Exploring Obscurin and SPEG Kinase Biology
Abstract
1. Introduction
2. Materials and Methods
2.1. Cloning and Generation of Constructs
2.2. Cell Culture
2.3. Immunofluorescence and Microscopy
2.4. Antibodies
2.5. Protein Analysis
2.6. Modeling and Bioinformatics Analyses
3. Results
3.1. Obscurin Contains Phosphorylation Sites C-Terminal to Kinase Domain 1
3.2. Presence of OK1 Phosphorylation Sites Affects the Localization of the Fragment in Differentiated Muscle Cells
3.3. Modelling Suggests That OK1 Is an Active Protein Kinase
3.4. Actions of OK1 Auto-Phosphorylate the Obscurin Inter-Kinase Region
3.5. Structural Analysis of the Putative Autophosphorylation Substrate C-Terminal of OK1
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Borisov, A.B.; Raeker, M.O.; Russell, M.W. Developmental expression and differential cellular localization of obscurin and obscurin-associated kinase in cardiac muscle cells. J. Cell Biochem. 2008, 103, 1621–1635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Young, P.; Ehler, E.; Gautel, M. Obscurin, a giant sarcomeric Rho guanine nucleotide exchange factor protein involved in sarcomere assembly. J. Cell Biol. 2001, 154, 123–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geisler, S.B.; Robinson, D.; Hauringa, M.; Raeker, M.O.; Borisov, A.B.; Westfall, M.V.; Russell, M.W. Obscurin-like 1, OBSL1, is a novel cytoskeletal protein related to obscurin. Genomics 2007, 89, 521–531. [Google Scholar] [CrossRef] [Scilit]
- Bang, M.L.; Centner, T.; Fornoff, F.; Geach, A.J.; Gotthardt, M.; McNabb, M.; Witt, C.C.; Labeit, D.; Gregorio, C.C.; Granzier, H.; et al. The complete gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform, and its interaction with obscurin identify a novel Z-line to I-band linking system. Circ. Res. 2001, 89, 1065–1072. [Google Scholar] [CrossRef] [Scilit]
- Hsieh, C.M.; Fukumoto, S.; Layne, M.D.; Maemura, K.; Charles, H.; Patel, A.; Perrella, M.A.; Lee, M.E. Striated muscle preferentially expressed genes alpha and beta are two serine/threonine protein kinases derived from the same gene as the aortic preferentially expressed gene-1. J. Biol. Chem. 2000, 275, 36966–36973. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Russell, M.W.; Raeker, M.O.; Korytkowski, K.A.; Sonneman, K.J. Identification, tissue expression and chromosomal localization of human Obscurin-MLCK, a member of the titin and Dbl families of myosin light chain kinases. Gene 2002, 282, 237–246. [Google Scholar] [CrossRef] [Scilit]
- Sutter, S.B.; Raeker, M.O.; Borisov, A.B.; Russell, M.W. Orthologous relationship of obscurin and Unc-89: Phylogeny of a novel family of tandem myosin light chain kinases. Dev. Genes Evol. 2004, 214, 352–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kontrogianni-Konstantopoulos, A.; Bloch, R.J. Obscurin: A multitasking muscle giant. J. Muscle Res. Cell Motil. 2005, 26, 419–426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kontrogianni-Konstantopoulos, A.; Ackermann, M.A.; Bowman, A.L.; Yap, S.V.; Bloch, R.J. Muscle giants: Molecular scaffolds in sarcomerogenesis. Physiol. Rev. 2009, 89, 1217–1267. [Google Scholar] [CrossRef] [Scilit]
- Fukuzawa, A.; Idowu, S.; Gautel, M. Complete human gene structure of obscurin: Implications for isoform generation by differential splicing. J. Muscle Res. Cell Motil. 2005, 26, 427–434. [Google Scholar] [CrossRef] [Scilit]
- Simon, B.; Huart, A.S.; Temmerman, K.; Vahokoski, J.; Mertens, H.D.; Komadina, D.; Hoffmann, J.E.; Yumerefendi, H.; Svergun, D.I.; Kursula, P.; et al. Death-Associated Protein Kinase Activity Is Regulated by Coupled Calcium/Calmodulin Binding to Two Distinct Sites. Structure 2016, 24, 851–861. [Google Scholar] [CrossRef] [Scilit]
- Temmerman, K.; de Diego, I.; Pogenberg, V.; Simon, B.; Jonko, W.; Li, X.; Wilmanns, M. A PEF/Y substrate recognition and signature motif plays a critical role in DAPK-related kinase activity. Chem. Biol. 2014, 21, 264–273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, S.H.; Parker, M.W.; Lei, J.Y.; Wilce, M.C.; Benian, G.M.; Kemp, B.E. Insights into autoregulation from the crystal structure of twitchin kinase. Nature 1994, 369, 581–584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lange, S.; Xiang, F.; Yakovenko, A.; Vihola, A.; Hackman, P.; Rostkova, E.; Kristensen, J.; Brandmeier, B.; Franzen, G.; Hedberg, B.; et al. The kinase domain of titin controls muscle gene expression and protein turnover. Science 2005, 308, 1599–1603. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gautel, M. Cytoskeletal protein kinases: Titin and its relations in mechanosensing. Pflug. Arch. 2011, 462, 119–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bogomolovas, J.; Gasch, A.; Simkovic, F.; Rigden, D.J.; Labeit, S.; Mayans, O. Titin kinase is an inactive pseudokinase scaffold that supports MuRF1 recruitment to the sarcomeric M-line. Open Biol. 2014, 4, 140041. [Google Scholar] [CrossRef] [Scilit]
- Small, T.M.; Gernert, K.M.; Flaherty, D.B.; Mercer, K.B.; Borodovsky, M.; Benian, G.M. Three new isoforms of Caenorhabditis elegans UNC-89 containing MLCK-like protein kinase domains. J. Mol. Biol. 2004, 342, 91–108. [Google Scholar] [CrossRef] [Scilit]
- Xiong, G.; Qadota, H.; Mercer, K.B.; McGaha, L.A.; Oberhauser, A.F.; Benian, G.M. A LIM-9 (FHL)/SCPL-1 (SCP) complex interacts with the C-terminal protein kinase regions of UNC-89 (obscurin) in Caenorhabditis elegans muscle. J. Mol. Biol. 2009, 386, 976–988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mayans, O.; Benian, G.M.; Simkovic, F.; Rigden, D.J. Mechanistic and functional diversity in the mechanosensory kinases of the titin-like family. Biochem. Soc. Trans. 2013, 41, 1066–1071. [Google Scholar] [CrossRef] [Scilit]
- Quick, A.P.; Wang, Q.; Philippen, L.E.; Barreto-Torres, G.; Chiang, D.Y.; Beavers, D.; Wang, G.; Khalid, M.; Reynolds, J.O.; Campbell, H.M.; et al. SPEG (Striated Muscle Preferentially Expressed Protein Kinase) Is Essential for Cardiac Function by Regulating Junctional Membrane Complex Activity. Circ. Res. 2017, 120, 110–119. [Google Scholar] [CrossRef] [Scilit]
- Quan, C.; Li, M.; Du, Q.; Chen, Q.; Wang, H.; Campbell, D.; Fang, L.; Xue, B.; MacKintosh, C.; Gao, X.; et al. SPEG Controls Calcium Reuptake into the Sarcoplasmic Reticulum Through Regulating SERCA2a by Its Second Kinase-Domain. Circ. Res. 2019, 124, 712–726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agrawal, P.B.; Pierson, C.R.; Joshi, M.; Liu, X.; Ravenscroft, G.; Moghadaszadeh, B.; Talabere, T.; Viola, M.; Swanson, L.C.; Haliloglu, G.; et al. SPEG interacts with myotubularin, and its deficiency causes centronuclear myopathy with dilated cardiomyopathy. Am. J. Hum. Genet. 2014, 95, 218–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campbell, H.M.; Quick, A.P.; Abu-Taha, I.; Chiang, D.Y.; Kramm, C.F.; Word, T.A.; Brandenburg, S.; Hulsurkar, M.; Alsina, K.M.; Liu, H.B.; et al. Loss of SPEG Inhibitory Phosphorylation of Ryanodine Receptor Type-2 Promotes Atrial Fibrillation. Circulation 2020, 142, 1159–1172. [Google Scholar] [CrossRef] [Scilit]
- Hu, L.Y.; Kontrogianni-Konstantopoulos, A. The kinase domains of obscurin interact with intercellular adhesion proteins. FASEB J. 2013, 27, 2001–2012. [Google Scholar] [CrossRef] [Scilit]
- Qadota, H.; McGaha, L.A.; Mercer, K.B.; Stark, T.J.; Ferrara, T.M.; Benian, G.M. A novel protein phosphatase is a binding partner for the protein kinase domains of UNC-89 (Obscurin) in Caenorhabditis elegans. Mol. Biol. Cell 2008, 19, 2424–2432. [Google Scholar] [CrossRef] [Scilit]
- Lange, S.; Pinotsis, N.; Agarkova, I.; Ehler, E. The M-band: The underestimated part of the sarcomere. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118440. [Google Scholar] [CrossRef] [Scilit]
- Grogan, A.; Kontrogianni-Konstantopoulos, A. Unraveling obscurins in heart disease. Pflug. Arch. 2019, 471, 735–743. [Google Scholar] [CrossRef] [Scilit]
- Grogan, A.; Tsakiroglou, P.; Kontrogianni-Konstantopoulos, A. Double the trouble: Giant proteins with dual kinase activity in the heart. Biophys. Rev. 2020, 12, 1019–1029. [Google Scholar] [CrossRef] [Scilit]
- Kho, A.L.; Perera, S.; Alexandrovich, A.; Gautel, M. The sarcomeric cytoskeleton as a target for pharmacological intervention. Curr. Opin. Pharmacol. 2012, 12, 347–354. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Ramjiganesh, T.; Chen, Y.H.; Chung, S.W.; Hall, S.R.; Schissel, S.L.; Padera, R.F., Jr.; Liao, R.; Ackerman, K.G.; Kajstura, J.; et al. Disruption of striated preferentially expressed gene locus leads to dilated cardiomyopathy in mice. Circulation 2009, 119, 261–268. [Google Scholar] [CrossRef] [Scilit]
- Campbell, H.; Aguilar-Sanchez, Y.; Quick, A.P.; Dobrev, D.; Wehrens, X. SPEG: A key regulator of cardiac calcium homeostasis. Cardiovasc. Res. 2020. [Google Scholar] [CrossRef] [Scilit]
- Tang, J.; Ma, W.; Chen, Y.; Jiang, R.; Zeng, Q.; Tan, J.; Jiang, H.; Li, Q.; Zhang, V.W.; Wang, J.; et al. Novel SPEG variant cause centronuclear myopathy in China. J. Clin. Lab. Anal. 2020, 34, e23054. [Google Scholar] [CrossRef] [Scilit]
- Borisov, A.B.; Raeker, M.O.; Kontrogianni-Konstantopoulos, A.; Yang, K.; Kurnit, D.M.; Bloch, R.J.; Russell, M.W. Rapid response of cardiac obscurin gene cluster to aortic stenosis: Differential activation of Rho-GEF and MLCK and involvement in hypertrophic growth. Biochem. Biophys. Res. Commun. 2003, 310, 910–918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, P.; Xiao, Y.; Wang, Y.; Zheng, Z.; Chen, L.; Yang, X.; Li, J.; Wu, W.; Zhang, S. Intracellular calcium current disorder and disease phenotype in OBSCN mutant iPSC-based cardiomyocytes in arrhythmogenic right ventricular cardiomyopathy. Theranostics 2020, 10, 11215–11229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lange, S.; Ouyang, K.; Meyer, G.; Cui, L.; Cheng, H.; Lieber, R.L.; Chen, J. Obscurin determines the architecture of the longitudinal sarcoplasmic reticulum. J. Cell Sci. 2009, 122, 2640–2650. [Google Scholar] [CrossRef] [Scilit]
- Blondelle, J.; Marrocco, V.; Clark, M.; Desmond, P.; Myers, S.; Nguyen, J.; Wright, M.; Bremner, S.; Pierantozzi, E.; Ward, S.; et al. Murine obscurin and Obsl1 have functionally redundant roles in sarcolemmal integrity, sarcoplasmic reticulum organization, and muscle metabolism. Commun. Biol. 2019, 2, 178. [Google Scholar] [CrossRef] [Scilit]
- Grogan, A.; Coleman, A.; Joca, H.; Granzier, H.; Russel, M.W.; Ward, C.W.; Kontrogianni-Konstantopoulos, A. Deletion of obscurin immunoglobulin domains Ig58/59 leads to age-dependent cardiac remodeling and arrhythmia. Basic Res. Cardiol. 2020, 115, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scholten, A.; Preisinger, C.; Corradini, E.; Bourgonje, V.J.; Hennrich, M.L.; van Veen, T.A.; Swaminathan, P.D.; Joiner, M.L.; Vos, M.A.; Anderson, M.E.; et al. Phosphoproteomics study based on in vivo inhibition reveals sites of calmodulin-dependent protein kinase II regulation in the heart. J. Am. Heart Assoc. 2013, 2, e000318. [Google Scholar] [CrossRef] [Scilit]
- Quan, C.; Du, Q.; Li, M.; Wang, R.; Ouyang, Q.; Su, S.; Zhu, S.; Chen, Q.; Sheng, Y.; Chen, L.; et al. A PKB-SPEG signaling nexus links insulin resistance with diabetic cardiomyopathy by regulating calcium homeostasis. Nat. Commun. 2020, 11, 2186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lange, S.; Perera, S.; Teh, P.; Chen, J. Obscurin and KCTD6 regulate cullin-dependent small ankyrin-1 (sAnk1.5) protein turnover. Mol. Biol. Cell 2012, 23, 2490–2504. [Google Scholar] [CrossRef] [Scilit]
- Gluzman, Y. SV40-transformed simian cells support the replication of early SV40 mutants. Cell 1981, 23, 175–182. [Google Scholar] [CrossRef] [Scilit]
- Yaffe, D.; Saxel, O. Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature 1977, 270, 725–727. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lange, S.; Auerbach, D.; McLoughlin, P.; Perriard, E.; Schafer, B.W.; Perriard, J.C.; Ehler, E. Subcellular targeting of metabolic enzymes to titin in heart muscle may be mediated by DRAL/FHL-2. J. Cell Sci. 2002, 115, 4925–4936. [Google Scholar] [CrossRef] [Scilit]
- Takeda, H.; Kawasaki, A.; Takahashi, M.; Yamada, A.; Koike, T. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of phosphorylated compounds using a novel phosphate capture molecule. Rapid Commun. Mass Spectrom. 2003, 17, 2075–2081. [Google Scholar] [CrossRef] [Scilit]
- Raskin, A.; Lange, S.; Banares, K.; Lyon, R.C.; Zieseniss, A.; Lee, L.K.; Yamazaki, K.G.; Granzier, H.L.; Gregorio, C.C.; McCulloch, A.D.; et al. A novel mechanism involving four-and-a-half LIM domain protein-1 and extracellular signal-regulated kinase-2 regulates titin phosphorylation and mechanics. J. Biol. Chem. 2012, 287, 29273–29284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, Y.; DiMaio, F.; Wang, R.Y.; Kim, D.; Miles, C.; Brunette, T.; Thompson, J.; Baker, D. High-resolution comparative modeling with RosettaCM. Structure 2013, 21, 1735–1742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Irwin, J.J.; Sterling, T.; Mysinger, M.M.; Bolstad, E.S.; Coleman, R.G. ZINC: A free tool to discover chemistry for biology. J. Chem. Inf. Model. 2012, 52, 1757–1768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera--a visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef] [Scilit]
- Xu, D.; Zhang, Y. Ab initio protein structure assembly using continuous structure fragments and optimized knowledge-based force field. Proteins 2012, 80, 1715–1735. [Google Scholar] [CrossRef] [Scilit]
- Xu, D.; Zhang, Y. Toward optimal fragment generations for ab initio protein structure assembly. Proteins 2013, 81, 229–239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drozdetskiy, A.; Cole, C.; Procter, J.; Barton, G.J. JPred4: A protein secondary structure prediction server. Nucleic Acids Res. 2015, 43, W389–W394. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Corpet, F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988, 16, 10881–10890. [Google Scholar] [CrossRef] [Scilit]
- Letunic, I.; Bork, P. 20 years of the SMART protein domain annotation resource. Nucleic Acids Res. 2018, 46, D493–D496. [Google Scholar] [CrossRef] [Scilit]
- Letunic, I.; Khedkar, S.; Bork, P. SMART: Recent updates, new developments and status in 2020. Nucleic Acids Res. 2020. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
- Jones, D.T.; Taylor, W.R.; Thornton, J.M. The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. 1992, 8, 275–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hornbeck, P.V.; Zhang, B.; Murray, B.; Kornhauser, J.M.; Latham, V.; Skrzypek, E. PhosphoSitePlus, 2014: Mutations, PTMs and recalibrations. Nucleic Acids Res. 2015, 43, D512–D520. [Google Scholar] [CrossRef] [Scilit]
- Mertins, P.; Yang, F.; Liu, T.; Mani, D.R.; Petyuk, V.A.; Gillette, M.A.; Clauser, K.R.; Qiao, J.W.; Gritsenko, M.A.; Moore, R.J.; et al. Ischemia in tumors induces early and sustained phosphorylation changes in stress kinase pathways but does not affect global protein levels. Mol. Cell Proteom. 2014, 13, 1690–1704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lundby, A.; Secher, A.; Lage, K.; Nordsborg, N.B.; Dmytriyev, A.; Lundby, C.; Olsen, J.V. Quantitative maps of protein phosphorylation sites across 14 different rat organs and tissues. Nat. Commun. 2012, 3, 876. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lundby, A.; Andersen, M.N.; Steffensen, A.B.; Horn, H.; Kelstrup, C.D.; Francavilla, C.; Jensen, L.J.; Schmitt, N.; Thomsen, M.B.; Olsen, J.V. In vivo phosphoproteomics analysis reveals the cardiac targets of beta-adrenergic receptor signaling. Sci. Signal 2013, 6, rs11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tereshko, V.; Teplova, M.; Brunzelle, J.; Watterson, D.M.; Egli, M. Crystal structures of the catalytic domain of human protein kinase associated with apoptosis and tumor suppression. Nat. Struct. Biol. 2001, 8, 899–907. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Inbal, B.; Shani, G.; Cohen, O.; Kissil, J.L.; Kimchi, A. Death-associated protein kinase-related protein 1, a novel serine/threonine kinase involved in apoptosis. Mol. Cell Biol. 2000, 20, 1044–1054. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobe, B.; Heierhorst, J.; Feil, S.C.; Parker, M.W.; Benian, G.M.; Weiss, K.R.; Kemp, B.E. Giant protein kinases: Domain interactions and structural basis of autoregulation. EMBO J. 1996, 15, 6810–6821. [Google Scholar] [CrossRef] [Scilit]
- Goldberg, J.; Nairn, A.C.; Kuriyan, J. Structural basis for the autoinhibition of calcium/calmodulin-dependent protein kinase I. Cell 1996, 84, 875–887. [Google Scholar] [CrossRef] [Scilit]
- Zheng, J.; Trafny, E.A.; Knighton, D.R.; Xuong, N.H.; Taylor, S.S.; Ten Eyck, L.F.; Sowadski, J.M. 2.2 A refined crystal structure of the catalytic subunit of cAMP-dependent protein kinase complexed with MnATP and a peptide inhibitor. Acta Crystallogr. D Biol. Crystallogr. 1993, 49, 362–365. [Google Scholar] [CrossRef] [Scilit]
- Qadota, H.; Moody, J.C.; Lesanpezeshki, L.; Moncrief, T.; Kitzler, D.; Bhat, P.D.; Vanapalli, S.A.; Oberhauser, A.F.; Benian, G.M. A Region of UNC-89 (Obscurin) Lying between Two Protein Kinase Domains Is a Highly Elastic Spring Required for Proper Sarcomere Organization. J. Mol. Biol. 2020, 432, 4799–4814. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.C.; Yamankurt, G.; Luo, J.; Subramaniam, J.; Hashmi, S.S.; Hu, H.; Cunha, S.R. Identification and characterization of two ankyrin-B isoforms in mammalian heart. Cardiovasc. Res. 2015, 107, 466–477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Randazzo, D.; Giacomello, E.; Lorenzini, S.; Rossi, D.; Pierantozzi, E.; Blaauw, B.; Reggiani, C.; Lange, S.; Peter, A.K.; Chen, J.; et al. Obscurin is required for ankyrinB-dependent dystrophin localization and sarcolemma integrity. J. Cell Biol. 2013, 200, 523–536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bagnato, P.; Barone, V.; Giacomello, E.; Rossi, D.; Sorrentino, V. Binding of an ankyrin-1 isoform to obscurin suggests a molecular link between the sarcoplasmic reticulum and myofibrils in striated muscles. J. Cell Biol. 2003, 160, 245–253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cunha, S.R.; Mohler, P.J. Obscurin targets ankyrin-B and protein phosphatase 2A to the cardiac M-line. J. Biol. Chem. 2008, 283, 31968–31980. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blondelle, J.; Biju, A.; Lange, S. The Role of Cullin-RING Ligases in Striated Muscle Development, Function, and Disease. Int. J. Mol. Sci. 2020, 21, 7936. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanson, D.; Stevens, A.; Murray, P.G.; Black, G.C.; Clayton, P.E. Identifying biological pathways that underlie primordial short stature using network analysis. J. Mol. Endocrinol. 2014, 52, 333–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Name | Sequence |
|---|---|
| mOK1.fwd | CCGCTCGAGCCACCATGGACAAGCTAGATGCCGAAAATCAAG |
| mOK1.rev | CGGGATCCGGTCTGGGGGACCCTGAAGCAGCTC |
| mOK1-ps.rev | CGGGATCCCGGGGCATGCTGGCCTCTGTCTCC |
| mOK1-ΔS7.rev | CGGGATCCCGGGCGCCACTGGCTTCCCCTCG |
| mSK1.fwd | CCGCTCGAGCCACCATGGAAGTCTCCTGCAAGGCGG |
| mSK1.rev | CGGGATCCGGGGGAGCCCGTAGCAGTTCC |
| mSK1-ps.rev | CGGGATCCGGGGTCCCCAGAGCCTCATCTTC |
| mOK1-KA.mut | GGAAACAAGATGTTCTGTGCCGCCGCCTTCATCCCCCTACGGAGTAAAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fleming, J.R.; Rani, A.; Kraft, J.; Zenker, S.; Börgeson, E.; Lange, S. Exploring Obscurin and SPEG Kinase Biology. J. Clin. Med. 2021, 10, 984. https://doi.org/10.3390/jcm10050984
Fleming JR, Rani A, Kraft J, Zenker S, Börgeson E, Lange S. Exploring Obscurin and SPEG Kinase Biology. Journal of Clinical Medicine. 2021; 10(5):984. https://doi.org/10.3390/jcm10050984
Chicago/Turabian StyleFleming, Jennifer R., Alankrita Rani, Jamie Kraft, Sanja Zenker, Emma Börgeson, and Stephan Lange. 2021. "Exploring Obscurin and SPEG Kinase Biology" Journal of Clinical Medicine 10, no. 5: 984. https://doi.org/10.3390/jcm10050984
APA StyleFleming, J. R., Rani, A., Kraft, J., Zenker, S., Börgeson, E., & Lange, S. (2021). Exploring Obscurin and SPEG Kinase Biology. Journal of Clinical Medicine, 10(5), 984. https://doi.org/10.3390/jcm10050984

