Recent Progress of Electrochemical Aptasensors toward AFB1 Detection (2018–2023)
Abstract
1. Introduction
2. Food Contamination with AFB1 (Incidence, Toxicity, and Legal Limits)
3. Nanomaterials Used for Electrode Modification
4. Aptamers for AFB1
5. Food and Beverage Samples Treatment
6. Applications of Electrochemical Aptasensors for AFB1 Detection
6.1. Label-Free Assays
6.2. Labeled Assays
6.3. Competitive Assays
6.4. Simultaneous Aptasensing of Toxins
7. Conclusions and Future Perspectives
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Al-Taher, F.; Banaszewski, K.; Jackson, L.; Zweigenbaum, J.; Ryu, D.; Cappozzo, J. Rapid Method for the Determination of Multiple Mycotoxins in Wines and Beers by LC-MS/MS Using a Stable Isotope Dilution Assay. J. Agric. Food Chem. 2013, 61, 2378–2384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pereira, V.L.; Fernandes, J.O.; Cunha, S.C. Mycotoxins in Cereals and Related Foodstuffs: A Review on Occurrence and Recent Methods of Analysis. Trends Food Sci. Technol. 2014, 36, 96–136. [Google Scholar] [CrossRef] [Scilit]
- Li, F.-Q.; Li, Y.-W.; Wang, Y.-R.; Luo, X.-Y. Natural Occurrence of Aflatoxins in Chinese Peanut Butter and Sesame Paste. J. Agric. Food Chem. 2009, 57, 3519–3524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shim, W.-B.; Kim, M.J.; Mun, H.; Kim, M.-G. An Aptamer-Based Dipstick Assay for the Rapid and Simple Detection of Aflatoxin B1. Biosens. Bioelectron. 2014, 62, 288–294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Babu, D.; Muriana, P.M. Immunomagnetic Bead-Based Recovery and Real Time Quantitative PCR (RT Iq-PCR) for Sensitive Quantification of Aflatoxin B1. J. Microbiol. Methods 2011, 86, 188–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, Z.; Lustig, W.P.; Zhang, J.; Zheng, C.; Wang, H.; Teat, S.J.; Gong, Q.; Rudd, N.D.; Li, J. Effective Detection of Mycotoxins by a Highly Luminescent Metal–Organic Framework. J. Am. Chem. Soc. 2015, 137, 16209–16215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abia, W.A.; Warth, B.; Sulyok, M.; Krska, R.; Tchana, A.N.; Njobeh, P.B.; Dutton, M.F.; Moundipa, P.F. Determination of Multi-Mycotoxin Occurrence in Cereals, Nuts and Their Products in Cameroon by Liquid Chromatography Tandem Mass Spectrometry (LC-MS/MS). Food Control 2013, 31, 438–453. [Google Scholar] [CrossRef] [Scilit]
- Herzallah, S.M. Determination of Aflatoxins in Eggs, Milk, Meat and Meat Products Using HPLC Fluorescent and UV Detectors. Food Chem. 2009, 114, 1141–1146. [Google Scholar] [CrossRef] [Scilit]
- Tokuşoǧlu, Ö.; Ünal, M.K.; Yemiş, F. Determination of the Phytoalexin Resveratrol (3,5,4′-Trihydroxystilbene) in Peanuts and Pistachios by High-Performance Liquid Chromatographic Diode Array (HPLC-DAD) and Gas Chromatography−Mass Spectrometry (GC-MS). J. Agric. Food Chem. 2005, 53, 5003–5009. [Google Scholar] [CrossRef] [Scilit]
- Yazdanpanah, H.; Zarghi, A.; Shafaati, A.R.; Foroutan, S.M.; Aboul-Fathi, F.; Khoddam, A.; Nazari, F.; Shaki, F. Analysis of Aflatoxin B1 in Iranian Foods Using HPLC and a Monolithic Column and Estimation of Its Dietary Intake. Iran. J. Pharm. Res. IJPR 2013, 12, 83–89. [Google Scholar]
- Shim, W.-B.; Yang, Z.-Y.; Kim, J.-S.; Kim, J.-Y.; Kang, S.-J.; Woo, G.-J.; Chung, Y.-C.; Eremin, S.A.; Chung, D.-H. Development of Immunochromatography Strip-Test Using Nanocolloidal Gold-Antibody Probe for the Rapid Detection of Aflatoxin B1 in Grain and Feed Samples. J. Microbiol. Biotechnol. 2007, 17, 1629–1637. [Google Scholar] [PubMed]
- Simões, F.R.; Xavier, M.G. Electrochemical Sensors. In Nanoscience and Its Applications; Elsevier: Amsterdam, The Netherlands, 2017; pp. 155–178. ISBN 9780323497800. [Google Scholar]
- Ensafi, A.A. An Introduction to Sensors and Biosensors. In Electrochemical Biosensors; Elsevier: Amsterdam, The Netherlands, 2019; pp. 1–10. [Google Scholar]
- Ellington, A.D.; Szostak, J.W. In Vitro Selection of RNA Molecules That Bind Specific Ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tuerk, C.; Gold, L. Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science 1990, 249, 505–510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ilgu, M.; Nilsen-Hamilton, M. Aptamers in Analytics. Analyst 2016, 141, 1551–1568. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ștefan, G.; Hosu, O.; De Wael, K.; Lobo-Castañón, M.J.; Cristea, C. Aptamers in Biomedicine: Selection Strategies and Recent Advances. Electrochim. Acta 2021, 376, 137994. [Google Scholar] [CrossRef] [Scilit]
- Zhu, C.; Wang, X.; Yang, Y.; Chen, L.; Yu, D. Research Progress on Ratiometric Electrochemical Sensing of Mycotoxins. J. Electroanal. Chem. 2023, 929, 117115. [Google Scholar] [CrossRef] [Scilit]
- Hianik, T. Aptamer-Based Biosensors. In Encyclopedia of Interfacial Chemistry; Elsevier: Amsterdam, The Netherlands, 2018; pp. 11–19. [Google Scholar]
- Hermann, T.; Patel, D.J. Adaptive Recognition by Nucleic Acid Aptamers. Science 2000, 287, 820–825. [Google Scholar] [CrossRef] [Scilit]
- Kadam, U.S.; Hong, J.C. Advances in Aptameric Biosensors Designed to Detect Toxic Contaminants from Food, Water, Human Fluids, and the Environment. Trends Environ. Anal. Chem. 2022, 36, e00184. [Google Scholar] [CrossRef] [Scilit]
- Melinte, G.; Hosu, O.; Cristea, C.; Marrazza, G. DNA Sensing Technology a Useful Food Scanning Tool. TrAC Trends Anal. Chem. 2022, 154, 116679. [Google Scholar] [CrossRef] [Scilit]
- Fan, Y.; Li, J.; Amin, K.; Yu, H.; Yang, H.; Guo, Z.; Liu, J. Advances in Aptamers, and Application of Mycotoxins Detection: A Review. Food Res. Int. 2023, 170, 113022. [Google Scholar] [CrossRef] [Scilit]
- Shkembi, X.; Svobodova, M.; Skouridou, V.; Bashammakh, A.S.; Alyoubi, A.O.; O’Sullivan, C.K. Aptasensors for Mycotoxin Detection: A Review. Anal. Biochem. 2022, 644, 114156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pérez-Fernández, B.; de la Escosura-Muñiz, A. Electrochemical Biosensors Based on Nanomaterials for Aflatoxins Detection: A Review (2015–2021). Anal. Chim. Acta 2022, 1212, 339658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, M.; Guo, X. Emerging Strategies in Fluorescent Aptasensor toward Food Hazard Aflatoxins Detection. Trends Food Sci. Technol. 2022, 129, 621–633. [Google Scholar] [CrossRef] [Scilit]
- Magdalena Pisoschi, A.; Iordache, F.; Stanca, L.; Ionescu Petcu, A.; Purdoiu, L.; Ionut Geicu, O.; Bilteanu, L.; Iren Serban, A. Comprehensive Overview and Critical Perspective on the Analytical Techniques Applied to Aflatoxin Determination—A Review Paper. Microchem. J. 2023, 191, 108770. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; He, K.; Wang, X.; Wang, Q.; Quan, H.; Wang, P.; Xu, X. Recent Progress in Visual Methods for Aflatoxin Detection. Crit. Rev. Food Sci. Nutr. 2022, 62, 7849–7865. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, S.; Niu, L.; Liu, Y. Recent Progress on Techniques in the Detection of Aflatoxin B1 in Edible Oil: A Mini Review. Molecules 2022, 27, 6141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- IARC International Agency for Research on Cancer. List of Classifications by Cancer Sites with Sufficient or Limited Evidence in Humans, IARC Monographs Volumes 1–129 Cancer; International Agency for Research on Cancer: Lyon, France, 2021; pp. 1–12. [Google Scholar]
- Bennett, J.W.; Klich, M. Mycotoxins. Clin. Microbiol. Rev. 2003, 16, 497–516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pitt, J. Chemical Characterization. In Encyclopedia of Food Safety; Elsevier: Amsterdam, The Netherlands, 2014; Volume 2, pp. 289–294. ISBN 9780123786128. [Google Scholar]
- Li, C.; Liu, X.; Wu, J.; Ji, X.; Xu, Q. Research Progress in Toxicological Effects and Mechanism of Aflatoxin B 1 Toxin. PeerJ 2022, 10, e13850. [Google Scholar] [CrossRef] [Scilit]
- Smith, J.W.; Groopman, J.D. Aflatoxins. In Reference Module in Biomedical Sciences; Elsevier: Amsterdam, The Netherlands, 2018; pp. 1–14. ISBN 9780128012383. [Google Scholar]
- European Commission. Commission Regulation (EC) No 1881/2006 of 19 December 2006 Setting Maximum Levels for Certain Contaminants in Foodstuffs; European Commission: Brussels, Belgium, 2006. [Google Scholar]
- Anisakis—Nematode|Tokyo Food Safety Information Center|Bureau of Public Health, Tokyo Metropolitan Government. Available online: https://www.hokeniryo.metro.tokyo.lg.jp/shokuhin/eng/kabi/kabidoqa.html (accessed on 8 December 2023).
- FDA. Guidance for Industry: Action Levels for Poisonous or Deleterious Substances in Human Food and Animal Feed; FDA: Washington, DC, USA, 2011; pp. 1–15.
- Lim, M.-C.; Kim, Y.-R. Analytical Applications of Nanomaterials in Monitoring Biological and Chemical Contaminants in Food. J. Microbiol. Biotechnol. 2016, 26, 1505–1516. [Google Scholar] [CrossRef] [Scilit]
- Feier, B.; Cernat, A.; Melinte, G.; Stefan, G.; Cristea, C.; Hosu, O. Magnetic Nanomaterials-Based Biosensors. In Nanosensors for Smart Agriculture; Elsevier: Amsterdam, The Netherlands, 2022; pp. 81–115. ISBN 9780128245545. [Google Scholar]
- Pan, Y.; Han, Z.; Chen, S.; Wei, K.; Wei, X. Metallic Nanoclusters: From Synthetic Challenges to Applications of Their Unique Properties in Food Contamination Detection. Coord. Chem. Rev. 2023, 478, 214964. [Google Scholar] [CrossRef] [Scilit]
- Barsan, M.M.; Ghica, M.E.; Brett, C.M.A. Electrochemical Sensors and Biosensors Based on Redox Polymer/Carbon Nanotube Modified Electrodes: A Review. Anal. Chim. Acta 2015, 881, 1–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, T.; Li, S.; Li, X.; JiYe, Y.; Mo, Y.; Chen, L.; Zhang, Z.; Wu, H.; Li, M.; Luo, Q. A Label-Free Electrochemical Aptasensor Based on AuNPs-Loaded Zeolitic Imidazolate Framework-8 for Sensitive Determination of Aflatoxin B1. Food Chem. 2022, 384, 132495. [Google Scholar] [CrossRef] [Scilit]
- He, D.; Wu, Z.; Cui, B.; Xu, E. Aptamer and Gold Nanorod–Based Fumonisin B1 Assay Using Both Fluorometry and SERS. Microchim. Acta 2020, 187, 215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kou, J.; Nguyen, E.P.; Merkoçi, A.; Guo, Z. 2-Dimensional Materials-Based Electrical/Optical Platforms for Smart on-off Diagnostics Applications. 2D Mater. 2020, 7, 032001. [Google Scholar] [CrossRef] [Scilit]
- Sinha, S.; Kim, H.; Robertson, A.W. Preparation and Application of 0D-2D Nanomaterial Hybrid Heterostructures for Energy Applications. Mater. Today Adv. 2021, 12, 100169. [Google Scholar] [CrossRef] [Scilit]
- Hosu, O.; Florea, A.; Cristea, C.; Sandulescu, R. Functionalized Advanced Hybrid Materials for Biosensing Applications. In Advanced Biosensors for Health Care Applications; Elsevier: Amsterdam, The Netherlands, 2019; pp. 171–207. ISBN 9780128157435. [Google Scholar]
- Gopalan, A.I.; Lee, K.-P.; Manesh, K.M.; Santhosh, P.; Kim, J.H.; Kang, J.S. Electrochemical Determination of Dopamine and Ascorbic Acid at a Novel Gold Nanoparticles Distributed Poly(4-Aminothiophenol) Modified Electrode. Talanta 2007, 71, 1774–1781. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Picciani, P.H.S.; Shimizu, F.M.; Olimpio, Q.G.; Michel, R.C. Sensing Materials: Organic Polymers. In Encyclopedia of Sensors and Biosensors; Elsevier: Amsterdam, The Netherlands, 2023; Volume 1–4, pp. 130–147. ISBN 9780128225486. [Google Scholar]
- Ong, J.Y.; Phang, S.W.; Goh, C.T.; Pike, A.; Tan, L.L. Impedimetric Polyaniline-Based Aptasensor for Aflatoxin B1 Determination in Agricultural Products. Foods 2023, 12, 1698. [Google Scholar] [CrossRef] [Scilit]
- Selvolini, G.; Lettieri, M.; Tassoni, L.; Gastaldello, S.; Grillo, M.; Maran, C.; Marrazza, G. Electrochemical Enzyme-Linked Oligonucleotide Array for Aflatoxin B1 Detection. Talanta 2019, 203, 49–57. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Qian, J.; An, K.; Ren, C.; Lu, X.; Hao, N.; Liu, Q.; Li, H.; Huang, X.; Wang, K. Fabrication of Magnetically Assembled Aptasensing Device for Label-Free Determination of Aflatoxin B1 Based on EIS. Biosens. Bioelectron. 2018, 108, 69–75. [Google Scholar] [CrossRef] [Scilit]
- Daniel, M.-C.; Astruc, D. Gold Nanoparticles: Assembly, Supramolecular Chemistry, Quantum-Size-Related Properties, and Applications toward Biology, Catalysis, and Nanotechnology|Chemical Reviews. Chem. Rev. 2004, 104, 293–346. [Google Scholar] [CrossRef] [Scilit]
- Smart, A.; Crew, A.; Pemberton, R.; Hughes, G.; Doran, O.; Hart, J.P. Screen-Printed Carbon Based Biosensors and Their Applications in Agri-Food Safety. TrAC Trends Anal. Chem. 2020, 127, 115898. [Google Scholar] [CrossRef] [Scilit]
- Dreyer, D.R.; Todd, A.D.; Bielawski, C.W. Harnessing the Chemistry of Graphene Oxide. Chem. Soc. Rev. 2014, 43, 5288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beheshti-Marnani, A.; Hatefi-Mehrjardi, A.; Es’haghi, Z. A Sensitive Biosensing Method for Detecting of Ultra-Trace Amounts of AFB1 Based on “Aptamer/Reduced Graphene Oxide” Nano-Bio Interaction. Colloids Surfaces B Biointerfaces 2019, 175, 98–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rhouati, A.; Marty, J.-L.; Vasilescu, A. Electrochemical Biosensors Combining Aptamers and Enzymatic Activity: Challenges and Analytical Opportunities. Electrochim. Acta 2021, 390, 138863. [Google Scholar] [CrossRef] [Scilit]
- Hui, Y.; Wang, B.; Ren, R.; Zhao, A.; Zhang, F.; Song, S.; He, Y. An Electrochemical Aptasensor Based on DNA-AuNPs-HRP Nanoprobes and Exonuclease-Assisted Signal Amplification for Detection of Aflatoxin B1. Food Control 2020, 109, 106902. [Google Scholar] [CrossRef] [Scilit]
- Cui, H.; An, K.; Wang, C.; Chen, Y.; Jia, S.; Qian, J.; Hao, N.; Wei, J.; Wang, K. A Disposable Ratiometric Electrochemical Aptasensor with Exonuclease I-Powered Target Recycling Amplification for Highly Sensitive Detection of Aflatoxin B1. Sens. Actuators B Chem. 2022, 355, 131238. [Google Scholar] [CrossRef] [Scilit]
- Tang, J.; Huang, Y.; Liu, H.; Zhang, C.; Tang, D. Homogeneous Electrochemical Immunoassay of Aflatoxin B1 in Foodstuff Using Proximity-Hybridization-Induced Omega-like DNA Junctions and Exonuclease III-Triggered Isothermal Cycling Signal Amplification. Anal. Bioanal. Chem. 2016, 408, 8593–8601. [Google Scholar] [CrossRef] [Scilit]
- Zheng, W.; Teng, J.; Cheng, L.; Ye, Y.; Pan, D.; Wu, J.; Xue, F.; Liu, G.; Chen, W. Hetero-Enzyme-Based Two-Round Signal Amplification Strategy for Trace Detection of Aflatoxin B1 Using an Electrochemical Aptasensor. Biosens. Bioelectron. 2016, 80, 574–581. [Google Scholar] [CrossRef] [Scilit]
- Le, L.C.; Cruz-Aguando, J.A.; Penner, A.G. DNA Ligands for Aflatoxin and Zearalenone. U.S. Patent Application No. 13/391,426, 6 September 2012. [Google Scholar]
- Cruz-Aguado, J.A.; Penner, G. Determination of Ochratoxin A with a DNA Aptamer. J. Agric. Food Chem. 2008, 56, 10456–10461. [Google Scholar] [CrossRef] [Scilit]
- Zuker, M. Mfold Web Server for Nucleic Acid Folding and Hybridization Prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef] [Scilit]
- Azri, F.A.; Selamat, J.; Sukor, R.; Yusof, N.A.; Raston, N.H.A.; Eissa, S.; Zourob, M.; Chinnappan, R. Determination of Minimal Sequence for Zearalenone Aptamer by Computational Docking and Application on an Indirect Competitive Electrochemical Aptasensor. Anal. Bioanal. Chem. 2021, 413, 3861–3872. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, L.; Zhao, Q. Direct Fluorescence Anisotropy Approach for Aflatoxin B1 Detection and Affinity Binding Study by Using Single Tetramethylrhodamine Labeled Aptamer. Talanta 2018, 189, 442–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, G.; Wang, C.; Yu, H.; Li, Y.; Zhao, Q.; Zhou, X.; Li, C.; Liu, M. Structural Basis for High-Affinity Recognition of Aflatoxin B1 by a DNA Aptamer. Nucleic Acids Res. 2023, 51, 7666–7674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.; Liu, L.; Zhao, Q. Low Temperature Greatly Enhancing Responses of Aptamer Electrochemical Sensor for Aflatoxin B1 Using Aptamer with Short Stem. ACS Sensors 2020, 5, 3246–3253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, X.; Wang, W.; Chen, X.; Xia, Y.; Wu, S.; Duan, N.; Wang, Z. Selection, Identification, and Application of Aflatoxin B1 Aptamer. Eur. Food Res. Technol. 2014, 238, 919–925. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Suo, Z.; Liu, Y.; He, B.; Wei, M. An Electrochemical Apta-Assay Based on Hybridization Chain Reaction and Aflatoxin B1-Driven Ag-DNAzyme as Amplification Strategy. Bioelectrochemistry 2023, 149, 108322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, H.; Sun, D.-W.; Pu, H.; Huang, L. Bridging Fe3O4@Au Nanoflowers and Au@Ag Nanospheres with Aptamer for Ultrasensitive SERS Detection of Aflatoxin B1. Food Chem. 2020, 324, 126832. [Google Scholar] [CrossRef] [Scilit]
- Yugender Goud, K.; Catanante, G.; Hayat, A.; Satyanarayana, M.; Gobi, K.V.; Marty, J.L. Disposable and Portable Electrochemical Aptasensor for Label Free Detection of Aflatoxin B1 in Alcoholic Beverages. Sens. Actuators B Chem. 2016, 235, 466–473. [Google Scholar] [CrossRef] [Scilit]
- Ling, Z.; Yang, J.; Zhang, Y.; Zeng, D.; Wang, Y.; Tian, Y.; Wang, H.; Xu, Z.; Sun, Y.; Shen, Y. Applications of Advanced Materials in the Pretreatment and Rapid Detection of Small Molecules in Foods: A Review. Trends Food Sci. Technol. 2023, 141, 104175. [Google Scholar] [CrossRef] [Scilit]
- Mohan, B.; Priyanka; Singh, G.; Chauhan, A.; Pombeiro, A.J.L.; Ren, P. Metal-Organic Frameworks (MOFs) Based Luminescent and Electrochemical Sensors for Food Contaminant Detection. J. Hazard. Mater. 2023, 453, 131324. [Google Scholar] [CrossRef] [Scilit]
- Alilou, S.; Amirzehni, M.; Eslami, P.A. A Simple Fluorometric Method for Rapid Screening of Aflatoxins after Their Extraction by Magnetic MOF-808/Graphene Oxide Composite and Their Discrimination by HPLC. Talanta 2021, 235, 122709. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castillo, G.; Spinella, K.; Poturnayová, A.; Šnejdárková, M.; Mosiello, L.; Hianik, T. Detection of Aflatoxin B1 by Aptamer-Based Biosensor Using PAMAM Dendrimers as Immobilization Platform. Food Control 2015, 52, 9–18. [Google Scholar] [CrossRef] [Scilit]
- Feng, Z.; Gao, N.; Liu, J.; Li, H. Boron-Doped Diamond Electrochemical Aptasensors for Trace Aflatoxin B1 Detection. Anal. Chim. Acta 2020, 1122, 70–75. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geleta, G.S.; Zhao, Z.; Wang, Z. A Novel Reduced Graphene Oxide/Molybdenum Disulfide/Polyaniline Nanocomposite-Based Electrochemical Aptasensor for Detection of Aflatoxin B1. Analyst 2018, 143, 1644–1649. [Google Scholar] [CrossRef] [Scilit]
- Alahmad, W.; Kaya, S.I.; Cetinkaya, A.; Varanusupakul, P.; Ozkan, S.A.A. Green Chemistry Methods for Food Analysis: Overview of Sample Preparation and Determination. Adv. Sample Prep. 2023, 5, 100053. [Google Scholar] [CrossRef] [Scilit]
- Jahangiri–Dehaghani, F.; Zare, H.R.; Shekari, Z. A Non-Label Electrochemical Aptasensor Based on Cu Metal–Organic Framework to Measure Aflatoxin B1 in Wheat Flour. Food Anal. Methods 2022, 15, 192–202. [Google Scholar] [CrossRef] [Scilit]
- Mo, R.; He, L.; Yan, X.; Su, T.; Zhou, C.; Wang, Z.; Hong, P.; Sun, S.; Li, C. A Novel Aflatoxin B1 Biosensor Based on a Porous Anodized Alumina Membrane Modified with Graphene Oxide and an Aflatoxin B1 Aptamer. Electrochem. Commun. 2018, 95, 9–13. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Xu, S.; Lin, X.; Liu, J.; Wang, K. Label-Free Electrochemical Aptasensor Based on the Vertically-Aligned Mesoporous Silica Films for Determination of Aflatoxin B1. Biosensors 2023, 13, 661. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Meng, S.; Dong, N.; Wei, Y.; Wang, Y.; Li, X.; Liu, D.; You, T. Space-Confined Electrochemical Aptasensing with Conductive Hydrogels for Enhanced Applicability to Aflatoxin B1 Detection. J. Agric. Food Chem. 2023, 71, 14806–14813. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Wang, F.; Li, Z.; Hu, B.; Zheng, Q.; Piao, Y.; Feng, L.; Cao, J. Dual-Mode Electrochemical/Colorimetric Microfluidic Sensor Integrated Tetrahedral DNA Nanostructures with Au/Ni-Co LDH NCs Nanozyme for Ultrasensitive Detection of Aflatoxin B1. Sens. Actuators B Chem. 2023, 393, 134322. [Google Scholar] [CrossRef] [Scilit]
- Zhu, C.; Liu, D.; Li, Y.; Chen, T.; You, T. Label-Free Ratiometric Homogeneous Electrochemical Aptasensor Based on Hybridization Chain Reaction for Facile and Rapid Detection of Aflatoxin B1 in Cereal Crops. Food Chem. 2022, 373, 131443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, W.; Umar, A.; Algadi, H.; Albargi, H.; Ibrahim, A.A.; Cui, K.; Wang, L.; Pei, M.; Wang, Y. Design of a Unique “ON/OFF” Switch Electrochemical Aptasensor Driven by the PH for the Detection of Aflatoxin B1 in Acid Solutions Based on Titanium Carbide/Carboxylated Graphene Oxide-Poly(4-Vinyl Pyridine)/Aptamer Composite. Microchem. J. 2021, 169, 106548. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Zhou, Y.; Dong, H.; Li, Q.; Zhang, Y.; Xu, M. Disposable Electrochemical Aptasensor for Ultrasensitive Determination of Aflatoxin B1 Using Copper Nanoparticles as Probes Research Article. Electroanalysis 2022, 34, 352–361. [Google Scholar] [CrossRef] [Scilit]
- Wang, P.; Luo, B.; Liu, K.; Wang, C.; Dong, H.; Wang, X.; Hou, P.; Li, A. A Novel COOH-GO-COOH-MWNT/PDA/AuNPs Based Electrochemical Aptasensor for Detection of AFB1. RSC Adv. 2022, 12, 27940–27947. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, K.-Y.; Hong, C.-Y.; Yang, K.-C.; Hsieh, B.-C. A Comparative Study for Evaluating the Binding Affinity of MARAS-Selected Aptamer and a Patented Aptamer towards Aflatoxin B1 by Electrochemical Impedimetric Aptasensing. Int. J. Electrochem. Sci. 2023, 18, 100307. [Google Scholar] [CrossRef] [Scilit]
- Lin, T.; Shen, Y. Fabricating Electrochemical Aptasensors for Detecting Aflatoxin B1 via Layer-by-Layer Self-Assembly. J. Electroanal. Chem. 2020, 870, 114247. [Google Scholar] [CrossRef] [Scilit]
- Roushani, M.; Zare Dizajdizi, B.; Rahmati, Z.; Azadbakht, A. Development of Electrochemical Aptasensor Based on Gold Nanorod and Its Application for Detection of Aflatoxin B1 in Rice and Blood Serum Sample. Nanochem. Res. 2019, 4, 35–42. [Google Scholar] [CrossRef] [Scilit]
- Roushani, M.; Farokhi, S.; Rahmati, Z. Development of a Dual-Recognition Strategy for the Aflatoxin B1 Detection Based on a Hybrid of Aptamer-MIP Using a Cu2O NCs/GCE. Microchem. J. 2022, 178, 107328. [Google Scholar] [CrossRef] [Scilit]
- Shen, J.; Liu, J.; Yang, S.; Yao, X.; Fa, H.; Hou, C.; Yang, M. Novel Electrochemical Sensor Based on PDA/MXene/MWCNTs/NiCo2O4 Nanocomposites for Rapid, Sensitive, and Selective Detection of Aflatoxin B1. Food Anal. Methods 2023, 16, 1055–1068. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Liu, D.; Zhu, C.; Wang, M.; Liu, Y.; You, T. A Ratiometry-Induced Successive Reusable Electrochemical Aptasensing Platform: Efficient Monitoring of Aflatoxin B1 in Peanut. Sens. Actuators B Chem. 2021, 336, 129021. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Liu, D.; Zhu, C.; Shen, X.; Liu, Y.; You, T. Sensitivity Programmable Ratiometric Electrochemical Aptasensor Based on Signal Engineering for the Detection of Aflatoxin B1 in Peanut. J. Hazard. Mater. 2020, 387, 122001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, S.S.; Wei, M.; Wei, W.; Liu, Y.; Liu, S. Electrochemical Aptasensor for Aflatoxin B1 Based on Smart Host-Guest Recognition of β-Cyclodextrin Polymer. Biosens. Bioelectron. 2019, 129, 58–63. [Google Scholar] [CrossRef] [Scilit]
- Ren, X.; Jiao, X.; Wang, Y.; Yao, C.; Xu, X. A Sensitive Aflatoxin B1 Electrochemical Aptasensor Based on Ferrocene-Functionalized Hollow Porous Carbon Spheres as Signal Amplifier. Microchem. J. 2022, 181, 107649. [Google Scholar] [CrossRef] [Scilit]
- Lv, M.; Li, F.; Du, Y.; Guo, X.; Zhang, P.; Liu, Y. Ratiometric Electrochemical Aptasensor for AFB1 Detection in Peanut and Peanut Products. Int. J. Electrochem. Sci. 2023, 18, 9–15. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Liu, D.; Meng, S.; Chen, T.; Liu, C.; You, T. Dual-Ratiometric Electrochemical Aptasensor Enabled by Programmable Dynamic Range: Application for Threshold-Based Detection of Aflatoxin B1. Biosens. Bioelectron. 2022, 195, 113634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zejli, H.; Goud, K.Y.; Marty, J.L. An Electrochemical Aptasensor Based on Polythiophene-3-Carboxylic Acid Assisted Methylene Blue for Aflatoxin B1 Detection. Sens. Bio-Sens. Res. 2019, 25, 100290. [Google Scholar] [CrossRef] [Scilit]
- Chen, T.; Li, Y.; Meng, S.; Liu, C.; Liu, D.; Dong, D.; You, T. Temperature and PH Tolerance Ratiometric Aptasensor: Efficiently Self-Calibrating Electrochemical Detection of Aflatoxin B1. Talanta 2022, 242, 123280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.; Zhao, Q. A Reagentless Electrochemical Sensor for Aflatoxin B1 with Sensitive Signal-on Responses Using Aptamer with Methylene Blue Label at Specific Internal Thymine. Biosens. Bioelectron. 2020, 167, 112478. [Google Scholar] [CrossRef] [Scilit]
- Huang, Q.; Lin, X.; Chen, D.; Tong, Q.X. Carbon Dots/α-Fe2O3-Fe3O4 Nanocomposite: Efficient Synthesis and Application as a Novel Electrochemical Aptasensor for the Ultrasensitive Determination of Aflatoxin B1. Food Chem. 2022, 373, 131415. [Google Scholar] [CrossRef] [Scilit]
- Wei, G.; Fan, Q.; Hong, N.; Cui, H.; Zhang, W.; Rustam, M.; Alim, A.; Jiang, T.; Dong, H.; Fan, H. A Reagentless Aptamer Sensor Based on a Self-Powered DNA Machine for Electrochemical Detection of AFB1. Electrocatalysis 2023, 14, 593–601. [Google Scholar] [CrossRef] [Scilit]
- Jahangiri–Dehaghani, F.; Zare, H.R.; Shekari, Z.; Benvidi, A. Development of an Electrochemical Aptasensor Based on Au Nanoparticles Decorated on Metal–Organic Framework Nanosheets and p-Biphenol Electroactive Label for the Measurement of Aflatoxin B1 in a Rice Flour Sample. Anal. Bioanal. Chem. 2022, 414, 1973–1985. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Gao, L.; Chai, B.; Zhao, J.; Yang, Z.; Yang, K. Electrochemical Aptasensor for Aflatoxin B1 Detection Using Cerium Dioxide Nanoparticle Supported on Iron-Porphyrinic Metal–Organic Framework as Signal Probes. Microchem. J. 2022, 181, 107716. [Google Scholar] [CrossRef] [Scilit]
- Sameiyan, E.; Lavaee, P.; Ramezani, M.; Alibolandi, M.; Khoshbin, Z.; Abnous, K.; Taghdisi, S.M. A Novel Electrochemical Method for the Sensitive Determination of Aflatoxin B 1 Using a Bivalent Binding Aptamer-cDNA Structure. Electroanalysis 2023, 35, e202200243. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Qian, J.; An, K.; Lu, X.; Huang, X. A Semiconductor Quantum Dot-Based Ratiometric Electrochemical Aptasensor for the Selective and Reliable Determination of Aflatoxin B1. Analyst 2019, 144, 4772–4780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Ye, S.; Huang, L.; Fan, S.; Mao, W.; Hu, Y.; Yu, Y.; Fu, F. An Electrochemical Biosensor for the Detection of Aflatoxin B1 Based on the Specific Aptamer and HCR Biological Magnification. Anal. Methods 2023, 15, 99–108. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.; Wu, T.; Zeng, W.; Liu, J.; Hu, B.; Wu, L. Dual-Signal Electrochemical Aptasensor Involving Hybridization Chain Reaction Amplification for Aflatoxin B1 Detection. Sens. Actuators B Chem. 2022, 371, 132494. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Li, Y.; Zhao, Q. A Signal-on Electrochemical Aptasensor for Rapid Detection of Aflatoxin B1 Based on Competition with Complementary DNA. Biosens. Bioelectron. 2019, 144, 111641. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Li, Y.; Zhao, Q. A Competitive Electrochemical Aptamer-Based Method for Aflatoxin B1 Detection with Signal-off Response. Anal. Methods 2020, 12, 646–650. [Google Scholar] [CrossRef] [Scilit]
- Wu, D.; Liu, P.; Teng, Y.; Peng, L.; Deng, W.; Jia, Y. Wash-Free Electrochemical Aptasensor for the Detection of Aflatoxins by the Signal Amplification of Ferrocene-Capped Gold Nanoparticles. Int. J. Electrochem. Sci. 2022, 17, 220948. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Zhao, X.; Gu, C.; Xu, F.; Zhang, W.; Huang, X.; Qian, J. Fabrication of a Versatile Aptasensing Chip for Aflatoxin B1 in Photothermal and Electrochemical Dual Modes. Food Anal. Methods 2022, 15, 3390–3399. [Google Scholar] [CrossRef] [Scilit]
- Jahangiri–Dehaghani, F.; Zare, H.R.; Shekari, Z. Simultaneous Measurement of Ochratoxin A and Aflatoxin B1 Using a Duplexed-Electrochemical Aptasensor Based on Carbon Nanodots Decorated with Gold Nanoparticles and Two Redox Probes Hemin@HKUST-1 and Ferrocene@HKUST-1. Talanta 2024, 266, 124947. [Google Scholar] [CrossRef] [Scilit]
- Zhu, C.; Liu, D.; Li, Y.; Ma, S.; Wang, M.; You, T. Hairpin DNA Assisted Dual-Ratiometric Electrochemical Aptasensor with High Reliability and Anti-Interference Ability for Simultaneous Detection of Aflatoxin B1 and Ochratoxin A. Biosens. Bioelectron. 2021, 174, 112654. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malvano, F.; Pilloton, R.; Albanese, D. Label-Free Impedimetric Biosensors for the Control of Food Safety—A Review. Int. J. Environ. Anal. Chem. 2020, 100, 468–491. [Google Scholar] [CrossRef] [Scilit]
- Zaccari, I.; Davies, A.G.; Walti, C.; Laurenson, S.X. Label-Free Electrochemical Biosensors for Clinical Diagnostic. In Proceedings of the 2014 Cairo International Biomedical Engineering Conference (CIBEC), Giza, Egypt, 11–13 December 2014; pp. 15–18. [Google Scholar]
- Lima, H.R.S.; da Silva, J.S.; de Oliveira Farias, E.A.; Teixeira, P.R.S.; Eiras, C.; Nunes, L.C.C. Electrochemical Sensors and Biosensors for the Analysis of Antineoplastic Drugs. Biosens. Bioelectron. 2018, 108, 27–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thevendran, R.; Citartan, M. Assays to Estimate the Binding Affinity of Aptamers. Talanta 2022, 238, 122971. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Štukovnik, Z.; Fuchs-Godec, R.; Bren, U. Nanomaterials and Their Recent Applications in Impedimetric Biosensing. Biosensors 2023, 13, 899. [Google Scholar] [CrossRef] [Scilit]
- Onaş, A.M.; Dascălu, C.; Raicopol, M.D.; Pilan, L. Critical Design Factors for Electrochemical Aptasensors Based on Target-Induced Conformational Changes: The Case of Small-Molecule Targets. Biosensors 2022, 12, 816. [Google Scholar] [CrossRef] [Scilit]
- Labuda, J.; Brett, A.M.O.; Evtugyn, G.; Fojta, M.; Mascini, M.; Ozsoz, M.; Palchetti, I.; Paleček, E.; Wang, J. Electrochemical Nucleic Acid-Based Biosensors: Concepts, Terms, and Methodology (IUPAC Technical Report). Pure Appl. Chem. 2010, 82, 1161–1187. [Google Scholar] [CrossRef] [Scilit]
- Liu, D.; Li, W.; Zhu, C.; Li, Y.; Shen, X.; Li, L.; Yan, X.; You, T. Recent Progress on Electrochemical Biosensing of Aflatoxins: A Review. TrAC Trends Anal. Chem. 2020, 133, 115966. [Google Scholar] [CrossRef] [Scilit]
- Han, H.; Liu, C.; Sha, J.; Wang, Y.; Dong, C.; Li, M.; Jiao, T. Ferrocene-Reduced Graphene Oxide-Polyoxometalates Based Ternary Nanocomposites as Electrochemical Detection for Acetaminophen. Talanta 2021, 235, 122751. [Google Scholar] [CrossRef] [Scilit]
- Amaya-González, S.; López-López, L.; Miranda-Castro, R.; De-los-Santos-Álvarez, N.; Miranda-Ordieres, A.J.; Lobo-Castañón, M.J. Affinity of Aptamers Binding 33-Mer Gliadin Peptide and Gluten Proteins: Influence of Immobilization and Labeling Tags. Anal. Chim. Acta 2015, 873, 63–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Name | AFB1 Aptamer Seq. (from 5′ to 3′) | Length | No. of Studies | Kd (nM) from Original Seq./ΔG (kcal/mol) | Secondary Structures Generated in Mfold Web Server [63] | Selection/Affinity Evaluation Ref. |
|---|---|---|---|---|---|---|
| Apt1 | GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA | 50-mer | 27 | 10 nM */−10.26 | ![]() | [61] |
| Apt1 truncated v1 | GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCC | 47-mer | 5 | Not mentioned/−10.26 | ![]() | [61] |
| Apt1 truncated v1 reversed | CCCGGATCGCTTCCCGTGCTCTGTGTCTCTCTGTTGTGCACGGGTTG | 47-mer | 1 | -/−9.96 | ![]() | - |
| Apt1 truncated v2 | CCCGTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGGCCC | 51-mer | 2 | Not mentioned/−11.35 | ![]() | [61] |
| Apt1 truncated v3 | GCACGTGTTGTCTCTCTGTGTCTCGTGC | 28-mer | 4 | 70 ± 2 nM * 30.9 ± 2.3 nM **i 35 ± 4.2 nM **ii/−4.67 | ![]() | [65] * [66] **i [67] **ii |
| Apt1 truncated v4 | CACGTGTTGTCTCTCTGTGTCTCGTG | 26-mer | 1 | 49 ± 2 nM * 27.7 ± 2.4 nM **i 94 ± 24 nM **ii 21.8 nM ***/−2.16 | ![]() | [65] * [66] **i/*** [67] **ii |
| Apt1 truncated v5 | CGTGTTGTCTCTCTGTGTCTCG | 22-mer | 1 | 341 ± 20 nM ** i 498 ± 37.2 nM ** ii/+1.23 | ![]() | [66] **i [67] **ii |
| Apt2 | AGCAGCACAGAGGTCCAGTCGTATAAATTTACATGGCGTGCTACCGTGAA | 50-mer | 1 | 11.39 nM */−2.8 | ![]() | [68] |
| Apt3 | TGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGG | 35-mer | 2 | -/−1.42 | ![]() | - |
| Apt3 truncated v1 | TGGGGTTTTGGTGGCGGTGGTGTACGGGCGAGGG | 34-mer | 2 | -/−1.43 | ![]() | - |
| Apt3 truncated v2 | TGGGGTTTGGTGGGTGGTGTACGGGCAGG | 29-mer | 1 | -/+0.04 | ![]() | - |
| Apt4 | GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA | 36-mer | 1 | -/−0.61 | ![]() | [62] |
| Aptamer Name (Modifications Made in Direction 5′ à 3′) | Transducer Platform | Analysis Method | Dynamic Range | LOD | Interferents | Samples and Minimum Detectable AFB1 Concentration | Ref. | |
|---|---|---|---|---|---|---|---|---|
| Label-free | ||||||||
| HO(CH2)6-S-S-(CH2)6-Apt1 | GCE/rGO/MoS2/PANI@AuNPs/Apt/MCH | DPV | 0.01–1.0 fg/mL | 0.002 fg/mL | OTA, FB1 | Wine | 0.125 fg/mL | [77] |
| HS-Apt1 | GCE/ZIF-8/AuNPs/Apt/MCH | EIS | 10 pg/mL–0.1 µg/mL | 1.820 pg/mL | AFB2, AFG1, AFG2 | Corn oil, peanut oil | 1 ng/mL | [42] |
| NH2-C6-Apt1 | GCE/aminocaproic acid/Apt/AFB1/rGO | DPV | 0.15–1.25 ng/mL | 0.022 pg/mL | - | Human blood plasma and pasteurized cow milk | 150 pg/mL | [55] |
| NH2-C12-Apt1 | GCE/CuMOFs/GA/Apt/BSA | EIS | 1.0 pg/mL–200.0 ng/mL | 0.830 pg/mL | OTA, AFM1 | Wheat flour | 420 ng/mL | [79] |
| NH2-Apt1 | GFE/PAA/Apt/GO | CA | 1–20 ng/mL | 0.130 ng/mL | OTA, AFG1, AFB2 | - | - | [80] |
| Apt1-SH | SPCE/PANI Fe3O4@Au-Apt | EIS | 20 pg/mL–50 ng/mL | 0.015 ng/mL | FB1, AFB2, OTA | Peanut | 0.5 ng/mL | [51] |
| NH2-Apt1 | SPCE/PANI/GA/Apt | EIS | 9.37–24.98 pg/mL | 3.120 pg/mL | AFB2, OTA, OTB, ZEN | Pistachio nuts, cinnamon, cloves, corn, soybeans | 18.720 pg/mL | [49] |
| SH-(CH2)6-Apt1 | BDDE/AuNPs/Apt/MCH | EIS | 31.22 pg/mL‒3.12 µg/mL | 0.017 fg/mL | AFB2, AFG1, AFG2 | Peanut powder | 0.031 fg/mL | [76] |
| Apt1-NH2 | ITOE/O-VMSF/Apt/BSA | DPV | 3 pg/mL–3 µg/mL | 0.002 ng/mL | ZEN, OTA, AFB2 | Peanuts and corn | 0.1 ng/mL | [81] |
| Apt1 | ITOE/Au-hydrogel/MB-dsDNA | DPV | 0.001 ng/mL–1000 ng/mL | 0.800 pg/mL | - | Peanut, soil | 5 ng/mL | [82] |
| SH-(CH2)6-Apt1 | µPAD/TDNs/Apt-Au@Ni-Co LDH NCs | DPV | 0.2 pg/mL–100 ng/mL | 0.071 pg/mL | OTA, ZEN, DON, T-2 | Corn | 0.1 ng/mL | [83] |
| Apt1 v1 | GCE/hDNA-Apt/HP1+HP2 | ACV | 100 pg/mL–100 ng/mL | 0.039 ng/mL | AFB2, ZEN, OTA, FB1 | Corn, wheat, peanut, rice | 1 ng/mL | [84] |
| NH2-Apt1 v1 | GCE/Ti3C2Tx/GO-COOH-P4VP/Apt | DPV | 0.01 ng/mL–50 ng/mL | 0.003 ng/mL | AFG1, OTA | Grape juice, milk, soy milk | 0.5 ng/mL | [85] |
| HS-(CH2)6-Apt1 v1 | SPCE/AuNFs/APT/cDNA/CuNPs | DPV | 0.031 fg/mL–31.22 pg/mL | 2.107 ag/mL | AFB2, AFG1, AFG2 | Peanut, rice, soy, millet, corn, chestnut, beer | 0.312 pg/mL | [86] |
| SH-(CH2)6-Apt1 v3 | SPCE/COOH–GO–COOH–MWCNTs/pDA/AuNPs/SH-Apt/MCH | DPV | 0.1 fg/mL–100 pg/mL | 15.140 ag/mL | AFB2, OTB, FB1, FB2, ZON, DON | Milk | 0.1 pg/mL | [87] |
| SH-Apt2 | GE/Apt/MCH | EIS | 0.312–31.227 ng/mL | 0.131 ng/mL | OTA, AFB2, AFG1, AFG2 | Peanut | 0.312 ng/mL | [88] |
| NH2-Apt3 | GCE/PDDA-GNs/PS-COOH/BSA/Apt | EIS | 0.001–0.1 ng/mL | 0.002 ng/mL | OTA | Oil and soy sauce | 0.1 ng/mL | [89] |
| NH2-Apt3 v1 | GCE/AuNRs/Apt | DPV | 0.31–78.07 pg/mL | 0.090 pg/mL | AFM1, OTA, OTB | Human serum and rice samples | 0.312 pg/mL | [90] |
| NH2–Apt3 v1 | GCE/Cu2O NCs/Apt/MIP | EIS | 50 fg/mL–40 pg/mL | 0.012 pg/mL | AFG2, OTA, OTB, AFM1 | Milk | 2 pg/mL | [91] |
| Labeled | ||||||||
| NH2-(CH2)6-Apt1 | SGPGE/NiCo2O4/MWCNTs/MXene/pDA/cDNA/MCH/Apt/TEMPO-COOH | DPV | 2.5–200 ng/mL | 1.890 ng/mL | AFB2, AFG1, AFG2, OTA, Vit B1, Citric acid, Glu, Gly, Na+, K+ | Corn flour, corn residue | 25 ng/mL | [92] |
| Apt1 | GCE/THI-rGO/CS/Fc-Apt | ACV | 0.01–100 ng/mL | 0.010 ng/mL | AFB2, ZEN, OTA, FB1 | Peanut | 0.05 ng/mL | [93] |
| Apt1 | GCE/THI-rGO/AuNPs/cDNA/MCH/Apt-Fc | ACV | 0.05–20 ng/mL | 0.016 ng/mL | FB1, AFB2, ZEN, OTA | Peanut | 0.1 ng/mL | [94] |
| Apt1 | GCE/AuNPs/β-CD/BSA/Fc-DNA | EIS | 0.1 pg/mL–10 ng/mL | 0.049 pg/mL | AFB2, OTA, FB1, ZEN, DON, SEB | Peanut oil | 0.2 pg/mL | [95] |
| Apt1 | GCE/Au@rGO/TDNs/BSA/Apt/cDNA/HPCS-Fc | DPV | 0.01 pg/mL–100 µg/mL | 0.033 pg/mL | AFB2, OTA, ATP, BSA | Wheat powder | 1 ng/mL | [96] |
| Apt1 | GCE/THI-rGO/CS/Apt/Fc-cDNA | ACV | 0.001–100 ng/mL | 0.330 pg/mL | AFB2, AFM1, OTA, ZEN | Peanut, peanut butter, peanut oil | 0.1 ng/mL | [97] |
| Apt1 | GCE/AQ-rGO/AuNPs/MB-HP/Apt-Fc | ACV | 0.01 pg/mL–1 µg/mL | 0.010 pg/mL | FB1, AFB2, ZEN, OTA | Peanut | 1 pg/mL | [98] |
| COOH-Apt1-MB | SPCE/PT3C/HMDA/Apt-MB | DPV | 2.5–30 ng/mL | 1.600 pg/mL | OTA | Coffee | 5 ng/mL | [99] |
| Apt1 v1 reversed | GCE/AuNPs/sDNA/MCH/Fc-Apt/Fc-aDNA | ACV | 0.1–10000 pg/mL | 0.012 pg/mL | FB1, ZEN, OTA | Corn powder | 10 ng/mL | [100] |
| Apt1 v2 | ITOE/AuNFs/cDNA-MB/MCH/Apt-Fc/AFB1/ExoI | DPV | 0.1–1000 pg/mL | 0.032 pg/mL | AFB2, FB1, ZEN, OTA, Glu, BSA, Na+, K+, Mg2+, Zn2+, Fe3+, Al3+ | Peanut | 0.1 ng/mL | [58] |
| SH-Apt1 v4 | GE/Apt-MB/MCH | SWV | 2.500 pg/mL–0.936 µg/mL | 1.870 pg/mL | OTA, OTB, FB1, FB2, ZEN, AFG1, AFG2 | White wine, milk, corn flour | 2.500 pg/mL | [101] |
| SH-Apt1 v5 | GE/Apt-MB/MCH | SWV | 2.500 pg/mL–0.195 µg/mL | 1.870 pg/mL | OTA, OTB, FB1, FB2, ZEN | Beer, grape juice, corn flour | 2.500 pg/mL | [67] |
| NH2-(CH2)6-Apt3 | GCE/α-Fe2O3-Fe3O4/CDs/Apt/MB | DPV | 312.27 ng/mL–31.227 mg/mL | 0.156 µg/mL | AFB2, AFM1, AFG1, AFG2, miscellaneous aspergillin (ST), OTA, FB1 | Beer, rice, and peanut | 1.560 ng/mL | [102] |
| Apt3 v2 | GE/PTFE/sDNA-Fc/DNAzyme/Apt/Mn2+@MOF | DPV | 0.1 pg/mL–1000 ng/mL | 4.810 fg/mL | AFB2, AFG1, AFG2, AFM1, OTA, OTB, ZEN | Peanut oil | 10 pg/mL | [103] |
| Competitive | ||||||||
| NH2-(CH2)3-Apt1 | GCE/Ni-MOFs/AuNPs/MPA/Apt/BSA/cDNA/PBP | DPV | 5 pg/mL–150 ng/mL | 0.001 ng/mL | OTA, AFM1 | Rice flour | 0.750 ng/mL | [104] |
| BIO-Apt1 | GE/cDNA/MCH/Apt-AFB1/SA/ CeO2/PorMOFs | DPV | 0.03 pg/mL–3.12 ng/mL | 9.360 fg/mL | AFB2, OTA, OTB | Peanut, cow milk | 3.12 pg/mL | [105] |
| BIO-Apt1 | GE/sDNA/MCH/HP1/HP2/SA-MBs/Ag+-DNAzyme/MB | DPV | 1 pg/mL–50 ng/mL | 0.416 pg/mL | T-2, OTA, ZEN, FB1, DON | Corn flour, buckwheat powder, walnut powder, white peony powder, wine | 10 pg/mL | [69] |
| BIO-TEG-Apt1 | SPCE/PANI-PAA/AFB1-BSA/Lys-Apt-BIO/SAP/1NP | DPV | 0.1–10 ng/mL | 0.086 ng/mL | AFG1 | Corn flour | 1 ng/mL | [50] |
| SH-Apt1 | GCE/AuNPs/cDNA/MCH/Apt/(Exo I) AFB1-ssDNA-AuNPs-HRP | DPV | 1 pg/mL–200 ng/mL | 0.330 pg/mL | AFB2, AFG1, AFG2, AFM1, OTA, FB1 | Peanut, corn | 1 pg/mL | [57] |
| SH-Apt1 | SPGE/Apt/cDNA/AFB1/MB | DPV | 0.7–80 ng/mL | 0.100 ng/mL | ZEN, OTA, AFM1, DON | Rat serum samples | 10 ng/mL | [106] |
| Apt1 | SiO2@PbS-Apt/MBs-CdTe/cDNA1/HindIII/MBs-cDNA2 | SWV | 5–50 ng/mL | 4.500 pg/mL | FB1, OTA, AFB2, Glu, BSA, Ascorbic acid, K+, Fe3+ | Peanut | 0.500 ng/mL | [107] |
| Apt1 v1 | GE/cDNA/MCH/Apt/HP1/HP2 | DPV | 0.01–100 pg/mL | 2.840 fg/mL | AFB2, FB1, OTA, ZEN, DON | Corn, coix seed, polygala root | 0.500 pg/mL | [108] |
| Apt1 v2-SH | GCE/AuNPs/Fc-Apt/MB-cDNA | SWV | 0.3 pg/mL–3.12 ng/mL | 0.037 pg/mL | AFG1, AFG2, AFM1, DON, ZEN | Peanut, corn, wheat | 3.12 pg/mL | [109] |
| SH-Apt1 v3 | GE/Apt-MB/MCH/cDNA | SWV | 0.62 ng/mL–1.24 µg/mL | 0.620 ng/mL | OTA, OTB, FB1, FB2, ZEN | Beer, white wine | 0.620 ng/mL | [110] |
| SH-Apt1 v3 | GE/cDNA/MCH/Apt-MB | SWV | 0.62–156 ng/mL | 0.620 ng/mL | OTA, OTB, FB1, FB2, ZEN | White wine | 0.620 ng/mL | [111] |
| SH-(CH2)6-Apt1 v3 | GE/Apt/Cys/cDNA/Fc-AuNPs | DPV | 0.01–7.5 pg/mL | 0.010 pg/mL | AFM1, AFB2, AFG1, OTA, ZEN | Beer | 0.100 pg/mL | [112] |
| Apt4-SH | ITOE/AuNPs/Apt/MCH/cDNA-Au@Fe3O4 | EIS, photothermal | 10 pg/mL–300 ng/mL | 0.005 ng/mL | OTA, OTB, FB1, AFM1 | Peanut | 0.100 ng/mL | [113] |
| Simultaneous | ||||||||
| AFB1: NH2-(CH2)3-Apt1OTA: NH2-C6H12-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACACGCCACCCACACA | GCE/AuNPs-CNDs/MPA/Apt(s)/BSA/Bioconj | DPV | 0.01–100 ng/mL | AFB1: 5.200 pg/mL OTA: 4.300 pg/mL | AFM1 | Corn flour | AFB1: 0.100 ng/mL OTA: 0.500 ng/mL | [114] |
| AFB1: Fc-Apt1 v1 OTA: GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGAC-MB | GE/AQ-hDNA/MCH/Fc-Apt1/MB-Apt2 | ACV | AFB1: 10 pg/mL–3 ng/mL OTA: 30 pg/mL–10 ng/mL | AFB1: 4.300 pg/mL OTA: 13.300 pg/mL | AFB2, OTB, FB1, ZEN | Corn, wheat | AFB1: 0.100 ng/mL OTA: 0.100 ng/mL | [115] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ciobanu, D.; Hosu-Stancioiu, O.; Melinte, G.; Ognean, F.; Simon, I.; Cristea, C. Recent Progress of Electrochemical Aptasensors toward AFB1 Detection (2018–2023). Biosensors 2024, 14, 7. https://doi.org/10.3390/bios14010007
Ciobanu D, Hosu-Stancioiu O, Melinte G, Ognean F, Simon I, Cristea C. Recent Progress of Electrochemical Aptasensors toward AFB1 Detection (2018–2023). Biosensors. 2024; 14(1):7. https://doi.org/10.3390/bios14010007
Chicago/Turabian StyleCiobanu, Despina, Oana Hosu-Stancioiu, Gheorghe Melinte, Flavia Ognean, Ioan Simon, and Cecilia Cristea. 2024. "Recent Progress of Electrochemical Aptasensors toward AFB1 Detection (2018–2023)" Biosensors 14, no. 1: 7. https://doi.org/10.3390/bios14010007
APA StyleCiobanu, D., Hosu-Stancioiu, O., Melinte, G., Ognean, F., Simon, I., & Cristea, C. (2024). Recent Progress of Electrochemical Aptasensors toward AFB1 Detection (2018–2023). Biosensors, 14(1), 7. https://doi.org/10.3390/bios14010007













