Surface Pre-Reacted Glass Filler Contributes to Tertiary Dentin Formation through a Mechanism Different Than That of Hydraulic Calcium-Silicate Cement
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Cell Culture
2.3. Cement Components and Material Preparation
2.4. LDH Cell Cytotoxicity Assay
2.5. Cell Proliferation Assay
2.6. Pulp Capping Procedure
2.7. Distribution of Released Ions from S-PRG Cement Using µXRF Analysis
2.8. Microstructure Analysis Using Scanning Electron Microscopy
2.9. Three-Dimensional µCT Analyses
2.10. Mineralized Nodule Formation Assay
2.11. RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction
2.12. RNA Sequencing and Data Analysis
2.13. Statistical Analysis
3. Results
3.1. Microstructure Analysis Using Scanning Electron Microscopy
3.2. Three-Dimensional μCT Analysis of Tertiary Dentin Formation
3.3. Distribution of Releasing Ions from S-PRG Cement Using µXRF Analysis
3.4. LDH Cytotoxicity and Proliferation Assay
3.5. Mineralized Nodule Formation Assay
3.6. RNA Sequence Analysis
3.7. Real-Time PCR Analysis of Pulpal Wound Healing Process-Related Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wilson, A.D.; Kent, B.E. A new translucent cement for dentistry. The glass ionomer cement. Br. Dent. J. 1972, 132, 133–135. [Google Scholar] [CrossRef] [PubMed]
- Wilson, A.D. Glass-ionomer cement origins, development and future. Clin. Mater. 1991, 7, 275–282. [Google Scholar] [CrossRef]
- Frencken, J.E.; Leal, S.C.; Navarro, M.F. Twenty-five-year atraumatic restorative treatment (ART) approach: A comprehensive overview. Clin. Oral Investig. 2012, 16, 1337–1346. [Google Scholar] [CrossRef] [PubMed]
- da Rosa, W.L.O.; Piva, E.; da Silva, A.F. Disclosing the physiology of pulp tissue for vital pulp therapy. Int. Endod. J. 2018, 51, 829–846. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schwendicke, F.; Brouwer, F.; Schwendicke, A.; Paris, S. Different materials for direct pulp capping: Systematic review and meta-analysis and trial sequential analysis. Clin. Oral Investig. 2016, 20, 1121–1132. [Google Scholar] [CrossRef] [PubMed]
- Okiji, T.; Yoshiba, K. Reparative dentinogenesis induced by mineral trioxide aggregate: A review from the biological and physicochemical points of view. Int. J. Dent. 2009, 2009, 464280. [Google Scholar] [CrossRef]
- Tananbaum, N.I. Pulp capping with zinc oxide-eugenol and calcium hydroxide: Clinical studies on 135 patients. J. Dent. Child. 1951, 18, 16–20. [Google Scholar] [PubMed]
- Mente, J.; Hufnagel, S.; Leo, M.; Michel, A.; Gehrig, H.; Panagidis, D.; Saure, D.; Pfefferle, T. Treatment outcome of mineral trioxide aggregate or calcium hydroxide direct pulp capping: Long-term results. J. Endod. 2014, 40, 1746–1751. [Google Scholar] [CrossRef] [PubMed]
- Tziafa, C.; Koliniotou-Koumpia, E.; Papadimitriou, S.; Tziafas, D. Dentinogenic activity of biodentine in deep cavities of miniature swine teeth. J. Endod. 2015, 41, 1161–1166. [Google Scholar] [CrossRef]
- Min, K.S.; Park, H.J.; Lee, S.K.; Park, S.H.; Hong, C.U.; Kim, H.W.; Lee, H.H.; Kim, E.C. Effect of mineral trioxide aggregate on dentin bridge formation and expression of dentin sialoprotein and heme-oxygenase-1 in human dental pulp. J. Endod. 2008, 34, 666–670. [Google Scholar] [CrossRef]
- Paranjpe, A.; Smoot, T.; Zhang, H.; Johnson, J.D. Direct contact with mineral trioxide aggregate activates and differentiates human dental pulp cells. J. Endod. 2011, 37, 1691–1695. [Google Scholar] [CrossRef] [PubMed]
- Parirokh, M.; Torabinejad, M. Mineral trioxide aggregate: A comprehensive literature review—Part III: Clinical applications, drawbacks, and mechanism of action. J. Endod. 2010, 36, 400–413. [Google Scholar] [CrossRef]
- do Nascimento, A.B.; Fontana, U.F.; Teixeira, H.M.; Costa, C.A. Biocompatibility of a resin-modified glass-ionomer cement applied as pulp capping in human teeth. Am. J. Dent. 2000, 13, 28–34. [Google Scholar] [PubMed]
- Ikemura, K.; Tay, F.R.; Endo, T.; Pashley, D.H. A review of chemical-approach and ultramorphological studies on the development of fluoride-releasing dental adhesives comprising new pre-reacted glass ionomer (PRG) fillers. Dent. Mater. J. 2008, 27, 315–339. [Google Scholar] [CrossRef] [PubMed]
- Kaga, M.; Kakuda, S.; Ida, Y.; Toshima, H.; Endo, K.; Sano, H. Inhibition of enamel demineralization by buffering effect of S-PRG filler-containing dental sealant. Eur. J. Oral Sci. 2014, 122, 78–83. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.; Imazato, S.; Chen, J.H.; Mayanagi, G.; Takahashi, N.; Ishimoto, T.; Nakano, T. Effects of a coating resin containing S-PRG filler to prevent demineralization of root surfaces. Dent. Mater. J. 2012, 31, 909–915. [Google Scholar] [CrossRef] [Green Version]
- Ito, S.; Iijima, M.; Hashimoto, M.; Tsukamoto, N.; Mizoguchi, I.; Saito, T. Effects of surface pre-reacted glass-ionomer fillers on mineral induction by phosphoprotein. J. Dent. 2011, 39, 72–79. [Google Scholar] [CrossRef] [PubMed]
- Saku, S.; Kotake, H.; Scougall-Vilchis, R.J.; Ohashi, S.; Hotta, M.; Horiuchi, S.; Hamada, K.; Asaoka, K.; Tanaka, E.; Yamamoto, K. Antibacterial activity of composite resin with glass-ionomer filler particles. Dent. Mater. J. 2010, 29, 193–198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, L.; Okiji, T. Evaluation of the ions release/incorporation of the prototype S-PRG filler-containing endodontic sealer. Dent. Mater. J. 2011, 30, 898–903. [Google Scholar] [CrossRef] [PubMed]
- Shimazu, K.; Ogata, K.; Karibe, H. Evaluation of the ion releasing and recharging abilities of a resin-based fissure sealant containing S-PRG filler. Dent. Mater. J. 2011, 30, 923–927. [Google Scholar] [CrossRef] [PubMed]
- Miki, S.; Kitagawa, H.; Kitagawa, R.; Kiba, W.; Hayashi, M.; Imazato, S. Antibacterial activity of resin composites containing surface pre-reacted glass-ionomer (S-PRG) filler. Dent. Mater. 2016, 32, 1095–1102. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wei, L.; Wu, C.; Miron, R.J. Periodontal regeneration using strontium-loaded mesoporous bioactive glass scaffolds in osteoporotic rats. PLoS ONE 2014, 9, e104527. [Google Scholar] [CrossRef] [PubMed]
- Kuang, G.M.; Yau, W.P.; Wu, J.; Yeung, K.W.; Pan, H.; Lam, W.M.; Lu, W.W.; Chiu, K.Y. Strontium exerts dual effects on calcium phosphate cement: Accelerating the degradation and enhancing the osteoconductivity both in vitro and in vivo. J. Biomed. Mater. Res. A 2015, 103, 1613–1621. [Google Scholar] [CrossRef] [PubMed]
- Ilyas, A.; Odatsu, T.; Shah, A.; Monte, F.; Kim, H.K.; Kramer, P.; Aswath, P.B.; Varanasi, V.G. Amorphous silica: A new antioxidant role for rapid critical-sized bone defect healing. Adv. Healthc. Mater. 2016, 5, 2199–2213. [Google Scholar] [CrossRef]
- Takahashi, Y.; Okamoto, M.; Komichi, S.; Imazato, S.; Nakatsuka, T.; Sakamoto, S.; Kimoto, K.; Hayashi, M. Application of a direct pulp capping cement containing S-PRG filler. Clin. Oral Investig. 2019, 23, 1723–1731. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.; Okamoto, M.; Komichi, S.; Watanabe, M.; Huang, H.; Takahashi, Y.; Hayashi, M. Lithium-containing surface pre-reacted glass fillers enhance hDPSCfunctions and induce reparative dentin formation in a rat pulp cappingmodel through activation of Wnt/b-catenin signaling. Acta Biomater. 2019, in press. [Google Scholar] [CrossRef] [PubMed]
- Okamoto, M.; Takahashi, Y.; Komichi, S.; Ali, M.; Yoneda, N.; Ishimoto, T.; Nakano, T.; Hayashi, M. Novel evaluation method of dentin repair by direct pulp capping using high-resolution micro-computed tomography. Clin. Oral Investig. 2018, 22, 2879–2887. [Google Scholar] [CrossRef]
- Okamoto, M.; Takahashi, Y.; Komichi, S.; Cooper, P.R.; Hayashi, M. Dentinogenic effects of extracted dentin matrix components digested with matrix metalloproteinases. Sci. Rep. 2018, 8, 10690. [Google Scholar] [CrossRef] [PubMed]
- Cooper, P.R.; Takahashi, Y.; Graham, L.W.; Simon, S.; Imazato, S.; Smith, A.J. Inflammation-regeneration interplay in the dentine-pulp complex. J. Dent. 2010, 38, 687–697. [Google Scholar] [CrossRef]
- Smith, A.J.; Scheven, B.A.; Takahashi, Y.; Ferracane, J.L.; Shelton, R.M.; Cooper, P.R. Dentine as a bioactive extracellular matrix. Arch. Oral Biol. 2012, 57, 109–121. [Google Scholar] [CrossRef]
- Magloire, H.; Romeas, A.; Melin, M.; Couble, M.L.; Bleicher, F.; Farges, J.C. Molecular regulation of odontoblast activity under dentin injury. Adv. Dent. Res. 2001, 15, 46–50. [Google Scholar] [CrossRef] [PubMed]
- Tomson, P.L.; Lumley, P.J.; Smith, A.J.; Cooper, P.R. Growth factor release from dentine matrix by pulp-capping agents promotes pulp tissue repair-associated events. Int. Endod. J. 2017, 50, 281–292. [Google Scholar] [CrossRef] [PubMed]
- Vogel, P.; Hansen, G.M.; Read, R.W.; Vance, R.B.; Thiel, M.; Liu, J.; Wronski, T.J.; Smith, D.D.; Jeter-Jones, S.; Brommage, R. Amelogenesis imperfecta and other biomineralization defects in Fam20a and Fam20c null mice. Vet. Pathol. 2012, 49, 998–1017. [Google Scholar] [CrossRef] [PubMed]
- Nakashima, M. Bone morphogenetic proteins in dentin regeneration for potential use in endodontic therapy. Cytokine Growth Factor Rev. 2005, 16, 369–376. [Google Scholar] [CrossRef] [PubMed]
- Okamoto, M.; Takahashi, Y.; Komichi, S.; Ali, M.; Watanabe, M.; Hayashi, M. Effect of tissue inhibitor of metalloprotease 1 on human pulp cells in vitro and rat pulp tissue in vivo. Int. Endod. J. 2019, 52, 1051–1062. [Google Scholar] [CrossRef] [PubMed]
- Hilton, T.J.; Ferracane, J.L.; Mancl, L. Northwest Practice-based Research Collaborative in Evidence-based Dentistry (NWP). Comparison of CaOH with MTA for direct pulp capping: A PBRN randomized clinical trial. J. Dent. Res. 2013, 92, 16–22. [Google Scholar] [CrossRef]
- Torabinejad, M.; Rastegar, A.F.; Kettering, J.D.; Pitt Ford, T.R. Bacterial leakage of mineral trioxide aggregate as a root-end filling material. J. Endod. 1995, 21, 109–112. [Google Scholar] [CrossRef]
- Camilleri, J.; Montesin, F.E.; Di Silvio, L.; Pitt Ford, T.R. The chemical constitution and biocompatibility of accelerated Portland cement for endodontic use. Int. Endod. J. 2005, 38, 834–842. [Google Scholar] [CrossRef]
- Marciano, M.A.; Duarte, M.A.; Camilleri, J. Dental discoloration caused by bismuth oxide in MTA in the presence of sodium hypochlorite. Clin. Oral Investig. 2015, 19, 2201–2209. [Google Scholar] [CrossRef]
- Jang, J.H.; Kang, M.; Ahn, S.; Kim, S.; Kim, W.; Kim, Y.; Kim, E. Tooth discoloration after the use of new pozzolan cement (Endocem) and mineral trioxide aggregate and the effects of internal bleaching. J. Endod. 2013, 39, 1598–1602. [Google Scholar] [CrossRef]
- Tran, X.V.; Gorin, C.; Willig, C.; Baroukh, B.; Pellat, B.; Decup, F.; Opsahl Vital, S.; Chaussain, C.; Boukpessi, T. Effect of a calcium-silicate-based restorative cement on pulp repair. J. Dent. Res. 2012, 91, 1166–1171. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Tian, J.; Cheng, J.; Zhang, J. Migration of CXCR4 gene-modified bone marrow-derived mesenchymal stem cells to the acute injured kidney. J. Cell Biochem. 2013, 114, 2677–2689. [Google Scholar] [CrossRef] [PubMed]
- Otsuru, S.; Tamai, K.; Yamazaki, T.; Yoshikawa, H.; Kaneda, Y. Circulating bone marrow-derived osteoblast progenitor cells are recruited to the bone-forming site by the CXCR4/stromal cell-derived factor-1 pathway. Stem Cells 2008, 26, 223–234. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Zhu, Y.Q.; Du, R.; Gu, Y.X.; Xia, L.; Qin, F.; Ritchie, H.H. The expression and role of stromal cell-derived factor-1alpha-CXCR4 axis in human dental pulp. J. Endod. 2008, 34, 939–944. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.S.; Kim, Y.S.; Bae, W.J.; Lee, H.J.; Chang, S.W.; Kim, W.S.; Kim, E.C. The role of SDF-1 and CXCR4 on odontoblastic differentiation in human dental pulp cells. Int. Endod. J. 2014, 47, 534–541. [Google Scholar] [CrossRef] [PubMed]
- Lin, P.S.; Chang, H.H.; Yeh, C.Y.; Chang, M.C.; Chan, C.P.; Kuo, H.Y.; Liu, H.C.; Liao, W.C.; Jeng, P.Y.; Yeung, S.Y.; et al. Transforming growth factor beta 1 increases collagen content, and stimulates procollagen I and tissue inhibitor of metalloproteinase-1 production of dental pulp cells: Role of MEK/ERK and activin receptor-like kinase-5/Smad signaling. J. Formos. Med. Assoc. 2017, 116, 351–358. [Google Scholar] [CrossRef] [PubMed]
- Luiz de Oliveira da Rosa, W.; Machado da Silva, T.; Fernando Demarco, F.; Piva, E.; Fernandes da Silva, A. Could the application of bioactive molecules improve vital pulp therapy success? A systematic review. J. Biomed. Mater. Res. A 2017, 105, 941–956. [Google Scholar] [CrossRef] [PubMed]
- Prati, C.; Gandolfi, M.G. Calcium silicate bioactive cements: Biological perspectives and clinical applications. Dent. Mater. 2015, 31, 351–370. [Google Scholar] [CrossRef] [PubMed]
- Duarte, M.A.; Demarchi, A.C.; Yamashita, J.C.; Kuga, M.C.; Fraga Sde, C. pH and calcium ion release of 2 root-end filling materials. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 2003, 95, 345–347. [Google Scholar] [CrossRef]
- Wang, Y.; Li, J.; Song, W.; Yu, J. Mineral trioxide aggregate upregulates odonto/osteogenic capacity of bone marrow stromal cells from craniofacial bones via JNK and ERK MAPK signalling pathways. Cell Prolif. 2014, 47, 241–248. [Google Scholar] [CrossRef]
- Zhang, J.; Zhu, L.X.; Cheng, X.; Lin, Y.; Yan, P.; Peng, B. Promotion of dental pulp cell migration and pulp repair by a bioceramic putty involving FGFR-mediated signaling pathways. J. Dent. Res. 2015, 94, 853–862. [Google Scholar] [CrossRef] [PubMed]
Materials | Main Composition | |
---|---|---|
MTA | hydraulic calcium-silicate cement (ProRoot mineral trioxide aggregate (MTA), Dentsply Sirona) | Powder: white tricalcium silicate, dicalcium silicate, calcium sulfate, silica, and bismuth oxide trioxide aggregate. Lot number 108824. |
S-PRG | Surface pre-reacted glass-ionomer filler cement (Shofu) | Powder: surface pre-reacted glass-ionomer filler (fluoroboroaluminosilicate glass). Liquid: copolymer of acrylic acid, tricarboxylic acid, water, and others. |
Co-GIC | Conventional glass-ionomer cement (Base cement, Shofu) | Powder: fluoroaluminosilicate glass, others. Lot number 071797. Liquid: copolymer of acrylic acid and tricarboxylic acid, tartaric acid. Lot number 061730. |
Name | 5′ Sequence (Forward) | 3′ Sequence (Reverse) |
---|---|---|
CXCL-12 | GAGCCAACGTCAAGCATCTCAA | TTTAGCTTCGGGTCAATGCCAC |
TGF b1 | CCCAGCATCTGCAAAGCTC | GTCAATGTACAGCTGCCGCA |
GAPDH | AATCCCATCACCATCTTCCA | TGGACTCCACGACGTACTCA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Okamoto, M.; Ali, M.; Komichi, S.; Watanabe, M.; Huang, H.; Ito, Y.; Miura, J.; Hirose, Y.; Mizuhira, M.; Takahashi, Y.; et al. Surface Pre-Reacted Glass Filler Contributes to Tertiary Dentin Formation through a Mechanism Different Than That of Hydraulic Calcium-Silicate Cement. J. Clin. Med. 2019, 8, 1440. https://doi.org/10.3390/jcm8091440
Okamoto M, Ali M, Komichi S, Watanabe M, Huang H, Ito Y, Miura J, Hirose Y, Mizuhira M, Takahashi Y, et al. Surface Pre-Reacted Glass Filler Contributes to Tertiary Dentin Formation through a Mechanism Different Than That of Hydraulic Calcium-Silicate Cement. Journal of Clinical Medicine. 2019; 8(9):1440. https://doi.org/10.3390/jcm8091440
Chicago/Turabian StyleOkamoto, Motoki, Manahil Ali, Shungo Komichi, Masakatsu Watanabe, Hailing Huang, Yuki Ito, Jiro Miura, Yujiro Hirose, Manabu Mizuhira, Yusuke Takahashi, and et al. 2019. "Surface Pre-Reacted Glass Filler Contributes to Tertiary Dentin Formation through a Mechanism Different Than That of Hydraulic Calcium-Silicate Cement" Journal of Clinical Medicine 8, no. 9: 1440. https://doi.org/10.3390/jcm8091440