Development of RT h-CLAT, a Rapid Assessment Method for Skin Sensitizers Using THP-1 Cells as a Biosensor
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture
2.3. Chemical Treatment of THP-1 Cells for RNA-Seq Analysis
2.4. RNA-Seq Analysis
2.5. Real-Time PCR Assay
2.6. Selection of the Candidate Marker Genes
3. Results
3.1. Gene Expression Analysis
3.2. Selection of the Candidate Marker Genes
3.3. Evaluation of New Candidate Marker Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kimber, I.; Basketter, D.A.; Gerberick, G.F.; Dearman, R.J. Allergic contact dermatitis. Int. Immunopharmacol. 2002, 2, 201–211. [Google Scholar] [CrossRef]
- OECD. Test No. 429: Skin Sensitisation: Local Lymph Node Assay. In OECD Guidelines for the Testing of Chemicals; Section 4; OECD Publishing: Paris, France, 2010. [Google Scholar] [CrossRef]
- OECD. Test No. 442A: Skin Sensitization: Local Lymph Node Assay: DA. In OECD Guidelines for the Testing of Chemicals; Section 4; OECD Publishing: Paris, France, 2010. [Google Scholar] [CrossRef]
- OECD. Test No. 406: Skin Sensitisation Guinea Pig Maximisation Test and Bühler Test. In OECD Guidelines for the Testing of Chemicals; Section 4; OECD Publishing: Paris, France, 2022. [Google Scholar] [CrossRef]
- Directive 2003/15/EC, Directive 2003/15/EC of the European parliament and of the council of 27 February 2003 amending council directive 76/768/EEC on the approximation of the laws of the member states relating to cosmetic products. Off. J. Eur. Union 2003, L66, 26–35.
- European Parliament. A Global Ban on Animal Testing for Cosmetics: European Parliament Resolution of 3 May 2018 on a Global Ban to End Animal Testing for Cosmetics (2017/2922(RSP)). Available online: https://www.europarl.europa.eu/doceo/document/TA-8-2018-0202_EN.pdf (accessed on 17 December 2024).
- OECD. Test No. 442E: In Vitro Skin Sensitisation: In Vitro Skin Sensitisation assays addressing the Key Event on activation of dendritic cells on the Adverse Outcome Pathway for Skin Sensitisation. In OECD Guidelines for the Testing of Chemicals; Section 4; OECD Publishing: Paris, France, 2024. [Google Scholar] [CrossRef]
- OECD. Test No. 442D: In Vitro Skin Sensitisation: Assays addressing the Adverse Outcome Pathway Key Event on Keratinocyte activation. In OECD Guidelines for the Testing of Chemicals; Section 4; OECD Publishing: Paris, France, 2024. [Google Scholar] [CrossRef]
- OECD. The Adverse Outcome Pathway for Skin Sensitisation Initiated by Covalent Binding to Proteins; OECD Series on Testing and Assessment, No. 168; OECD Publishing: Paris, France, 2014. [Google Scholar] [CrossRef]
- Gerberick, F.; Aleksic, M.; Basketter, D.; Casati, S.; Karlberg, A.; Kern, P.; Kimber, I.; Lepoittervin, J.P.; Natsch, A.; Ovigne, J.M.; et al. Chemical reactivity measurement and the predictive identification of skin sensitisers. The report and recommendations of ECVAM Workshop 64. Altern. Lab. Anim. 2008, 36, 215–242. [Google Scholar] [CrossRef] [PubMed]
- Martinon, F.; Mayor, A.; Tschopp, J. The inflammasomes: Guardians of the body. Ann. Rev. Immunol. 2009, 27, 229–265. [Google Scholar] [CrossRef]
- Sutterwala, F.S.; Ogura, Y.; Szczepanik, M.; Lara-Tejero, M.; Lichtenberger, G.S.; Grant, E.P.; Bertin, J.; Coyle, A.J.; Galán, J.E.; Askenase, P.W.; et al. Critical role for NALP3/CIAS1/Cryopyrin in innate and adaptive immunity through its regulation of caspase-1. Immunity 2006, 24, 317–327. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, H.; Gaide, O.; Pétrilli, V.; Martinon, F.; Contassot, E.; Roques, S.; Kummer, J.A.; Tschopp, J.; French, L.E. Activation of the IL-1beta processing inflammasome is involved in contact hypersensitivity. J. Investig. Dermatol. 2007, 127, 1956–1963. [Google Scholar] [CrossRef]
- Weltzien, H.U.; Corsini, E.; Gibbs, S.; Lindstedt, M.; Borrebaeck, C.; Budde, P.; Schulz-Knappe, P.; Thierse, H.; Martin, S.F.; Roggen, E.L. Safe cosmetics without animal testing? Contributions of the EU Project Sens-it-iv. J. Verbrauch. Lebensm. 2009, 4, 41–48. [Google Scholar] [CrossRef][Green Version]
- dos Santos, G.G.; Reinders, J.; Ouwehand, K.; Rustemeyer, T.; Scheper, R.J.; Gibbs, S. Progress on the development of human in vitro dendritic cell based assays for assess ment of the sensitizing potential of a compound. Toxicol. Appl. Pharmacol. 2009, 236, 372–382. [Google Scholar] [CrossRef]
- Ashikaga, T.; Sakaguchi, H.; Sono, S.; Kosaka, N.; Ishikawa, M.; Nukada, Y.; Miyazawa, M.; Ito, Y.; Nishiyama, N.; Itagaki, H. A comparative evaluation of in vitro skin sensitisation tests: The human cell-line activation test (h-CLAT) versus the local lymph node assay (LLNA). Altern. Lab. Anim. 2010, 38, 275–284. [Google Scholar] [CrossRef] [PubMed]
- Kimber, I.; Basketter, D.A.; Gerberick, G.F.; Ryan, C.A.; Dearman, R.J. Chemical allergy: Translating biology into hazard characterization. Toxicol. Sci. 2011, 120, S238–S268. [Google Scholar] [CrossRef] [PubMed]
- Ryan, C.A.; Kimber, I.; Basketter, D.A.; Pallardy, M.; Gildea, L.A.; Gerberick, G.F. Dendritic cells and skin sensitization: Biological roles and uses in hazard identification. Toxicol. Appl. Pharmacol. 2007, 221, 384–394. [Google Scholar] [CrossRef]
- Gerberick, G.F.; Ryan, C.A.; Kern, P.S.; Schlatter, H.; Dearman, R.J.; Kimber, I.; Patlewicz, G.Y.; Basketter, D.A. Compilation of historical local lymph node data for evaluation of skin sensitization alternative methods. Dermatitis 2005, 16, 157–202. [Google Scholar] [PubMed]
- Kern, P.S.; Gerberick, G.F.; Ryan, C.A.; Kimber, I.; Aptula, A.; Basketter, D.A. Local lymph node data for the evaluation of skin sensitization alternatives: A second compilation. Dermatitis 2010, 21, 8–32. [Google Scholar] [CrossRef] [PubMed]
- Ashikaga, T.; Hoya, M.; Itagaki, H.; Katsumura, Y.; Aiba, S. Evaluation of CD86 expres sion and MHC class II molecule internalization in THP-1 human mono cyte cells as predictive endpoints for contact sensitizers. Toxicol. In Vitro 2002, 16, 711–716. [Google Scholar] [CrossRef] [PubMed]
- Bocchietto, E.; Paolucci, C.; Breda, D.; Sabbioni, E.; Burastero, S.E. Human monocytoid THP 1 cell line versus monocyte-derived human immature dendritic cells as in vitro models for predicting the sensitising potential of chemicals. Int. J. Immunopathol. Pharmacol. 2007, 20, 259–265. [Google Scholar] [CrossRef]
- Miyazawa, M.; Ito, Y.; Yoshida, Y.; Sakaguchi, H.; Suzuki, H. Phenotypic alterations and cytokine production in THP-1 cells in response to allergens. Toxicol. In Vitro 2007, 21, 428–437. [Google Scholar] [CrossRef]
- Tietze, C.; Blomeke, B. Sensitization assays: Monocyte-derived dendritic cells versus a monocytic cell line (THP-1). J. Toxicol. Environ. Health Part A 2008, 71, 965–968. [Google Scholar] [CrossRef]
- Nishikawa, M.U.; Iwaki, M.; Tashiro, K.; Kurose, K. Identification of gene expression markers and development of evaluation method using cell-based and RT-PCR-based assay for skin sensitising potential of chemicals. Xenobiotica 2020, 50, 1359–1369. [Google Scholar] [CrossRef]
- Nukada, Y.; Ashikaga, T.; Miyazawa, M.; Hirota, M.; Sakaguchi, H.; Sasa, H.; Nishiyama, N. Prediction of skin sensitization potency of chemicals by human Cell Line Activation Test (h-CLAT) and an attempt at classifying skin sensitization potency. Toxicol. In Vitro 2012, 26, 1150–1160. [Google Scholar] [CrossRef] [PubMed]
- Urbisch, D.; Mehling, A.; Guth, K.; Ramirez, T.; Honarvar, N.; Kolle, S.; Landsiedel, R.; Jaworska, J.; Kern, P.S.; Gerberick, F.; et al. Assessing skin sensitization hazard in mice and men using non-animal test methods. Regul. Toxicol. Pharmacol. 2015, 71, 337–351. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Arkusz, J.; Stępnik, M.; Sobala, W.; Dastych, J. Prediction of the con tact sensitizing potential of chemicals using analysis of gene expres sion changes in human THP-1 monocytes. Toxicol. Lett. 2010, 199, 51–59. [Google Scholar] [CrossRef] [PubMed]
- Ade, N.; Leon, F.; Pallardy, M.; Peiffer, J.; Kerdine-Romer, S.; Tissier, M.; Bonnet, P.; Fabre, I.; Ourlin, J. HMOX1 and NQO1 genes are upregulated in response to contact sensitizers in dendritic cells and THP-1 cell line: Role of the Keap1/Nrf2 pathway. Toxicol. Sci. 2009, 107, 451–460. [Google Scholar] [CrossRef]
- Hirota, M.; Moro, O. MIP-1beta, a novel biomarker for in vitro sensitization test using human monocytic cell line. Toxicol. In Vitro 2006, 20, 736–742. [Google Scholar] [CrossRef] [PubMed]
- OECD. Guidance Document for the Use of Adverse Outcome Pathways in Developing Integrated Approaches to Testing and Assessment (IATA); OECD Series on Testing and Assessment, No. 260; OECD Publishing: Paris, France, 2017. [Google Scholar] [CrossRef]
- Gozzelino, R.; Jeney, V.; Soares, M.P. Mechanisms of cell production by heme oxygenase-1. Annu. Rev. Pharmacol. Toxicol. 2010, 50, 323–354. [Google Scholar] [CrossRef]
- Costa, D.L.; Amaral, E.P.; Andrade, B.B.; Sher, A. Modulation of inflammation and immune responses by heme oxygenase-1: Implications for infection with intracellular pathogens. Antioxidants 2020, 9, 1205. [Google Scholar] [CrossRef] [PubMed]
- Zhong, G.; Li, H.; Bai, J.; Pang, S.; He, C.; Du, X.; Wang, H.; Zhang, Q.; Xie, S.; Du, H.; et al. Advancing the predictivity of skin sensitization by applying a novel HMOX1 reporter system. Arch. Toxicol. 2018, 92, 3103–3115. [Google Scholar] [CrossRef] [PubMed]
- Hess, J.; Angel, P.; Schorpp-Kistner, M. AP-1 subunits: Quarrel and harmony among siblings. J. Cell Sci. 2004, 117, 5965–5973. [Google Scholar] [CrossRef]
- Zenz, R.; Eferl, R.; Scheinecker, C.; Redlich, K.; Smolen, J.; Schonthaler, H.B.; Kenner, L.; Tschachler, E.; Wagner, E.F. Activator protein 1 (Fos/Jun) functions in inflammatory bone and skin disease. Arthritis Res. Ther. 2008, 10, 201. [Google Scholar] [CrossRef] [PubMed]
- Vally, H.; Misso, N.L.A.; Madan, V. Clinical effects of sulphate additives. Clin. Exp. Allergy 2009, 39, 1643–1651. [Google Scholar] [CrossRef]
- OECD. Guideline No. 497: Defined Approaches on Skin Sensitisation. In OECD Guidelines for the Testing of Chemicals; Section 4; OECD Publishing: Paris, France, 2023. [Google Scholar] [CrossRef]
- OECD. Test No. 442C: In Chemico Skin Sensitisation: Assays addressing the Adverse Outcome Pathway key event on covalent binding to proteins. In OECD Guidelines for the Testing of Chemicals; Section 4; OECD Publishing: Paris, France, 2024. [Google Scholar] [CrossRef]
- Benjamini, Y.; Hochberg, Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. Series B Stat. Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]




| Gene Name | Gene Symbol | Sense Primer (5′-3′) | Antisense Primer (5′-3′) |
|---|---|---|---|
| Heme oxygenase 1 | HMOX1 | TGAACTCCCTGGAGATGACTC | AGCTCCTGCAACTCCTCAAA |
| Jun proto-oncogene, AP-1 transcription factor subunit | JUN | CAAGAACTCGGACCTCCTCA | CCGTTGCTGGACTGGATTAT |
| Protein phosphatase 1 regulatory subunit 15A | PPP1R15A | GAGGGCAGGGAAGTCAATTT | TCCTCCCCTGGGTTCTTATC |
| BTG anti-proliferation factor 2 | BTG2 | TGAGGTGTCCTACCGCATT | CACTTGGTTCTTGCAGGTGA |
| DNA damage inducible transcript 3 | DDIT3 | AGCAGAGGTCACAAGCACCT | CCTGGTTCTCCCTTGGTCTT |
| Early growth response 1 | EGR1 | CTTCGCTAACCCCTCTGTCT | TTGATGAGCTGGGACTGGTA |
| Growth arrest and DNA damage inducible beta | GADD45B | CAGAAGATGCAGACGGTGAC | AACTTGGCCGACTCGTACAC |
| Phorbol-12-myristate-13-acetate-induced protein 1 | PMAIP1 | CCGGCAGAAACTTCTGAATC | ACGTGCACCTCCTGAGAAAA |
| Spermidine/spermine N1-acetyltransferase 1 | SAT1 | GCAGCATGCACTTCTTGGTA | TCCAACCCTCTTCACTGGAC |
| UL16 binding protein 2 | ULBP2 | CCCCTGGGGAAGAAACTAAA | CTGAATGTCACGCAGTTGCT |
| C-C motif chemokine receptor 2 | CCR2 | ACCAGTCAACTGGACCAAGC | TGAACTTCTCCCCAACGAAG |
| Isoprenylcysteine carboxyl methyltransferase | ICMT | GTTTCGGCATCCTTCTTACG | CACTGTCAGGGCATAGCTGA |
| Glyceraldehyde-3-phosphate dehydrogenase | GAPDH | AGCCACATCGCTCAGACAC | GCCCAATACGACCAAATCC |
| Chemical | Murine LLNA Category | h-CLAT Judgment | GAPDH | HMOX1 | JUN | PPP1R15A | BTG2 | DDIT3 | EGR1 | ||||||||||||
| NGS | NGS | PCR | Judgment | NGS | PCR | Judgment | NGS | PCR | Judgment | NGS | PCR | Judgment | NGS | PCR | Judgment | NGS | PCR | Judgment | |||
| 2,4-Dinitrochlorobenzene | Extreme | p | 1.2 | 5.2 | 3.2 | 7.7 | 9.3 | 9.3 | 8.0 | 3.3 | 30.7 | 1.6 | 1.4 | 5.4 | 8.3 | ||||||
| 3.2 | Match | 10.0 | Match | 21.1 | Match | 4.3 | Match | 0.7 | Match | 8.1 | Match | ||||||||||
| 2.9 | 10.0 | 5.9 | 2.8 | 1.4 | 8.3 | ||||||||||||||||
| 1,4-Phenylendiamine | Strong | p | 0.9 | 83.7 | 66.3 | 27.2 | 19.2 | 25.6 | 12.1 | 10.1 | 15.7 | 6.1 | 5.1 | 5.1 | 14.9 | ||||||
| 69.6 | Match | 22.8 | Match | 19.2 | Match | 16.7 | Match | 5.5 | Match | 16.4 | Mismatch | ||||||||||
| 61.0 | 19.2 | 38.9 | 28.8 | 9.6 | 15.3 | ||||||||||||||||
| Nickel sulfate | Moderate | p | 1.1 | 3.4 | 2.3 | 4.5 | 2.8 | 3.1 | 2.2 | 4.6 | 3.9 | 2.4 | 1.5 | 1.1 | 1.3 | ||||||
| 2.3 | Match | 3.0 | Match | 2.0 | Match | 6.8 | Match | 2.2 | Match | 1.1 | Match | ||||||||||
| 2.6 | 3.1 | 4.8 | 5.4 | 3.9 | 1.0 | ||||||||||||||||
| 2-Mercaptobenzothiazole | Moderate | p | 1.1 | 63.7 | 39.7 | 25.1 | 27.6 | 12.3 | 10.1 | 3.8 | 9.3 | 27.2 | 33.4 | 3.2 | 3.9 | ||||||
| 37.3 | Match | 24.9 | Match | 27.3 | Match | 6.1 | Match | 11.6 | Mismatch | 3.6 | Match | ||||||||||
| 22.5 | 25.4 | 21.7 | 5.2 | 63.1 | 3.4 | ||||||||||||||||
| R(+)-Limonene | Weak | p | 1.1 | 61.5 | 62.2 | 28.1 | 54.2 | 9.1 | 10.1 | 3.5 | 11.1 | 8.6 | 9.8 | 18.6 | 50.9 | ||||||
| 46.9 | Match | 54.9 | Match | 29.0 | Match | 4.6 | Match | 7.4 | Match | 36.5 | Match | ||||||||||
| 54.6 | 63.6 | 17.8 | 6.1 | 18.8 | 32.9 | ||||||||||||||||
| Imidazolidinyl urea | Weak | p | 1.2 | 7.4 | 3.9 | 80.0 | 65.3 | 15.6 | 10.9 | 13.5 | 15.8 | 2.5 | 2.2 | 8.3 | 10.9 | ||||||
| 4.1 | Match | 46.8 | Match | 13.2 | Match | 18.6 | Match | 4.6 | Match | 8.3 | Match | ||||||||||
| 4.2 | 51.9 | 17.9 | 24.1 | 3.3 | 8.6 | ||||||||||||||||
| Isopropanol | non-sensitizer | n | 1.0 | 1.3 | 1.6 | 1.4 | 0.8 | 1.2 | 1.1 | 1.4 | 1.6 | 1.7 | 2.3 | 0.6 | 0.8 | ||||||
| 1.5 | Match | 0.7 | Match | 0.9 | Match | 1.5 | Match | 3.3 | Match | 0.6 | Match | ||||||||||
| 1.5 | 0.9 | 1.8 | 1.6 | 3.7 | 0.5 | ||||||||||||||||
| Glycerol | non-sensitizer | n | 1.0 | 1.5 | 1.4 | 1.2 | 0.8 | 1.0 | 1.0 | 0.9 | 1.4 | 1.1 | 1.1 | 1.1 | 1.6 | ||||||
| 1.6 | Match | 1.2 | Match | 1.0 | Match | 1.3 | Match | 1.2 | Match | 1.0 | Match | ||||||||||
| 0.9 | 0.8 | 1.1 | 0.8 | 1.6 | 1.0 | ||||||||||||||||
| 4-Aminobenzoic acid | non-sensitizer | n | 1.1 | 1.3 | 0.8 | 0.6 | 0.8 | 1.0 | 0.8 | 1.4 | 1.7 | 0.9 | 0.8 | 0.5 | 0.8 | ||||||
| 0.8 | Match | 0.6 | Match | 2.0 | Match | 1.1 | Match | 0.3 | Match | 0.5 | Match | ||||||||||
| 0.9 | 0.8 | 0.9 | 4.5 | 1.2 | 0.6 | ||||||||||||||||
| Chemical | Murine LLNA Category | h-CLAT Judgment | GAPDH | GADD45B | PMAIP1 | SAT1 | ULBP2 | CCR2 | ICMT | ||||||||||||
| NGS | NGS | PCR | Judgment | NGS | PCR | Judgment | NGS | PCR | Judgment | NGS | PCR | Judgment | NGS | PCR | Judgment | NGS | PCR | Judgment | |||
| 2,4-Dinitrochlorobenzene | Extreme | p | 1.2 | 7.3 | 8.1 | 7.7 | 6.9 | 2.4 | 0.5 | 7.1 | 1.6 | 0.1 | 0.2 | 0.5 | 0.5 | ||||||
| 7.4 | Match | 6.5 | Match | 16.6 | Mismatch | 8.5 | Match | 0.3 | Mismatch | 0.5 | Match | ||||||||||
| 5.8 | 9.3 | 1.7 | 4.6 | 0.2 | 0.7 | ||||||||||||||||
| 1,4-Phenylendiamine | Strong | p | 0.9 | 14.6 | 18.3 | 5.6 | 4.3 | 16.5 | 8.4 | 8.9 | 3.7 | 0.0 | 0.1 | 0.3 | 0.3 | ||||||
| 12.1 | Match | 2.9 | Match | 14.4 | Match | 1.6 | Mismatch | 0.0 | Match | 0.5 | Match | ||||||||||
| 25.6 | 9.9 | 24.1 | 12.6 | 0.0 | 0.4 | ||||||||||||||||
| Nickel sulfate | Moderate | p | 1.1 | 0.9 | 1.0 | 3.6 | 2.8 | 2.3 | 1.5 | 1.4 | 0.5 | 0.6 | 0.6 | 0.6 | 0.6 | ||||||
| 0.7 | Match | 2.6 | Match | 2.0 | Match | 0.3 | Mismatch | 0.5 | Match | 0.8 | Match | ||||||||||
| 1.4 | 4.3 | 3.5 | 1.8 | 0.7 | 0.8 | ||||||||||||||||
| 2-Mercaptobenzothiazole | Moderate | p | 1.1 | 6.5 | 7.9 | 4.5 | 4.9 | 12.7 | 2.2 | 4.2 | 0.9 | 0.1 | 0.1 | 0.4 | 0.6 | ||||||
| 7.2 | Match | 3.9 | Match | 27.3 | Mismatch | 4.6 | Mismatch | 0.1 | Match | 0.6 | Match | ||||||||||
| 8.6 | 6.5 | 27.7 | 8.6 | 0.2 | 0.6 | ||||||||||||||||
| R(+)-Limonene | Weak | p | 1.1 | 3.4 | 3.5 | 3.9 | 3.9 | 8.0 | 3.6 | 7.5 | 2.2 | 0.1 | 0.5 | 0.2 | 0.5 | ||||||
| 3.5 | Match | 4.2 | Match | 44.6 | Mismatch | 11.6 | Mismatch | 0.3 | Mismatch | 0.9 | Mismatch | ||||||||||
| 3.4 | 8.3 | 17.9 | 17.6 | 0.3 | 0.7 | ||||||||||||||||
| Imidazolidinyl urea | Weak | p | 1.2 | 12.0 | 6.0 | 19.4 | 14.5 | 15.0 | 12.3 | 24.3 | 21.3 | 0.0 | 0.0 | 0.1 | 0.2 | ||||||
| 5.9 | Mismatch | 15.8 | Match | 18.5 | Match | 11.8 | Match | 0.0 | Match | 0.2 | Mismatch | ||||||||||
| 9.3 | 32.7 | 13.1 | 26.7 | 0.0 | 0.2 | ||||||||||||||||
| Isopropanol | non-sensitizer | n | 1.0 | 1.2 | 1.4 | 1.2 | 2.1 | 1.3 | 2.1 | 1.1 | 1.6 | 0.8 | 1.0 | 1.0 | 0.9 | ||||||
| 0.7 | Match | 2.2 | Match | 3.7 | Mismatch | 0.8 | Match | 0.7 | Match | 1.2 | Match | ||||||||||
| 1.9 | 2.1 | 2.8 | 3.0 | 1.2 | 1.1 | ||||||||||||||||
| Glycerol | non-sensitizer | n | 1.0 | 0.9 | 1.1 | 1.1 | 1.3 | 1.0 | 1.0 | 0.8 | 0.9 | 1.2 | 1.8 | 0.9 | 0.7 | ||||||
| 0.7 | Match | 1.0 | Match | 1.5 | Match | 0.4 | Match | 1.1 | Match | 1.5 | Match | ||||||||||
| 1.1 | 2.0 | 1.9 | 2.1 | 1.1 | 1.1 | ||||||||||||||||
| 4-Aminobenzoic acid | non-sensitizer | n | 1.1 | 1.1 | 1.0 | 1.3 | 0.9 | 1.1 | 0.3 | 1.6 | 0.4 | 0.7 | 0.6 | 0.9 | 3.3 | ||||||
| 0.7 | Match | 0.8 | Match | 3.8 | Match | 1.2 | Match | 0.8 | Match | 0.9 | Match | ||||||||||
| 0.6 | 8.2 | 1.8 | 2.1 | 0.5 | 1.0 | ||||||||||||||||
| Chemical | Murine LLNA Category | h-CLAT Judgment | Expression Levels | Judgment | Match or Mismatch with Murine LLNA Category | |
|---|---|---|---|---|---|---|
| HMOX1 | JUN | |||||
| Potassium dichromate | Extreme | p | 0.9 | 1.3 | ||
| 0.6 | 1.0 | non-sensitizer | Mismatch | |||
| 0.4 | 1.0 | |||||
| Benzoyl peroxide | Extreme | n | 1.9 | 3.0 | ||
| 1.4 | 2.2 | sensitizer | Match | |||
| 1.5 | 2.0 | |||||
| Cobalt chloride | Strong | p | 11.4 | 1.4 | ||
| 18.0 | 1.4 | sensitizer | Match | |||
| 18.8 | 1.2 | |||||
| 4-Nitrobenzyl bromide | Strong | p | 92.8 | 11.8 | ||
| 175.7 | 21.6 | sensitizer | Match | |||
| 135.9 | 22.4 | |||||
| Maleic acid | Strong | p | 10.7 | 1.3 | ||
| 11.6 | 2.0 | sensitizer | Match | |||
| 13.2 | 1.3 | |||||
| 2-Aminophenol | Strong | p | 2.5 | 6.7 | ||
| 4.2 | 8.5 | sensitizer | Match | |||
| 3.2 | 8.0 | |||||
| Lauryl gallate | Strong | p | 1.7 | 5.8 | ||
| 1.4 | 7.0 | sensitizer | Match | |||
| 1.3 | 6.6 | |||||
| Methyl methanesulfonate | Moderate | n | 3.3 | 1.6 | ||
| 2.3 | 1.3 | sensitizer | Match | |||
| 3.6 | 1.6 | |||||
| Citral | Moderate | p | 220.8 | 5.9 | ||
| 176.9 | 4.9 | sensitizer | Match | |||
| 211.8 | 6.9 | |||||
| Resorcinol | Moderate | p | 1.1 | 13.6 | ||
| 1.2 | 13.2 | sensitizer | Match | |||
| 1.7 | 14.4 | |||||
| Diethylenetriamine | Moderate | n | 19.9 | 1.8 | ||
| 22.3 | 2.1 | sensitizer | Match | |||
| 19.9 | 1.9 | |||||
| Cinnamaldehyde | Moderate | p | 0.7 | 4.4 | ||
| 0.4 | 3.2 | sensitizer | Match | |||
| 0.5 | 3.0 | |||||
| 3-Propylidenephthalide | Moderate | p | 135.0 | 2.4 | ||
| 27.0 | 2.0 | sensitizer | Match | |||
| 11.0 | 2.9 | |||||
| Phenylacetaldehyde | Moderate | p | 16.1 | 3.5 | ||
| 18.2 | 11.7 | sensitizer | Match | |||
| 29.7 | 11.0 | |||||
| 3-Dimethylamino propylamine | Moderate | p | 79.5 | 4.9 | ||
| 46.6 | 2.7 | sensitizer | Match | |||
| 69.7 | 2.6 | |||||
| 1-Phenyl-1,2-propanedione | Moderate | p | 18.2 | 7.8 | ||
| 17.0 | 7.3 | sensitizer | Match | |||
| 19.7 | 6.8 | |||||
| Isoeugenol | Moderate | n | 14.7 | 3.4 | ||
| 13.3 | 4.3 | sensitizer | Match | |||
| 19.3 | 6.3 | |||||
| Oxalic acid anhydrous | Weak | p | 4.6 | 0.6 | ||
| 3.2 | 0.5 | sensitizer | Match | |||
| 3.4 | 0.5 | |||||
| Geraniol | Weak | p | 6.7 | 13.0 | ||
| 8.9 | 15.2 | sensitizer | Match | |||
| 7.7 | 10.3 | |||||
| 1,2-Propanediol | non-sensitizer | n | 0.4 | 0.6 | ||
| 0.4 | 0.6 | non-sensitizer | Match | |||
| 0.7 | 0.7 | |||||
| 4-Hydroxybenzoic acid | non-sensitizer | n | 0.6 | 1.0 | ||
| 0.7 | 1.1 | non-sensitizer | Match | |||
| 0.8 | 0.8 | |||||
| Sulfanilamide | non-sensitizer | n | 0.8 | 0.7 | ||
| 0.7 | 0.5 | non-sensitizer | Match | |||
| 0.9 | 0.8 | |||||
| Coumarin | non-sensitizer | n | 0.8 | 8.3 | ||
| 0.9 | 7.8 | sensitizer | Mismatch | |||
| 1.0 | 6.3 | |||||
| 4-Methoxyacetophenone | non-sensitizer | n | 0.4 | 1.3 | ||
| 0.4 | 1.9 | non-sensitizer | Match | |||
| 0.2 | 1.2 | |||||
| Ethyl benzoylacetate | non-sensitizer | n | 0.9 | 2.5 | ||
| 1.3 | 3.9 | sensitizer | Mismatch | |||
| 2.0 | 11.2 | |||||
| 1-Butanol | non-sensitizer | n | 0.7 | 1.0 | ||
| 0.7 | 0.9 | non-sensitizer | Match | |||
| 0.9 | 1.4 | |||||
| Saccharin | non-sensitizer | n | 2.0 | 0.6 | ||
| 1.1 | 0.4 | sensitizer | Mismatch | |||
| 2.2 | 0.8 | |||||
| Sodium Sulfite | ND | p | 0.5 | 3.5 | ||
| 0.4 | 3.9 | sensitizer | - | |||
| 0.4 | 6.5 | |||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Koyama, H.; Maeda, A.; Zhai, P.; Koiwai, K.; Kurose, K. Development of RT h-CLAT, a Rapid Assessment Method for Skin Sensitizers Using THP-1 Cells as a Biosensor. Biosensors 2024, 14, 632. https://doi.org/10.3390/bios14120632
Koyama H, Maeda A, Zhai P, Koiwai K, Kurose K. Development of RT h-CLAT, a Rapid Assessment Method for Skin Sensitizers Using THP-1 Cells as a Biosensor. Biosensors. 2024; 14(12):632. https://doi.org/10.3390/bios14120632
Chicago/Turabian StyleKoyama, Hiroki, Ayami Maeda, Peiqi Zhai, Keiichiro Koiwai, and Kouichi Kurose. 2024. "Development of RT h-CLAT, a Rapid Assessment Method for Skin Sensitizers Using THP-1 Cells as a Biosensor" Biosensors 14, no. 12: 632. https://doi.org/10.3390/bios14120632
APA StyleKoyama, H., Maeda, A., Zhai, P., Koiwai, K., & Kurose, K. (2024). Development of RT h-CLAT, a Rapid Assessment Method for Skin Sensitizers Using THP-1 Cells as a Biosensor. Biosensors, 14(12), 632. https://doi.org/10.3390/bios14120632

