Real-Time On-Site Monitoring of Viruses in Wastewater Using Nanotrap® Particles and RICCA Technologies
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Sample Preparation
2.3. Virus Concentration
2.4. Nucleic Acid Extraction
2.5. RNA Amplification and Detection
3. Results and Discussion
3.1. Effectiveness of Nanotrap Particles for Virus Concentration in Wastewater
3.2. Evaluation of the RICCA Amplification for SARS-CoV-2 Virus and PMMoV
3.3. Proof-of-Concept Demonstration for QPsor Sensing System
3.4. QPsor’s Underlying Application for Remote Monitoring of On-Site Wastewater Treatment Plants
4. Conclusions
5. Patents
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AVE | QIAamp viral elution buffer |
| Ct | Cycle threshold |
| KCl | Potassium chloride |
| LF pad | Lateral flow strip pad |
| NMVPs | Nanotrap magnetic virus particles |
| NSG | Nippon sheet glass |
| NTPs | Nanotrap microbiome particles |
| NaCl | Sodium chloride |
| PBS | Phosphate-buffered saline |
| PCR | Polymerase chain reaction |
| PEG | Polyethylene glycol |
| PMMoV | Pepper mottle mosaic virus |
| QPsor | Quick Poop Sensor |
| RICCA | RNA Isothermal Co-Assisted and Coupled Amplification |
| RNA | Ribonucleic acid |
| RT-qPCR | Reverse transcription-quantitative polymerase chain reaction |
| SARS-CoV-2 | Severe acute respiratory syndrome coronavirus 2 |
| WBE | Wastewater-based epidemiology |
| WWTP | Wastewater treatment plant |
| qPCR | Quantitative polymerase chain reaction |
References
- Cevik, M.; Kuppalli, K.; Kindrachuk, J.; Peiris, M. Virology, Transmission, and Pathogenesis of SARS-CoV-2. BMJ 2020, 371, m3862. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, M.; Hu, P.; Xu, X.; Ai, J.; Li, Y.; Bao, Y.; Tangamornsuksan, W.; Chan, A.; Xie, S.; Hu, H.; et al. A Look Back at the First Wave of COVID-19 in China: A Systematic Review and Meta-Analysis of Mortality and Health Care Resource Use among Severe or Critical Patients. PLoS ONE 2022, 17, e0265117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ando, H.; Murakami, M.; Ahmed, W.; Iwamoto, R.; Okabe, S.; Kitajima, M. Wastewater-Based Prediction of COVID-19 Cases Using a Highly Sensitive SARS-CoV-2 RNA Detection Method Combined with Mathematical Modeling. Environ. Int. 2023, 173, 107743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Liu, P.; Zhang, H.; Ibaraki, M.; VanTassell, J.; Geith, K.; Cavallo, M.; Kann, R.; Saber, L.; Kraft, C.S.; et al. Early Warning of a COVID-19 Surge on a University Campus Based on Wastewater Surveillance for SARS-CoV-2 at Residence Halls. Sci. Total Environ. 2022, 821, 153291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miura, F.; Kitajima, M.; Omori, R. Duration of SARS-CoV-2 Viral Shedding in Faeces as a Parameter for Wastewater-Based Epidemiology: Re-Analysis of Patient Data Using a Shedding Dynamics Model. Sci. Total Environ. 2021, 769, 144549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nourbakhsh, S.; Fazil, A.; Li, M.; Mangat, C.S.; Peterson, S.W.; Daigle, J.; Langner, S.; Shurgold, J.; D’Aoust, P.; Delatolla, R.; et al. A Wastewater-Based Epidemic Model for SARS-CoV-2 with Application to Three Canadian Cities. Epidemics 2022, 39, 100560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bikbov, B.; Bikbov, A. Maximum Incubation Period for COVID-19 Infection: Do We Need to Rethink the 14-Day Quarantine Policy? Travel. Med. Infect. Dis. 2021, 40, 101976. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.; Kennedy, L.C.; Wolfe, M.K.; Criddle, C.S.; Duong, D.H.; Topol, A.; White, B.J.; Kantor, R.S.; Nelson, K.L.; Steele, J.A.; et al. SARS-CoV-2 RNA Is Enriched by Orders of Magnitude in Primary Settled Solids Relative to Liquid Wastewater at Publicly Owned Treatment Works. Environ. Sci. 2022, 8, 757–770. [Google Scholar] [CrossRef] [Scilit]
- Lauer, S.A.; Grantz, K.H.; Bi, Q.; Jones, F.K.; Zheng, Q.; Meredith, H.R.; Azman, A.S.; Reich, N.G.; Lessler, J. The Incubation Period of Coronavirus Disease 2019 (COVID-19) From Publicly Reported Confirmed Cases: Estimation and Application. Ann. Intern. Med. 2020, 172, 577–582. [Google Scholar] [CrossRef] [Scilit]
- Park, S.; Lee, C.-W.; Park, D.-I.; Woo, H.-Y.; Cheong, H.S.; Shin, H.C.; Ahn, K.; Kwon, M.-J.; Joo, E.-J. Detection of SARS-CoV-2 in Fecal Samples From Patients With Asymptomatic and Mild COVID-19 in Korea. Clin. Gastroenterol. Hepatol. 2021, 19, 1387–1394.e2. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Gao, G.; Xu, Y.; Pu, L.; Wang, Q.; Wang, L.; Wang, W.; Song, Y.; Chen, M.; Wang, L.; et al. SARS-CoV-2–Positive Sputum and Feces After Conversion of Pharyngeal Samples in Patients With COVID-19. Ann. Intern. Med. 2020, 172, 832–834. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Zheng, J.; Guo, L.; Yao, H.; Wang, L.; Xia, X.; Zhang, W. Fecal Viral Shedding in COVID-19 Patients: Clinical Significance, Viral Load Dynamics and Survival Analysis. Virus Res. 2020, 289, 198147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fuschi, C.; Pu, H.; Negri, M.; Colwell, R.; Chen, J. Wastewater-Based Epidemiology for Managing the COVID-19 Pandemic. ACS EST Water 2021, 1, 54–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maryam, S.; Ul Haq, I.; Yahya, G.; Ul Haq, M.; Algammal, A.M.; Saber, S.; Cavalu, S. COVID-19 Surveillance in Wastewater: An Epidemiological Tool for the Monitoring of SARS-CoV-2. Front. Cell Infect. Microbiol. 2023, 12, 978643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Honda, R.; Murakami, M.; Hata, A.; Ihara, M. Public Health Benefits and Ethical Aspects in the Collection and Open Sharing of Wastewater-Based Epidemic Data on COVID-19. Data Sci. J. 2021, 20, 27. [Google Scholar] [CrossRef] [Scilit]
- Gandhi, M.; Yokoe, D.S.; Havlir, D.V. Asymptomatic Transmission, the Achilles’ Heel of Current Strategies to Control COVID-19. N. Engl. J. Med. 2020, 382, 2158–2160. [Google Scholar] [CrossRef] [Scilit]
- Kumblathan, T.; Liu, Y.; Uppal, G.K.; Hrudey, S.E.; Li, X.-F. Wastewater-Based Epidemiology for Community Monitoring of SARS-CoV-2: Progress and Challenges. ACS Environ. Au 2021, 1, 18–31. [Google Scholar] [CrossRef] [Scilit]
- McGowan, J.; Borucki, M.; Omairi, H.; Varghese, M.; Vellani, S.; Chakravarty, S.; Fan, S.; Chattopadhyay, S.; Siddiquee, M.; Thissen, J.B.; et al. SARS-CoV-2 Monitoring in Wastewater Reveals Novel Variants and Biomarkers of Infection. Viruses 2022, 14, 2032. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, J.; Ahmad, M.; Usman, A.R.A.; Al-Wabel, M.I. Prevalence of Human Pathogenic Viruses in Wastewater: A Potential Transmission Risk as Well as an Effective Tool for Early Outbreak Detection for COVID-19. J. Environ. Manag. 2021, 298, 113486. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez, R.; Curtis, K.; Bivins, A.; Bibby, K.; Weir, M.H.; Yetka, K.; Thompson, H.; Keeling, D.; Mitchell, J.; Gonzalez, D. COVID-19 Surveillance in Southeastern Virginia Using Wastewater-Based Epidemiology. Water Res. 2020, 186, 116296. [Google Scholar] [CrossRef] [Scilit]
- Betancourt, W.Q.; Schmitz, B.W.; Innes, G.K.; Prasek, S.M.; Pogreba Brown, K.M.; Stark, E.R.; Foster, A.R.; Sprissler, R.S.; Harris, D.T.; Sherchan, S.P.; et al. COVID-19 Containment on a College Campus via Wastewater-Based Epidemiology, Targeted Clinical Testing and an Intervention. Sci. Total Environ. 2021, 779, 146408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kitajima, M.; Murakami, M.; Kadoya, S.S.; Ando, H.; Kuroita, T.; Katayama, H.; Imoto, S. Association of SARS-CoV-2 Load in Wastewater With Reported COVID-19 Cases in the Tokyo 2020 Olympic and Paralympic Village From July to September 2021. JAMA Netw Open 2022, 5, e2226822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anand, U.; Adelodun, B.; Pivato, A.; Suresh, S.; Indari, O.; Jakhmola, S.; Jha, H.C.; Jha, P.K.; Tripathi, V.; Di Maria, F. A Review of the Presence of SARS-CoV-2 RNA in Wastewater and Airborne Particulates and Its Use for Virus Spreading Surveillance. Environ. Res. 2021, 196, 110929. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bivins, A.; Lott, M.; Shaffer, M.; Wu, Z.; North, D.; Lipp, E.K.; Bibby, K. Building-Level Wastewater Surveillance Using Tampon Swabs and RT-LAMP for Rapid SARS-CoV-2 RNA Detection. Environ. Sci. 2022, 8, 173–183. [Google Scholar] [CrossRef] [Scilit]
- Peccia, J.; Zulli, A.; Brackney, D.E.; Grubaugh, N.D.; Kaplan, E.H.; Casanovas-Massana, A.; Ko, A.I.; Malik, A.A.; Wang, D.; Wang, M.; et al. Measurement of SARS-CoV-2 RNA in Wastewater Tracks Community Infection Dynamics. Nat. Biotechnol. 2020, 38, 1164–1167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, G.; Wu, J.; Weidhaas, J.; Li, X.; Chen, Y.; Mueller, J.; Li, J.; Kumar, M.; Zhou, X.; Arora, S.; et al. Artificial Neural Network-Based Estimation of COVID-19 Case Numbers and Effective Reproduction Rate Using Wastewater-Based Epidemiology. Water Res. 2022, 218, 118451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tiwari, A.; Lipponen, A.; Hokajärvi, A.-M.; Luomala, O.; Sarekoski, A.; Rytkönen, A.; Österlund, P.; Al-Hello, H.; Juutinen, A.; Miettinen, I.T.; et al. Detection and Quantification of SARS-CoV-2 RNA in Wastewater Influent in Relation to Reported COVID-19 Incidence in Finland. Water Res. 2022, 215, 118220. [Google Scholar] [CrossRef] [Scilit]
- Zulli, A.; Pan, A.; Bart, S.M.; Crawford, F.W.; Kaplan, E.H.; Cartter, M.; Ko, A.I.; Sanchez, M.; Brown, C.; Cozens, D.; et al. Predicting Daily COVID-19 Case Rates from SARS-CoV-2 RNA Concentrations across a Diversity of Wastewater Catchments. FEMS Microbes 2022, 2, xtab022. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, W.; Smith, W.; Tiwari, A.; Bivins, A.; Simpson, S. Application of Adsorption-Extraction and Nanotrap® Microbiome A Particles Workflows for Detection and Quantification of Indicator, Enteric, and Respiratory Viruses in Aircraft Lavatory Wastewater. Preprints 2023, 2023050521. [Google Scholar]
- Fonseca, M.S.; Machado, B.A.S.; de Araújo Rolo, C.; Hodel, K.V.S.; dos Santos Almeida, E.; de Andrade, J.B. Evaluation of SARS-CoV-2 Concentrations in Wastewater and River Water Samples. Case Stud. Chem. Environ. Eng. 2022, 6, 100214. [Google Scholar] [CrossRef] [Scilit]
- Galani, A.; Aalizadeh, R.; Kostakis, M.; Markou, A.; Alygizakis, N.; Lytras, T.; Adamopoulos, P.G.; Peccia, J.; Thompson, D.C.; Kontou, A.; et al. SARS-CoV-2 Wastewater Surveillance Data Can Predict Hospitalizations and ICU Admissions. Sci. Total Environ. 2022, 804, 150151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, D.L.; Baluja, M.Q.; Graham, D.W.; Corbishley, A.; McDonald, J.E.; Malham, S.K.; Hillary, L.S.; Connor, T.R.; Gaze, W.H.; Moura, I.B.; et al. Shedding of SARS-CoV-2 in Feces and Urine and Its Potential Role in Person-to-Person Transmission and the Environment-Based Spread of COVID-19. Sci. Total Environ. 2020, 749, 141364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Medema, G.; Heijnen, L.; Elsinga, G.; Italiaander, R.; Brouwer, A. Presence of SARS-Coronavirus-2 RNA in Sewage and Correlation with Reported COVID-19 Prevalence in the Early Stage of the Epidemic in The Netherlands. Environ. Sci. Technol. Lett. 2020, 7, 511–516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sapula, S.A.; Whittall, J.J.; Pandopulos, A.J.; Gerber, C.; Venter, H. An Optimized and Robust PEG Precipitation Method for Detection of SARS-CoV-2 in Wastewater. Sci. Total Environ. 2021, 785, 147270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stadler, L.B.; Ensor, K.B.; Clark, J.R.; Kalvapalle, P.; LaTurner, Z.W.; Mojica, L.; Terwilliger, A.; Zhuo, Y.; Ali, P.; Avadhanula, V.; et al. Wastewater Analysis of SARS-CoV-2 as a Predictive Metric of Positivity Rate for a Major Metropolis. medRxiv 2020. medRxiv:2020.11.04.20226191. [Google Scholar] [CrossRef] [Scilit]
- Forés, E.; Bofill-Mas, S.; Itarte, M.; Martínez-Puchol, S.; Hundesa, A.; Calvo, M.; Borrego, C.M.; Corominas, L.L.; Girones, R.; Rusiñol, M. Evaluation of Two Rapid Ultrafiltration-Based Methods for SARS-CoV-2 Concentration from Wastewater. Sci. Total Environ. 2021, 768, 144786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, P.; Guo, L.; Cavallo, M.; Cantrell, C.; Hilton, S.P.; Dunbar, J.; Barbero, R.; Barclay, R.; Sablon, O.I.I.I.; Wolfe, M.; et al. Evaluation of Simple and Convenient Methods for SARS-CoV-2 Detection in Wastewater in High and Low Resource Settings. medRxiv 2023. medRxiv:2022.12.31.22284093. [Google Scholar] [CrossRef] [Scilit]
- Philo, S.E.; Ong, A.Q.W.; Keim, E.K.; Swanstrom, R.; Kossik, A.L.; Zhou, N.A.; Beck, N.K.; Meschke, J.S. Development and Validation of the Skimmed Milk Pellet Extraction Protocol for SARS-CoV-2 Wastewater Surveillance. Food Environ. Virol. 2022, 14, 355–363. [Google Scholar] [CrossRef] [Scilit]
- Wurtzer, S.; Marechal, V.; Mouchel, J.; Maday, Y.; Teyssou, R.; Richard, E.; Almayrac, J.; Moulin, L. Evaluation of Lockdown Effect on SARS-CoV-2 Dynamics through Viral Genome Quantification in Waste Water, Greater Paris, France, 5 March to 23 April 2020. Eurosurveillance 2020, 25, 2000776. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, W.; Bertsch, P.M.; Bivins, A.; Bibby, K.; Farkas, K.; Gathercole, A.; Haramoto, E.; Gyawali, P.; Korajkic, A.; McMinn, B.R.; et al. Comparison of Virus Concentration Methods for the RT-QPCR-Based Recovery of Murine Hepatitis Virus, a Surrogate for SARS-CoV-2 from Untreated Wastewater. Sci. Total Environ. 2020, 739, 139960. [Google Scholar] [CrossRef] [Scilit]
- Alygizakis, N.; Markou, A.N.; Rousis, N.I.; Galani, A.; Avgeris, M.; Adamopoulos, P.G.; Scorilas, A.; Lianidou, E.S.; Paraskevis, D.; Tsiodras, S.; et al. Analytical Methodologies for the Detection of SARS-CoV-2 in Wastewater: Protocols and Future Perspectives. TrAC Trends Anal. Chem. 2021, 134, 116125. [Google Scholar] [CrossRef] [Scilit]
- Pandey, D.; Verma, S.; Verma, P.; Mahanty, B.; Dutta, K.; Daverey, A.; Arunachalam, K. SARS-CoV-2 in Wastewater: Challenges for Developing Countries. Int. J. Hyg. Environ. Health 2021, 231, 113634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, X.; Deng, Y.; Xu, X.; Li, S.; Zhang, Y.; Ding, J.; On, H.Y.; Lai, J.C.C.; In Yau, C.; Chin, A.W.H.; et al. Comparison of Virus Concentration Methods and RNA Extraction Methods for SARS-CoV-2 Wastewater Surveillance. Sci. Total Environ. 2022, 824, 153687. [Google Scholar] [CrossRef] [Scilit]
- Jaworski, E.; Saifuddin, M.; Sampey, G.; Shafagati, N.; Van Duyne, R.; Iordanskiy, S.; Kehn-Hall, K.; Liotta, L.; Petricoin, E.; Young, M.; et al. The Use of Nanotrap Particles Technology in Capturing HIV-1 Virions and Viral Proteins from Infected Cells. PLoS ONE 2014, 9, e96778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fang, L.; Chen, M.; Zhu, S.; Zhang, W.; Yan, D.; Li, X.; Huang, S.; Li, C.; Guo, X.; Zeng, H.; et al. A Comparative Study on Environmental Surveillance of Enterovirus: Using a Two-Phase Separation Method and a Filtration Method with a Mixed Cellulose Ester (MCE) Membrane. Biosaf. Health 2023, 5, 174–180. [Google Scholar] [CrossRef] [Scilit]
- Biyani, R.; Sharma, K.; Kojima, K.; Biyani, M.; Sharma, V.; Kumawat, T.; Juma, K.M.; Yanagihara, I.; Fujiwara, S.; Kodama, E.; et al. Development of Robust Isothermal RNA Amplification Assay for Lab-Free Testing of RNA Viruses. Sci. Rep. 2021, 11, 15997. [Google Scholar] [CrossRef] [Scilit]
- Demetria, C.; Kimitsuki, K.; Yahiro, T.; Saito, N.; Hashimoto, T.; Khan, S.; Chu, M.Y.J.; Manalo, D.; Mananggit, M.; Quiambao, B.; et al. Evaluation of a Real-Time Mobile PCR Device (PCR 1100) for the Detection of the Rabies Gene in Field Samples. Trop Med. Health 2023, 51, 17. [Google Scholar] [CrossRef] [Scilit]
- Hata, A.; Hara-Yamamura, H.; Meuchi, Y.; Imai, S.; Honda, R. Detection of SARS-CoV-2 in Wastewater in Japan during a COVID-19 Outbreak. Sci. Total Environ. 2021, 758, 143578. [Google Scholar] [CrossRef] [Scilit]
- Wu, F.; Zhang, J.; Xiao, A.; Gu, X.; Lee, W.L.; Armas, F.; Kauffman, K.; Hanage, W.; Matus, M.; Ghaeli, N.; et al. SARS-CoV-2 Titers in Wastewater Are Higher than Expected from Clinically Confirmed Cases. mSystems 2020, 5, 10–128. [Google Scholar] [CrossRef] [Scilit]
- Alamin, M.; Tsuji, S.; Hata, A.; Hara-Yamamura, H.; Honda, R. Selection of Surrogate Viruses for Process Control in Detection of SARS-CoV-2 in Wastewater. Sci. Total Environ. 2022, 823, 153737. [Google Scholar] [CrossRef] [Scilit]
- Muraoka, M.; Tanoi, Y.; Tada, T.; Mizukoshi, M.; Kawaguchi, O. Quickly and Simply Detection for Coronavirus Including SARS-CoV-2 on the Mobile Real-Time PCR Device and without RNA Extraction. medRxiv 2020. [Google Scholar] [CrossRef] [Scilit]
- Yang, S.; Dong, Q.; Li, S.; Cheng, Z.; Kang, X.; Ren, D.; Xu, C.; Zhou, X.; Liang, P.; Sun, L.; et al. Persistence of SARS-CoV-2 RNA in Wastewater after the End of the COVID-19 Epidemics. J. Hazard. Mater. 2022, 429, 128358. [Google Scholar] [CrossRef] [Scilit]
- Wu, F.; Xiao, A.; Zhang, J.; Moniz, K.; Endo, N.; Armas, F.; Bonneau, R.; Brown, M.A.; Bushman, M.; Chai, P.R.; et al. SARS-CoV-2 RNA Concentrations in Wastewater Foreshadow Dynamics and Clinical Presentation of New COVID-19 Cases. Sci. Total Environ. 2022, 805, 150121. [Google Scholar] [CrossRef] [Scilit]




| Primers/Probes | Sequence (5′–3′) |
|---|---|
| 2019-nCoV_N1-CDC_F | GTTGTTCGTTCTATGAAGAC |
| T7-2019-nCoV_N1-CDC-R | AATTCTAATACGACTCACTATAGGGAGATCTGGTTACTGCCAGTTGAATCTG |
| 5DIG-CDC-P1 | [Digoxigenir] CGTTCTATGAAGACTTTTTAGAGTATCATG |
| 3-BIOTIN-CDC-P2 | CCAAAATCAGCGAAATGCACCCCGCATTAC [Biotin] |
| PMMV-FP1 | AAATGAGAGTGGTTTGACCTT |
| PMMV-T7-RP1 | AATTCTAATACGACTCACTATAGGGAGAAACTCATCGGACACTGTG |
| S. No. | Sample Types | Spiked/Real Viruses (Copies/mL) | Ct Values | Observed Concentration (Copies/mL) | Recovery Efficiency | |||
|---|---|---|---|---|---|---|---|---|
| PEG | NTPs | PEG | NTPs | PEG | NTPs | |||
| 1 | CoV-2_Low | 100 | 33.20 ± 0.02 | 36.45 ± 0.30 | 2.1 × 102 | 1.5 × 102 | 206% | 151% |
| 2 | CoV-2_High | 10,000 | 26.53 ± 0.10 | 29.26 ± 0.14 | 1.7 × 104 | 2.0 × 104 | 170% | 196% |
| 3 | PMMoV_Low | 1.6 × 106 | 28.3 ± 0.24 | 39.7 ± 0.00 | 3.1 × 105 | 558 | 19% | 0.035% |
| 4 | PMMoV_High | 2.0 × 106 | 27.9 ± 0.04 | >40 | 4.5 × 105 | ND | 23% | ND |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sharma, V.; Takamura, H.; Biyani, M.; Honda, R. Real-Time On-Site Monitoring of Viruses in Wastewater Using Nanotrap® Particles and RICCA Technologies. Biosensors 2024, 14, 115. https://doi.org/10.3390/bios14030115
Sharma V, Takamura H, Biyani M, Honda R. Real-Time On-Site Monitoring of Viruses in Wastewater Using Nanotrap® Particles and RICCA Technologies. Biosensors. 2024; 14(3):115. https://doi.org/10.3390/bios14030115
Chicago/Turabian StyleSharma, Vishnu, Hitomi Takamura, Manish Biyani, and Ryo Honda. 2024. "Real-Time On-Site Monitoring of Viruses in Wastewater Using Nanotrap® Particles and RICCA Technologies" Biosensors 14, no. 3: 115. https://doi.org/10.3390/bios14030115
APA StyleSharma, V., Takamura, H., Biyani, M., & Honda, R. (2024). Real-Time On-Site Monitoring of Viruses in Wastewater Using Nanotrap® Particles and RICCA Technologies. Biosensors, 14(3), 115. https://doi.org/10.3390/bios14030115

