic resistant bacteria in wild primates: Increased prevalence in baboons feeding on human refuse. Appl. Environ. Microbiol. 1985, 49, 791–794. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, S.; Kehrenberg, C.; Doublet, B.; Cloeckaert, A. Molecular basis of bacterial resistance to chloramphenicol and florfenicol. FEMS Microbiol. Rev. 2004, 28, 519–542. [Google Scholar] [CrossRef]
- Cantas, L.; Shah, S.Q.A.; Cavaco, L.M.; Manala, C.M.; Walsh, F.; Popowska, M.; Garelick, H.; Bürgmann, H.; Serum, H. A brief multi-disciplinary review on antimicrobial resistance in medicine and its linkage to the global environmental microbiota. Front. Microbiol. 2013, 4, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Chadha, T. Antibiotic resistant genes in natural environment. Agrotechnology 2013, 1, 1–3. [Google Scholar] [CrossRef]
- Economou, V.; Gousia, P. Agriculture and food animals as a source of antimicrobial-resistant bacteria. Infect. Drug Resist. 2015, 8, 49–61. [Google Scholar] [CrossRef] [PubMed]
- Wise, E.M.; Abou-Doni, M.M. Sulfonamide resistance mechanism in Escherichia coli: R plasmids can determine sulphonamide-resistant dihydropteroate synthases. Proc. Natl Acad. Sci. USA 1975, 72, 2621–2625. [Google Scholar] [CrossRef] [PubMed]
- Na, G.; Lu, Z.; Gao, H.; Zhang, L.; Li, Q.; Li, R.; Yang, F.; Huo, C.; Yao, Z. The effect of environmental factors and migration dynamics on the prevalence of antibiotic-resistant Escherichia coli in estuary environments. Sci. Rep. 2018, 8, 1–9. [Google Scholar] [CrossRef]
- Bryan, A.; Shapir, N.; Sadowsky, M.J. Frequency and distribution of tetracycline resistance genes in genetically diverse, nonselected, and nonclinical Escherichia coli strains isolated from diverse human and animal sources. Appl. Environ. Microbiol. 2004, 70, 2503–2507. [Google Scholar] [CrossRef]
- Fan, W.; Hamilton, T.; Webster-Sesay, S.; Nikolich, M.P.; Lindler, L.E. Mulitplex real-time SYBR green I PCR assay for detection of tetracycline efflux genes of Gram-negative bacteria. Mol. Cell. Probes 2006, 21, 245–256. [Google Scholar] [CrossRef]
- Michalova, E.; Novotna, P.; Schlegelova, J. Tetracyclines in veterinary medicine and bacterial resistance to them. Veterinární Med. 2004, 49, 79–100. [Google Scholar] [CrossRef]
- Gilmore, K.S.; Gilmore, M.S.; Sahn, D.F. Methicillin resistance in Staphylococcus aureus. In Bacterial Resistance to Antimicrobials, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2008; pp. 291–296. [Google Scholar]
- Katakweba, A.A.S.; Møller, K.S.; Muumba, J.; Muhairwa, A.P.; Damborg, P.; Rosenkrantz, J.T.; Minga, U.M.; Mtambo, M.M.A.; Olsen, J.E. Antimicrobial resistance in faecal samples from buffalo, wildebeest and zebra grazing together with and without cattle in Tanzania. J. Appl. Microbiol. 2015, 118, 966–975. [Google Scholar] [CrossRef] [PubMed]
- Navarro-Gonzalez, N.; Porrero, M.C.; Mentaberre, G.; Serrano, E.; Mateos, A.; Domínguez, L.; Lavína, S. Antimicrobial resistance in indicator Escherichia coli isolates from free-ranging livestock and sympatric wild ungulates in a natural environment northeastern Spain. Appl. Environ. Microbiol. 2013, 79, 6184–6186. [Google Scholar] [CrossRef]
- Bloch, N.; Sidjabat-Tambunan, H.; Tratt, T.; Bensink, J.; Lea, K.; Frost, A.J. The enumeration of coliforms and E. coli on naturally contaminated beef: A comparison of the Petrifilm™ method with the Australian standard. Meat Sci. 1996, 43, 187–193. [Google Scholar] [CrossRef]

| Farm | Animal | Phenotypic Resistance 1 | Genotypic Resistance | |||||
|---|---|---|---|---|---|---|---|---|
| blaCMY | sul1 | sul2 | aadA1 | tetA | tetB | |||
| Bredasdorp | Cattle 1 | AMP(I), SF(S), ST(R), TE(S) | - | - | - | + | - | - |
| Bredasdorp | Cattle 2 | AMP(I), SF(S), ST(I), TE(S) | - | - | - | + | - | - |
| Bredasdorp | Cattle 3 | AMP(R), SF(S), ST(I), TE(S) | + | - | - | - | - | - |
| Bredasdorp | Sheep 1 | AMP(S), SF(S), ST(R), TE(I) | - | - | - | + | - | - |
| Bredasdorp | Sheep 1 | AMP(S), SF(S), ST(I), TE(S) | + | - | - | + | - | - |
| Bredasdorp | Eland 1 | AMP(S), SF(S), ST(R), TE(S) | + | - | - | + | - | - |
| Bredasdorp | Eland 1 | AMP(S), SF(R), ST(I), TE (S) | - | - | + | + | - | - |
| Bredasdorp | Eland 1 | AMP(S), SF(S), ST(R), TE(I) | - | - | - | + | + | - |
| Bredasdorp | Wildebeest 1 | AMP(S), SF(S), ST(R), TE(S) | + | - | - | + | - | - |
| Bredasdorp | Wildebeest 2 | AMP(S), SF(R), ST(R), TE(I) | - | - | + | + | - | - |
| Bredasdorp | Wildebeest 3 | AMP(S), SF(R), ST(I), TE(S) | + | - | + | - | + | + |
| Bredasdorp | Wildebeest 4 | AMP(S), SF(S), ST(R), TE(I) | + | - | - | + | - | - |
| Witsand | Cattle 1 | AMP(I), SF(S), ST(I), TE(R) | - | - | - | + | + | + |
| Witsand | Cattle 2 | AMP(I), SF(R), ST(R), TE(I) | - | - | - | + | - | - |
| Witsand | Sheep 1 | AMP(R), SF(S), ST(I), TE(I) | + | - | - | + | - | - |
| Witsand | Sheep 2 | AMP(I), SF(S), ST(I), TE(R) | - | - | - | + | - | - |
| Witsand | Deer 1 | AMP(I), SF(S), ST(R), TE(S) | - | - | - | + | - | - |
| Witsand | Deer 2 | AMP(S), SF(R), ST(R), TE(R) | - | + | + | + | - | + |
| Witsand | Deer 3 | AMP(I), SF(R), ST(R), TE(R) | - | + | + | + | - | + |
| Witsand | Springbok 1 | AMP(S), SF(S), ST(R), TE(S) | + | - | - | + | - | - |
| Witsand | Springbok 2 | AMP(S), SF(S), ST(I), TE(S) | + | - | - | + | - | - |
| Wildlife Species | Farm Location | Farm Type | Number of Faecal Samples |
|---|---|---|---|
| Springbok (Antidorcas marsupialis) | Witsand | Co-grazing | 5 |
| Fallow deer (Dama dama) | Witsand | Co-grazing | 5 |
| Sheep (Ovis aries) | Witsand | Co-grazing | 5 |
| Cattle (Bos taurus) | Witsand | Co-grazing | 5 |
| Eland (Taurotragus oryx) | Bredasdorp | No co-grazing | 5 |
| Black wildebeest (Connochaetes gnou) | Bredasdorp | No co-grazing | 5 |
| Sheep (Ovis aries) | Bredasdorp | No co-grazing | 5 |
| Cattle (Bos taurus) | Bredasdorp | No co-grazing | 5 |
| Antibiotic | Gene | Primers F: 5′-3′ Primers R: 5′-3′ | bp | Reaction Conditions | Reference |
|---|---|---|---|---|---|
| Tetracycline | tetA | F: GGCGGTCTTCTTCATCATGC R: CGGCAGGCAGAGCAAGTAGA | 502 | 15 min at 95 °C;35 cycles of: 20 s at 95 °C, 40 s at 66 °C, 40 s at 72 °C; 4 min at 72 °C. | Adapted from [15] |
| tetB | F: CATTAATAGGCGCATCGCTG R: TGAAGGTCATCGATAGCAGG | 930 | |||
| Sulphafurazole | sul1 | F: CGGCGTGGGCTACCTGAACG R: GCCGATCGCGTGAAGTTCCG | 433 | 15 min 95 °C;30 cycles of: 20 s at 95 °C, 40 s at 66 °C, 40 s at 72 °C; 4 min at 72 °C. | Adapted from [25] |
| sul2 | F: CGGCATCGTCAACATAACCT R: TGTGCGGATGAAGTCAGCTC | 721 | |||
| Ampicillin | blaCMY | F: GACAGCCTCTTTCTCCACA R: TGGACACGAAGGCTACGTA | 1000 | 15 min at 94 °C;30 cycles of: 1 min at 94 °C, 1 min at 55 °C, 1 min at 72 °C; 10 min at 72 °C. | [25] |
| Streptomycin | aadA1 | F: GTGGATGGCGGCCTGAAGCC R: AATGCCCAGTCGGCAGCG | 525 | 15 min at 95 °C;35 cycles of: 1 min at 94 °C, 1 min at 60 °C, 1 min at 72 °C; 7 min at 72 °C. | Adapted from [15] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
van den Honert, M.S.; Gouws, P.A.; Hoffman, L.C. Escherichia coli Antibiotic Resistance Patterns from Co-Grazing and Non-Co-Grazing Livestock and Wildlife Species from Two Farms in the Western Cape, South Africa. Antibiotics 2021, 10, 618. https://doi.org/10.3390/antibiotics10060618
van den Honert MS, Gouws PA, Hoffman LC. Escherichia coli Antibiotic Resistance Patterns from Co-Grazing and Non-Co-Grazing Livestock and Wildlife Species from Two Farms in the Western Cape, South Africa. Antibiotics. 2021; 10(6):618. https://doi.org/10.3390/antibiotics10060618
Chicago/Turabian Stylevan den Honert, Michaela Sannettha, Pieter Andries Gouws, and Louwrens Christiaan Hoffman. 2021. "Escherichia coli Antibiotic Resistance Patterns from Co-Grazing and Non-Co-Grazing Livestock and Wildlife Species from Two Farms in the Western Cape, South Africa" Antibiotics 10, no. 6: 618. https://doi.org/10.3390/antibiotics10060618
APA Stylevan den Honert, M. S., Gouws, P. A., & Hoffman, L. C. (2021). Escherichia coli Antibiotic Resistance Patterns from Co-Grazing and Non-Co-Grazing Livestock and Wildlife Species from Two Farms in the Western Cape, South Africa. Antibiotics, 10(6), 618. https://doi.org/10.3390/antibiotics10060618

