An Anti-Oxidative Bioink for Cartilage Tissue Engineering Applications
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Synthesis of RTMA
2.3. Synthesis of SFGMA
2.4. Characterization of RTMA and SFGMA
2.5. Preparation of Hydrogels
2.6. Characterization of Hydrogels
2.7. Rabbit Chondrocyte Isolation, Culturing, and Hydrogen Peroxide (H2O2) Treatment
2.8. Cell Proliferation
2.9. 3D Bioprinting
2.10. In Vitro Antioxidant Property Evaluation
2.11. ROS Responsive Fluorescent Staining
2.12. Cartilage Regeneration Evaluation In Vitro and In Vivo
2.13. RNA Isolation and RT-qPCR Analysis
2.14. Statistical Analysis
3. Results and Discussion
3.1. Synthesis and Characterization of RTMA and SFGMA
3.2. Characterization of the Bioink Precursor Solutions and Prepared Hydrogels
3.3. Biocompatibility and Proliferation Testing In Vitro
3.4. Testing the Bioink for 3D Bioprinting Applications
3.5. Anti-Oxidative Property of the Bioink
3.6. Cartilage Regeneration Evaluation In Vitro and In Vivo
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Daly, A.C.; Prendergast, M.E.; Hughes, A.J.; Burdick, J.A. Bioprinting for the Biologist. Cell 2021, 184, 18–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kantaros, A.; Ganetsos, T. From Static to Dynamic: Smart Materials Pioneering Additive Manufacturing in Regenerative Medicine. Int. J. Mol. Sci. 2023, 24, 15748. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.H.; Hong, H.; Ajiteru, O.; Sultan, M.T.; Lee, Y.J.; Lee, J.S.; Lee, O.J.; Lee, H.; Park, H.S.; Choi, K.Y.; et al. 3D bioprinted silk fibroin hydrogels for tissue engineering. Nat. Protoc. 2021, 16, 5484–5532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levett, P.A.; Melchels, F.P.; Schrobback, K.; Hutmacher, D.W.; Malda, J.; Klein, T.J. A biomimetic extracellular matrix for cartilage tissue engineering centered on photocurable gelatin, hyaluronic acid and chondroitin sulfate. Acta Biomater. 2014, 10, 214–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, K.; Zhang, X.; Sun, Y.; Gao, Q.; Fu, J.; Cai, X.; He, Y. Printability during projection-based 3D bioprinting. Bioact. Mater. 2022, 11, 254–267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Janmaleki, M.; Liu, J.; Kamkar, M.; Azarmanesh, M.; Sundararaj, U.; Nezhad, A.S. Role of temperature on bio-printability of gelatin methacryloyl bioink in two-step cross-linking strategy for tissue engineering applications. Biomed. Mater. 2021, 16, 015021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kajave, N.S.; Schmitt, T.; Nguyen, T.U.; Gaharwar, A.K.; Kishore, V. Bioglass incorporated methacrylated collagen bioactive ink for 3D printing of bone tissue. Biomed. Mater. 2021, 16, 035003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Groll, J.; Burdick, J.A.; Cho, D.W.; Derby, B.; Gelinsky, M.; Heilshorn, S.C.; Jüngst, T.; Malda, J.; Mironov, V.A.; Nakayama, K.; et al. A definition of bioinks and their distinction from biomaterial inks. Biofabrication 2019, 11, 013001. [Google Scholar] [CrossRef] [Scilit]
- Decante, G.; Costa, J.B.; Silva-Correia, J.; Collins, M.N.; Reis, R.L.; Oliveira, J.M. Engineering bioinks for 3D bioprinting. Biofabrication 2021, 13, 032001. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Xu, S.; Feng, Q.; Dai, Q.; Yao, L.; Zhang, Y.; Gao, H.; Dong, H.; Chen, D.; Cao, X. 3D printed silk-gelatin hydrogel scaffold with different porous structure and cell seeding strategy for cartilage regeneration. Bioact. Mater. 2021, 6, 3396–3410. [Google Scholar] [CrossRef] [Scilit]
- Abdollahiyan, P.; Oroojalian, F.; Mokhtarzadeh, A.; de la Guardia, M. Hydrogel-based 3D bioprinting for bone and cartilage tissue engineering. Biotechnol. J. 2020, 15, 2000095. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Pizzute, T.; Pei, M. Anti-inflammatory strategies in cartilage repair. Tissue Eng. B 2014, 20, 655–668. [Google Scholar] [CrossRef] [Scilit]
- Henrotin, Y.E.; Bruckner, P.; Pujol, J.P.L. The role of reactive oxygen species in homeostasis and degradation of cartilage. Osteoarthr. Cartil. 2003, 11, 747–755. [Google Scholar] [CrossRef] [Scilit]
- Henrotin, Y.; Kurz, B.; Aigner, T. Oxygen and reactive oxygen species in cartilage degradation: Friends or foes. Osteoarthr. Cartil. 2005, 13, 643–654. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolduc, J.A.; Collins, J.A.; Loeser, R.F. Reactive oxygen species, aging and articular cartilage homeostasis. Free. Radic. Biol. Med. 2019, 132, 73–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- González-Rodríguez, M.L.; Fernandez-Romero, A.M.; Rabasco, A.M. Towards the antioxidant therapy in Osteoarthritis: Contribution of nanotechnology. J. Drug Deliv. Sci. Technol. 2017, 42, 94–106. [Google Scholar] [CrossRef] [Scilit]
- Hua, S.; De Matos, M.B.; Metselaar, J.M.; Storm, G. Current trends and challenges in the clinical translation of nanoparticulate nanomedicines: Pathways for translational development and commercialization. Front. Pharmacol. 2018, 9, 790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Z.; Han, S.; Gu, Z.; Wu, J. Advances and impact of antioxidant hydrogel in chronic wound healing. Adv. Healthc. Mater. 2020, 9, 1901502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H.; Lou, Z.; Zheng, S.; Wu, J.; Yao, Q.; Chen, R.; Kou, L.; Chen, D. Intra-articular drug delivery systems for osteoarthritis therapy: Shifting from sustained release to enhancing penetration into cartilage. Drug Deliv. 2022, 29, 767–791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gullon, B.; Lú-Chau, T.A.; Moreira, M.T.; Lema, J.M.; Eibes, G. Rutin: A review on extraction, identification and purification methods, biological activities and approaches to enhance its bioavailability. Trends Food Sci. Tech. 2017, 67, 220–235. [Google Scholar] [CrossRef] [Scilit]
- Ganeshpurkar, A.; Saluja, A.K. The Pharmacological Potential of Rutin. Saudi Pharm. J. 2017, 25, 149–164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hughes, S.D.; Ketheesan, N.; Haleagrahara, N. The therapeutic potential of plant flavonoids on rheumatoid arthritis. Crit. Rev. Food Sci. 2017, 57, 3601–3613. [Google Scholar] [CrossRef] [Scilit]
- Miranda, L.L.; Guimaraes-Lopes, V.D.P.; Altoe, L.S.; Sarandy, M.M.; Melo, F.C.S.A.; Novaes, R.D.; Goncalves, R.V. Plant Extracts in the Bone Repair Process: A Systematic Review. Mediat. Inflamm. 2019, 2019, 1296153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Che, C.T.; Wong, M.S.; Lam, C.W.K. Natural Products from Chinese Medicines with Potential Benefits to Bone Health. Molecules 2016, 21, 239. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Yu, M.; Xu, W.; Zou, L.; Ye, J.; Liu, Y.; Xiao, Y.; Luo, J. Rutin inhibited the advanced glycation end products-stimulated inflammatory response and extra-cellular matrix degeneration via targeting TRAF-6 and BCL-2 proteins in mouse model of osteoarthritis. Aging 2021, 13, 22134–22147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sui, C.; Wu, Y.; Zhang, R.; Zhang, T.; Zhang, Y.; Xi, J.; Ding, Y.; Wen, J.; Hu, Y. Rutin Inhibits the Progression of Osteoarthritis Through CBS-Mediated RhoA/ROCK Signaling. DNA Cell Biol. 2022, 41, 617–630. [Google Scholar] [CrossRef] [Scilit]
- Hong, H.; Seo, Y.B.; Lee, J.S.; Lee, Y.J.; Lee, H.; Ajiteru, O.; Sultan, M.T.; Lee, O.J.; Kim, S.H.; Park, C.H. Digital light processing 3D printed silk fibroin hydrogel for cartilage tissue engineering. Biomaterials 2020, 232, 119679. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.H.; Yeon, Y.K.; Lee, J.M.; Chao, J.R.; Lee, Y.J.; Seo, Y.B.; Sultan, M.T.; Lee, O.J.; Lee, J.S.; Yoon, S.; et al. Precisely printable and biocompatible silk fibroin bioink for digital light processing 3D printing. Nat. Commun. 2018, 9, 1620. [Google Scholar] [CrossRef] [Scilit]
- Zhu, W.; Zhou, Z.; Huang, Y.; Liu, H.; He, N.; Zhu, X.; Han, X.; Zhou, D.; Duan, X.; Chen, X.; et al. A versatile 3D-printable hydrogel for antichondrosarcoma, antibacterial, and tissue repair. J. Mater. Sci. Technol. 2023, 136, 200–211. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.; Xu, Y.; Li, H.; Dai, Y.; Zhou, G.; Zhou, Z.; Xia, H.; Liu, H. Tanshinone IIA Delivery Silk Fibroin Scaffolds Significantly Enhance Articular Cartilage Defect Repairing via Promoting Cartilage Regeneration. ACS Appl. Mater. Inter. 2020, 12, 21470–21480. [Google Scholar] [CrossRef] [Scilit]
- He, Y.; Zhou, Z.; Huang, Y.; Zhu, W.; He, N.; Zhu, X.; Han, X.; Liu, H. An antibacterial ε-poly-L-lysine-derived bioink for 3D bioprinting applications. J. Mater. Chem. B 2022, 10, 8274–8281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, W.; Fang, F.; Kong, Y.; Greer, S.E.; Kuss, M.; Liu, B.; Xue, W.; Jiang, X.; Lovell, P.; Mohs, A.M.; et al. Dynamic hyaluronic acid hydrogel with covalent linked gelatin as an anti-oxidative bioink for cartilage tissue engineering. Biofabrication 2021, 14, 014107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Zhang, Y.; Xia, Y.; Xu, C.; Meng, K.; Lian, J.; Zhang, X.; Xu, J.; Wang, C.; Zhao, B. Photocross-linked silk fibroin/hyaluronic acid hydrogel loaded with hDPSC for pulp regeneration. Int. J. Biol. Macromol. 2022, 215, 155–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Y.; Chen, J.; Liu, H.; Zhang, W. Photo-cross-linked Hydrogels for Cartilage and Osteochondral Repair. ACS Biomater. Sci. Eng. 2023, 9, 6567–6585. [Google Scholar] [CrossRef] [Scilit]
- Schirmer, L.; Chwalek, K.; Tsurkan, M.V.; Freudenberg, U.; Werner, C. Glycosaminoglycan-based hydrogels with programmable host reactions. Biomaterials 2020, 228, 119557. [Google Scholar] [CrossRef] [Scilit]
- Huh, J.; Moon, Y.W.; Park, J.; Atala, A.; Yoo, J.J.; Lee, S.J. Combinations of photoinitiator and UV absorber for cell-based digital light processing (DLP) bioprinting. Biofabrication 2021, 13, 034103. [Google Scholar] [CrossRef] [Scilit]
- Gomes, A.; Fernandes, E.; Lima, J.L.F.C. Fluorescence probes used for detection of reactive oxygen species. J. Biochem. Biophys. Methods 2005, 65, 45–80. [Google Scholar] [CrossRef] [Scilit]
- Martin, G.; Andriamanalijaona, R.; Mathy-Hartert, M.; Henrotin, Y.; Pujol, J.P. Comparative effects of IL-1β and hydrogen peroxide (H2O2) on catabolic and anabolic gene expression in juvenile bovine chondrocytes. Osteoarthr. Cartil. 2005, 13, 915–924. [Google Scholar] [CrossRef] [Scilit]
- Schuckert, K.H.; Jopp, S.; Osadnik, M. Modern Bone Regeneration Instead of Bone Transplantation: A Combination of Recombinant Human Bone Morphogenetic Protein-2 and Platelet-Rich Plasma for the Vertical Augmentation of the Maxillary Bone-A Single Case Report. Tissue Eng. Part C-Methods 2010, 16, 1335–1346. [Google Scholar] [CrossRef] [Scilit]








| Thickness (mm) | Section Numbers (100 μm/Layer) | Exposure Time per Layer (s) | Exposure Intensity (mW/cm2) |
|---|---|---|---|
| 1 | 10 | 8 | 22 of the first layer, 14 of the rest |
| The Full Name of Each RNA | Abbreviation | 5′-3′ | Primer Sequences |
|---|---|---|---|
| Glyceraldehyde-3-phosphate | GAPDH | Forward | TTGTCGCCATCAATGATCCAT |
| Reverse | GATGACCAGCTTCCCGTTCTC | ||
| SRY-related HMG box 9 | SOX9 | Forward | GCGTCAACGGCTCCAGCAAGA |
| Reverse | GCGTTGTGCAGGTGCGGGTAC | ||
| Aggrecan | AGG | Forward | GCTGCTACGGAGACAAGGATG |
| Reverse | CGTTGCGTAAAAGACCTCACC | ||
| Type II Collagen | COL II | Forward | GAGAGCCTGGGACCCCTGGAA |
| Reverse | CGCCTCCAGCCTTCTCGTCAA | ||
| Type I Collagen | COL I | Forward | CTAGCCACCTGCCAGTCTTTA |
| Reverse | GGACCATCATCACCATCTCTG | ||
| Matrix metalloproteinase-1 | MMP1 | Forward | TTCCAAAGCAGAGAGGCAATG |
| Reverse | CACCTGGGTTGCTTCATCATC | ||
| Matrix metalloproteinase-3 | MMP3 | Forward | GTGATACGCAAGCCCAGGTGT |
| Reverse | CTCTTGGCAGATCCGGTGTGT | ||
| Matrix metalloproteinase-13 | MMP13 | Forward | GTCTTCTGGCTCACGCTTTTC |
| Reverse | GGCAGCAACGAGAAACAAGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Yang, M.; Zhou, Z.; Sun, J.; Meng, X.; Huang, Y.; Zhu, W.; Zhu, S.; He, N.; Zhu, X.; et al. An Anti-Oxidative Bioink for Cartilage Tissue Engineering Applications. J. Funct. Biomater. 2024, 15, 37. https://doi.org/10.3390/jfb15020037
Chen X, Yang M, Zhou Z, Sun J, Meng X, Huang Y, Zhu W, Zhu S, He N, Zhu X, et al. An Anti-Oxidative Bioink for Cartilage Tissue Engineering Applications. Journal of Functional Biomaterials. 2024; 15(2):37. https://doi.org/10.3390/jfb15020037
Chicago/Turabian StyleChen, Xin, Mengni Yang, Zheng Zhou, Jingjing Sun, Xiaolin Meng, Yuting Huang, Wenxiang Zhu, Shuai Zhu, Ning He, Xiaolong Zhu, and et al. 2024. "An Anti-Oxidative Bioink for Cartilage Tissue Engineering Applications" Journal of Functional Biomaterials 15, no. 2: 37. https://doi.org/10.3390/jfb15020037
APA StyleChen, X., Yang, M., Zhou, Z., Sun, J., Meng, X., Huang, Y., Zhu, W., Zhu, S., He, N., Zhu, X., Han, X., & Liu, H. (2024). An Anti-Oxidative Bioink for Cartilage Tissue Engineering Applications. Journal of Functional Biomaterials, 15(2), 37. https://doi.org/10.3390/jfb15020037

