Single-Chamber Microbial Fuel Cell with an Innovative Sensing Component for Real-Time Continual Monitoring of a Wide Range of Cr(VI) Concentrations in Wastewater
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Gene Cloning, Genetic Transformation, and Biosensor Construction
2.3. Evaluation of the Growth Rate of ChrA–ChB–E. coli
2.4. Adaptability of ChrA–ChrB–E. coli to Environmental Conditions
2.4.1. Tolerance of ChrA–ChrB–E. coli to Varying Cr(VI) Concentrations
2.4.2. Effects of Temperature and pH on Cr(VI) Reduction by ChrA–ChrB–E. coli
2.4.3. Effect of Carbon Source on Cr(VI) Removal by ChrA–ChrB–E. coli
2.4.4. Effects of Forms of Cr(VI), Cations, and Anions on Cr(VI) Removal by ChrA–ChrB–E. coli
2.5. Construction of the Single-Chamber, Microbial Fuel Cell-Based Biosensor
2.6. Operating Characteristics of the SCMFC-Based Biosensor
2.6.1. Optimal Operating Resistance
2.6.2. Optimal Liquid Flow Rate or LRT
2.6.3. Optimal Stable Time or Response Time
2.6.4. Electrochemical Testing
2.7. Relationship Between Cr(VI) Concentration and Voltage Output of the SCMFC-Based Biosensor in Continual Operation
2.8. Measurement of Cr(VI) in Synthetic Wastewater Under Continual Operation of the Biosensor
2.9. Statistical Analysis
3. Results and Discussion
3.1. Construction of Recombinant E. coli
3.2. Characteristics of the Recombinant ChrA–ChB–E. coli Strain
3.3. Effects of Coexisting Compounds on the Removal Efficiency of Cr(VI) by the Recombinant ChrA–ChB–E. coli Strain
3.4. Determination of the Optimal Operational Parameters for the SCMFC-Based Biosensor
3.5. Relationship Between Cr(VI) Concentration and the Voltage Output of the SCMFC-Based Biosensor in Continual Operation
3.6. Cr(VI) Measurement in Synthetic Wastewater Using the SCMFC-Based Biosensor in Continual Operation
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zheng, S.; Wang, Q.; Yuan, Y.; Sun, W. Human health risk assessment of heavy metals in soil and food crops in the Pearl River Delta urban agglomeration of China. Food Chem. 2020, 316, 126213. [Google Scholar] [CrossRef]
- Ahmad, K.; Iqhrammullah, M.; Rizki, D.R.; Aulia, A.; Mairizal, A.Q.; Purnama, A.; Qanita, I.; Abdulmadjid, S.; Puspita, K. Heavy metal contamination in aquatic and terrestrial animals resulted from anthropogenic activities in Indonesia: A review. Asian J. Water Environ. Pollut. 2022, 19, 1–8. [Google Scholar] [CrossRef]
- Wise, J.P.; Young, J.L.; Cai, J.; Cai, L. Current understanding of hexavalent chromium [Cr(VI)] neurotoxicity and new perspectives. Environ. Int. 2022, 158, 106877. [Google Scholar] [CrossRef]
- Zhang, X.; Liu, Y.; Li, C. Influence of Cr (VI) concentration on Cr (VI) reduction and electricity production in microbial fuel cell. Environ. Sci. Pollut. Res. Int. 2021, 28, 54170–54176. [Google Scholar] [CrossRef] [PubMed]
- Meaza, I.; Williams, A.R.; Wise, S.S.; Lu, H.; Pierce, J.W. Carcinogenic mechanisms of hexavalent chromium: From DNA breaks to chromosome instability and neoplastic transformation. Curr. Environ. Health Rep. 2024, 11, 484–546. [Google Scholar] [CrossRef] [PubMed]
- Ramli, N.N.; Othman, A.R.; Kurniawan, S.B.; Abdullah, S.R.S.; Hasan, H.A. Metabolic pathway of Cr(VI) reduction by bacteria: A review. Microbiol. Res. 2023, 268, 127288. [Google Scholar] [CrossRef]
- De Oliveira Farias, E.A.; dos Santos, M.C.; de Araujo Dionísio, N.; Quelemes, P.V.; Leite, J.R.D.S.A.; Eaton, P.; Eiras, C. Layer-by-Layer films based on biopolymers extracted from red seaweeds and polyaniline applications in electrochemical sensors of chromium VI. Mater. Sci. Eng. B 2015, 200, 9–21. [Google Scholar] [CrossRef]
- Wu, L.C.; Wang, G.H.; Tsai, T.H.; Lo, S.Y.; Cheng, C.Y.; Chung, Y.C. Three-stage single-chambered microbial fuel cell biosensor inoculated with Exiguobacterium aestuarii YC211 for continuous chromium (VI) measurement. Sensors 2019, 19, 1418. [Google Scholar] [CrossRef]
- Zhang, X.; Liu, W.; Li, X.; Zhang, Z.; Shan, D.; Xia, H.; Zhang, S.; Lu, X. Ultrahigh selective colorimetric quantification of chromium (VI) ions based on gold amalgam catalyst oxidoreductase-like activity in water. Anal. Chem. 2018, 90, 14309–14315. [Google Scholar] [CrossRef]
- Mutuyimana, F.P.; Liu, J.; Nsanzamahoro, S.; Na, M.; Chen, H.; Chen, X. Yellow-emissive carbon dots as a fluorescent probe for chromium(VI). Microchim. Acta 2019, 186, 163. [Google Scholar] [CrossRef]
- Bosu, S.; Rajamohan, N.; Sagadevan, S.; Raut, N. Biomass derived green carbon dots for sensing applications of effective detection of metallic contaminants in the environment. Chemosphere 2023, 345, 140471. [Google Scholar] [CrossRef] [PubMed]
- Hilali, N.; Mohammadi, H.; Amine, A.; Zine, N.; Errachid, A. Recent advances in electrochemical monitoring of chromium. Sensors 2020, 20, 5153. [Google Scholar] [CrossRef] [PubMed]
- Chung, S.W.C. Update on chromium speciation analysis in foods: A review of advances in analytical methods and dietary exposure assessment. Food Addit. Contam. Part A 2024, 41, 782–789. [Google Scholar] [CrossRef]
- Ghayyem, S.; Swaidan, A.; Barras, A.; Dolci, M.; Faridbod, F.; Szunerits, S.; Boukherroub, R. Colorimetric detection of chromium (VI) ion using poly(N-phenylglycine) nanoparticles acting as a peroxidase mimetic catalyst. Talanta 2021, 226, 122082. [Google Scholar] [CrossRef]
- Sun, X.; Jin, L.; Zhou, F.; Jin, K.; Wang, L.; Zhang, X.; Ren, H.; Huang, H. Patent analysis of chemical treatment technology for wastewater: Status and future trends. Chemosphere 2022, 307, 135802. [Google Scholar] [CrossRef]
- Wang, G.H.; Cheng, C.Y.; Liu, M.H.; Chen, T.Y.; Hsieh, M.C.; Chung, Y.C. Utility of Ochrobactrum anthropi YC152 in a microbial fuel cell as an early warning device for hexavalent chromium determination. Sensors 2016, 16, 1272. [Google Scholar] [CrossRef]
- Xu, Z.; Liu, B.; Dong, Q.; Lei, Y.; Li, Y.; Ren, J. Flat microliter membrane-based microbial fuel cell as “on-line sticker sensor” for self-supported in situ monitoring of wastewater shocks. Bioresour. Technol. 2015, 197, 244–251. [Google Scholar] [CrossRef]
- Chung, H.; Ju, W.J.; Jho, E.H.; Nam, K. Applicability of a submersible microbial fuel cell for Cr(VI) detection in water. Environ. Monit. Assess. 2016, 188, 613. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.C.; Tsai, T.H.; Liu, M.H.; Kuo, J.L.; Chang, Y.C.; Chung, Y.C. A green microbial fuel cell-based biosensor for in situ chromium (VI) measurement in electroplating wastewater. Sensors 2017, 17, 2461. [Google Scholar] [CrossRef]
- Lazzarini Behrmann, I.C.; Grattieri, M.; Minteer, S.D.; Ramirez, S.A.; Vullo, D.L. Online self-powered Cr(VI) monitoring with autochthonous Pseudomonas and a bio-inspired redox polymer. Anal. Bioanal. Chem. 2020, 412, 6449–6457. [Google Scholar] [CrossRef]
- Chang, C.C.; Li, S.L.; Wu, Z.X.; Yu, C.P. Developing a novel computer numerical control-fabricated laminar-flow microfluidic microbial fuel cells as the bioelectrochemical sensor and power source: Enrichment, operation, and Cr(VI) detection. Biosens. Bioelectron. 2023, 226, 115119. [Google Scholar] [CrossRef] [PubMed]
- Gul, H.; Raza, W.; Lee, J.; Azam, M.; Ashraf, M.; Kim, K. Progress in microbial fuel cell technology for wastewater treatment and energy harvesting. Chemosphere 2021, 281, 130828. [Google Scholar] [CrossRef]
- Varshney, A.; Sharma, L.; Pandit, C.; Gupta, P.K.; Mathuriya, A.S.; Pandit, S.; Lahiri, D.; Nag, M. Upadhye, V.J. Microbial fuel cell-based biosensors and Applications. Appl. Biochem. Biotechnol. 2023, 195, 3508–3531. [Google Scholar] [CrossRef] [PubMed]
- Zhou, S.M.; Dong, L.L.; He, Y.; Xiao, H. Characterization of chromate resistance in genetically engineered Escherichia coli expressing chromate ion transporter ChrA. J. South. Med. Univ. 2017, 37, 1290–1295. [Google Scholar]
- Fernández, P.M.; Viñarta, S.C.; Bernal, A.R.; Cruz, E.L.; Figueroa, L.I.C. Bioremediation strategies for chromium removal: Current research, scale-up approach and future perspectives. Chemosphere 2018, 208, 139–148. [Google Scholar] [CrossRef] [PubMed]
- Elahi, A.; Arooj, I.; Bukhari, D.A.; Rehman, A. Successive use of microorganisms to remove chromium from wastewater. Appl. Microbiol. Biotechnol. 2020, 104, 3729–3743. [Google Scholar] [CrossRef]
- Akhzari, F.; Naseri, T.; Mousavi, S.M.; Khosravi-Darani, K. A sustainable solution for alleviating hexavalent chromium from water streams using Lactococcus lactis AM99 as a novel Cr(VI)-reducing bacterium. J. Environ. Manage. 2024, 353, 120190. [Google Scholar] [CrossRef]
- Thatoi, H.; Das, S.; Mishra, J. Bacterial chromate reductase, a potential enzyme for bioremediation of hexavalent chromium: A review. J. Environ. Manag. 2014, 146, 383–399. [Google Scholar] [CrossRef]
- Sarkar, A.; Sar, P.; Islam, E. Hexavalent chromium reduction by Microbacterium oleivorans A1: A possible mechanism of chromate-detoxification. Recent Pat. Biotechnol. 2015, 9, 116–129. [Google Scholar] [CrossRef]
- Valenzuela-García, L.I.; Zapata, B.L.; Ramírez-Ramírez, N.; Huchin-Mian, J.P.; Robleto, E.A.; Ayala García, V.M.; Pedraza-Reyes, M. Novel biochemical properties and physiological role of the 22 flavin mononucleotide oxidoreductase YhdA from Bacillus subtilis. Appl. Environ. Microbiol. 2020, 86, e01688-20. [Google Scholar] [CrossRef]
- Zhou, X.; Li, J.; Wang, W.; Yang, F.; Fan, B.; Zhang, C.; Ren, X.; Liang, F.; Cheng, R.; Jiang, F.; et al. Removal of chromium (VI) by Escherichia coli cells expressing cytoplasmic or surface-displayed ChrB: A comparative study. J. Microbiol. Biotechnol. 2020, 30, 996–1004. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.H.; Cheng, C.Y.; Tsai, T.H.; Chiang, P.K.; Chung, Y.C. Highly sensitive luminescent bioassay using recombinant Escherichia coli biosensor for rapid detection of low Cr(VI) concentration in environmental water. Biosensors 2021, 11, 357. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.H.; Tang, C.H.; Cheng, C.Y.; Chung, Y.C. Improving the practicality of recombinant Escherichia coli biosensor in detecting trace Cr(VI) by modifying the cryogenic storage conditions of biosensors and applying simple pretreatment. J. Environ. Sci. Health Part A 2023, 58, 1028–1038. [Google Scholar] [CrossRef]
- He, Y.; Dong, L.; Zhou, S.; Jia, Y.; Gu, R.; Bai, Q.; Gao, J.; Li, Y.; Xiao, H. Chromium resistance characteristics of Cr(VI) resistance genes ChrA and ChrB in Serratia sp. S2. Ecotoxicol. Environ. Saf. 2018, 157, 7417–7423. [Google Scholar] [CrossRef] [PubMed]
- Dewi, K.S.; Fuad, A.M. Improving the expression of human granulocyte colony stimulating factor in Escherichia coli by reducing the GC-content and increasing mRNA folding free energy at 5’-terminal end. Adv. Pharm. Bull. 2020, 10, 610–616. [Google Scholar] [CrossRef]
- Santoro, C.; Agrios, A.; Pasaogullari, U.; Li, B. Effects of gas diffusion layer (GDL) and micro porous layer (MPL) on cathode performance in microbial fuel cells (MFCs). Int. J. Hydrog. Energy 2011, 36, 13096–13104. [Google Scholar] [CrossRef]
- Harnisch, F.; Freguia, S. A basic tutorial on cyclic voltammetry for the investigation of electroactive microbial biofilms. Chem Asian J. 2012, 7, 466–475. [Google Scholar] [CrossRef]
- Lace, A.; Ryan, D.; Bowkett, M.; Cleary, L. Chromium monitoring in water by colorimetry using optimised 1,5-diphenylcarbazide method. Int. J. Environ. Res. Public Health 2019, 16, 1803. [Google Scholar] [CrossRef]
- USEPA. Methods for Chemical Analysis of Water and Wastes, Method 218.4, Hexavalent Chromium, EPA/600/4-79/020 March 1983. Available online: https://www.wbdg.org/FFC/EPA/EPACRIT/epa600_4_79_020.pdf (accessed on 3 January 2025).
- USEPA. Method 7199: Determination of Hexavalent Chromium in Drinking Water, Groundwater, and Industrial Wastewater Effluents by Ion Chromatography. 1996. Available online: https://www.epa.gov/sites/default/files/2015-12/documents/7199.pdf (accessed on 5 January 2025).
- Wilfinger, W.W.; Mackey, K.; Chomczynski, P. Effect of pH and ionic strength on the spectrophotometric assessment of nucleic acid purity. BioTechniques 1997, 22, 474–481. [Google Scholar] [CrossRef]
- Karamzadeh, M.; Kadivarian, M.; Mahmoodi, P.; Asefi, S.S.; Taghipour, A. Modeling and experimental investigation of the effect of carbon source on the performance of tubular microbial fuel cell. Sci. Rep. 2023, 13, 11070. [Google Scholar] [CrossRef]
- de Los Ángeles Fernandez, M.; de Los Ángeles Sanromán, M.; Marks, S.; Makinia, J.; Gonzalez Del Campo, A.; Rodrigo, M.; Fernandez, F.J. A grey box model of glucose fermentation and syntrophic oxidation in microbial fuel cells. Bioresour. Technol. 2016, 200, 396–404. [Google Scholar] [CrossRef] [PubMed]
- Rabus, R.; Boll, M.; Heider, J.; Meckenstock, R.U.; Buckel, W.; Einsle, O.; Ermler, U.; Golding, B.T.; Gunsalus, R.P.; Kroneck, P.M.; et al. Anaerobic microbial degradation of hydrocarbons: From enzymatic reactions to the environment. J. Mol. Microbiol. Biotechnol. 2016, 26, 5–28. [Google Scholar] [CrossRef] [PubMed]
- Shu, W.; Zhang, Y.; Wen, D.; Wu, Q.; Liu, H.; Cui, M.H.; Fu, B.; Zhang, J.; Yao, Y. Anaerobic biodegradation of levofloxacin by enriched microbial consortia: Effect of electron acceptors and carbon source. J. Hazard. Mater. 2021, 414, 125520. [Google Scholar] [CrossRef]
- Chen, C.Y.; Chen, T.Y.; Chung, Y.C. A comparison of bioelectricity in microbial fuel cells with aerobic and anaerobic anodes. Environ. Technol. 2014, 35, 286–293. [Google Scholar] [CrossRef]
- Degrenne, N.; Buret, F.; Allard, B.; Bevilacqua, P. Electrical energy generation from a large number of microbial fuel cells operating at maximum power point electrical load. J. Power Sourc. 2012, 205, 188–193. [Google Scholar] [CrossRef]
- Ali, J.; Zheng, C.; Lyu, T.; Oladoja, N.A.; Lu, Y.; An, W.; Yang, Y. Enhanced bioelectroremediation of heavy metal contaminated groundwater through advancing a self-standing cathode. Water Res. 2024, 256, 121625. [Google Scholar] [CrossRef] [PubMed]
- Chaprão, M.J.; Ferreira, I.N.S.; Correa, P.F.; Rufino, R.D.; Luna, J.M.; Silva, E.J.; Sarubbo, L.A. Application of bacterial and yeast biosurfactants for enhanced removal and biodegradation of motor oil from contaminated sand. Electron. J. Biotechnol. 2015, 18, 471–479. [Google Scholar] [CrossRef]
- Gu, T.; Niu, W.; Huo, L.; Zhou, L.; Jia, Y.; Li, R.; Wu, Y.; Zhong, H. Molasses-based in situ bio-sequestration of Cr(VI) in groundwater under flow condition. Environ. Pollut. 2024, 344, 123337. [Google Scholar] [CrossRef]
- Grösbacher, M.; Eckert, D.; Cirpka, O.A.; Griebler, C. Contaminant concentration versus flow velocity: Drivers of biodegradation and microbial growth in groundwater model systems. Biodegradation 2018, 29, 211–232. [Google Scholar] [CrossRef]
- You, L.X.; Liu, L.D.; Xiao, Y.; Dai, Y.F.; Chen, B.L.; Jiang, Y.X. Flavins mediate extracellular electron transfer in gram-positive Bacillus megaterium strain LLD-1. Bioelectrochemistry 2018, 119, 196–202. [Google Scholar] [CrossRef]
- Alfadaly, R.A.; Elsayed, A.; Hassan, R.Y.A.; Noureldeen, A.; Darwish, H.; Gebreil, A.S. Microbial sensing and removal of heavy metals: Bioelectrochemical detection and removal of chromium(VI) and cadmium(II). Molecules 2021, 26, 2549. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Wang, J.; Liu, J.; Wang, Y.; Bi, C.; Zhang, X. Engineering an electroactive Escherichia coli for the microbial electrosynthesis of succinate from glucose and CO2. Microb. Cell Fact. 2019, 18, 15. [Google Scholar] [CrossRef] [PubMed]
- Gu, R.; Gao, J.; Dong, L.; Liu, Y.; Li, X.; Bai, Q.; Jia, Y.; Xiao, H. Chromium metabolism characteristics of coexpression of ChrA and ChrT gene. Ecotoxicol. Environ. Saf. 2020, 204, 111060. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.; Lai, X.; Zhao, S.; Lu, Z.; Han, P.; Chen, L. A simple and feasible fluorescent approach for rapid detection of hexavalent chromium based on gold nanoclusters. Food Chem. 2023, 402, 134251. [Google Scholar] [CrossRef]
- Zhou, Q.Y.; Song, Y.; Yan, X.X.; Yu, Y.; Liu, L.L.; Qiu, H.D.; Li, P.; Su, X.D. A convenient colorimetric assay for Cr(VI) detection based on homogeneous Cu(II)-GMP system with oxidoreductase-like activity. Talanta 2025, 281, 126884. [Google Scholar] [CrossRef]
Primer Name | Primer Sequences (5′→3′) |
---|---|
Chr-Forward primer | |
Nco I-ChrA-f | C↓CATGGATGAGCAAAACGGTCGTTCT |
Nco I-ChrB-f | C↓CATGGATGCGTGTCTGGCGAACCCTGA |
Chr-Reverse primer | |
Xho I-ChrA-r | C↓TCGAGTTCTGCGCCGGACAGT |
Not I-ChrB-r | GC↓GGCCGCTCACTCTGCGGAAGAACGA |
Inlet Cr(VI) Concentration (mg/L) | |||||
---|---|---|---|---|---|
0.02 | 0.5 | 5 | 50 | 150 | |
AAS 1 | 0.0213 ± 0.0024 | 0.502 ± 0.020 | 5.01 ± 0.03 | 52.6 ± 0.5 | 142.8 ± 1.26 |
Colorimetric method | 0.0202 ± 0.0081 | 0.4981 ± 0.012 | 4.96 ± 0.15 | 47.3 ± 2.4 | 155.2 ± 3.71 |
Ion chromatography | 0.0201 ± 0.0023 | 0.4982 ± 0.008 | 5.01 ± 0.08 | 51.9 ± 0.9 | 152.4 ± 0.82 |
SCMFC-based biosensor | 0.0205 ± 0.0035 | 0.4967 ± 0.018 | 4.98 ± 0.07 | 51.2 ± 1.2 | 147.4 ± 0.96 |
Deviation (%) 2 | 6.5 | 0.4 | 0.2 | 5.2 | −4.8 |
Deviation (%) 3 | 1 | −0.38 | −0.8 | −5.4 | 3.47 |
Deviation (%) 4 | 0.5 | −0.36 | 0.2 | 3.8 | 1.6 |
Deviation (%) 5 | 2.5 | −0.66 | −0.4 | 2.4 | −1.73 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, G.-H.; Kuo, J.-T.; Cheng, C.-Y.; Chung, Y.-C. Single-Chamber Microbial Fuel Cell with an Innovative Sensing Component for Real-Time Continual Monitoring of a Wide Range of Cr(VI) Concentrations in Wastewater. Biosensors 2025, 15, 158. https://doi.org/10.3390/bios15030158
Wang G-H, Kuo J-T, Cheng C-Y, Chung Y-C. Single-Chamber Microbial Fuel Cell with an Innovative Sensing Component for Real-Time Continual Monitoring of a Wide Range of Cr(VI) Concentrations in Wastewater. Biosensors. 2025; 15(3):158. https://doi.org/10.3390/bios15030158
Chicago/Turabian StyleWang, Guey-Horng, Jong-Tar Kuo, Chiu-Yu Cheng, and Ying-Chien Chung. 2025. "Single-Chamber Microbial Fuel Cell with an Innovative Sensing Component for Real-Time Continual Monitoring of a Wide Range of Cr(VI) Concentrations in Wastewater" Biosensors 15, no. 3: 158. https://doi.org/10.3390/bios15030158
APA StyleWang, G.-H., Kuo, J.-T., Cheng, C.-Y., & Chung, Y.-C. (2025). Single-Chamber Microbial Fuel Cell with an Innovative Sensing Component for Real-Time Continual Monitoring of a Wide Range of Cr(VI) Concentrations in Wastewater. Biosensors, 15(3), 158. https://doi.org/10.3390/bios15030158