Prognostic Role of Immune Checkpoint Regulators in Cholangiocarcinoma: A Pilot Study
Abstract
1. Introduction
2. Materials and Methods
3. Results
3.1. The Expression of Immune Checkpoint Genes in CCA
3.2. Immune Biomarkers Prognosticate Poor Survival in CCA Patients
3.3. Association of Clinicopathological Characteristics with Expression of IDO1, FASLG and NT5E in CCA Patients
3.4. Coordinate Expression of PD-L1 (CD274), PD-1 and CTLA-4 and Immune Checkpoint Genes in CCA Patients
3.5. Anchorage-Independent Three-Dimensional CCA Spheres Express Embryonic Stemness and CSC Markers
3.6. Enhanced Expression of Immune Modulators in CCA Derived Stem-Like Cells
3.7. Induction of Immune Checkpoint Modulator Expression during TGF-β1- and TNF-α-Mediated EMT in Human CCA Cells
3.8. Coordinate Expression of Immune Modulatory Genes, EMT Markers and Stemness Marker in CCA Patients
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rizvi, S.; Borad, M.J.; Patel, T.; Gores, G.J. Cholangiocarcinoma: Molecular pathways and therapeutic opportunities. Semin. Liver Dis. 2014, 34, 456–464. [Google Scholar] [CrossRef]
- Bergquist, A.; von Seth, E. Epidemiology of cholangiocarcinoma. Best Pract. Res. Clin. Gastroenterol. 2015, 29, 221–232. [Google Scholar] [CrossRef] [PubMed]
- Bridgewater, J.; Galle, P.R.; Khan, S.A.; Llovet, J.M.; Park, J.W.; Patel, T.; Pawlik, T.M.; Gores, G.J. Guidelines for the diagnosis and management of intrahepatic cholangiocarcinoma. J. Hepatol. 2014, 60, 1268–1289. [Google Scholar] [CrossRef] [PubMed]
- Rizvi, S.; Gores, G.J. Pathogenesis, diagnosis, and management of cholangiocarcinoma. Gastroenterology 2013, 145, 1215–1229. [Google Scholar] [CrossRef] [PubMed]
- Valle, J.; Wasan, H.; Palmer, D.H.; Cunningham, D.; Anthoney, A.; Maraveyas, A.; Madhusudan, S.; Iveson, T.; Hughes, S.; Pereira, S.P.; et al. Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. N. Engl. J. Med. 2010, 362, 1273–1281. [Google Scholar] [CrossRef] [PubMed]
- Topalian, S.L.; Drake, C.G.; Pardoll, D.M. Immune checkpoint blockade: A common denominator approach to cancer therapy. Cancer Cell 2015, 27, 450–461. [Google Scholar] [CrossRef]
- Mertens, J.C.; Rizvi, S.; Gores, G.J. Targeting cholangiocarcinoma. Biochim. Biophys. Acta Mol. Basis Dis. 2018, 1864, 1454–1460. [Google Scholar] [CrossRef]
- Pardoll, D.M. The blockade of immune checkpoints in cancer immunotherapy. Nat. Rev. Cancer 2012, 12, 252–264. [Google Scholar] [CrossRef]
- Kudo, M. A New Era of Systemic Therapy for Hepatocellular Carcinoma with Regorafenib and Lenvatinib. Liver Cancer 2017, 6, 177–184. [Google Scholar] [CrossRef]
- Shrestha, R.; Prithviraj, P.; Anaka, M.; Bridle, K.R.; Crawford, D.H.; Dhungel, B.; Steel, J.C.; Jayachandran, A. Monitoring Immune Checkpoint Regulators as Predictive Biomarkers in Hepatocellular Carcinoma. Front. Oncol. 2018, 8, 269. [Google Scholar] [CrossRef] [PubMed]
- Eso, Y.; Seno, H. Current status of treatment with immune checkpoint inhibitors for gastrointestinal, hepatobiliary, and pancreatic cancers. Therap. Adv. Gastroenterol. 2020, 13. [Google Scholar] [CrossRef] [PubMed]
- Shrestha, R.; Bridle, K.R.; Crawford, D.H.; Jayachandran, A. Immune checkpoint blockade therapies for HCC: Current status and future implications. Hepatoma Res. 2019, 5, 32. [Google Scholar] [CrossRef]
- Iwai, Y.; Hamanishi, J.; Chamoto, K.; Honjo, T. Cancer immunotherapies targeting the PD-1 signaling pathway. J. Biomed. Sci. 2017, 24, 26. [Google Scholar] [CrossRef] [PubMed]
- Ueno, M.; Ikeda, M.; Morizane, C.; Kobayashi, S.; Ohno, I.; Kondo, S.; Okano, N.; Kimura, K.; Asada, S.; Namba, Y.; et al. Nivolumab alone or in combination with cisplatin plus gemcitabine in Japanese patients with unresectable or recurrent biliary tract cancer: A non-randomised, multicentre, open-label, phase 1 study. Lancet Gastroenterol. Hepatol. 2019, 4, 611–621. [Google Scholar] [CrossRef]
- Ioka, T.; Ueno, M.; Oh, D.-Y.; Fujiwara, Y.; Chen, J.-S.; Doki, Y.; Mizuno, N.; Park, K.; Asagi, A.; Hayama, M.; et al. Evaluation of safety and tolerability of durvalumab (D) with or without tremelimumab (T) in patients (pts) with biliary tract cancer (BTC). J. Clin. Oncol. 2019, 37, 387–387. [Google Scholar] [CrossRef]
- Gibney, G.T.; Weiner, L.M.; Atkins, M.B. Predictive biomarkers for checkpoint inhibitor-based immunotherapy. Lancet Oncol. 2016, 17, e542–e551. [Google Scholar] [CrossRef]
- Lou, Y.; Diao, L.; Cuentas, E.R.; Denning, W.L.; Chen, L.; Fan, Y.H.; Byers, L.A.; Wang, J.; Papadimitrakopoulou, V.A.; Behrens, C.; et al. Epithelial-Mesenchymal Transition Is Associated with a Distinct Tumor Microenvironment Including Elevation of Inflammatory Signals and Multiple Immune Checkpoints in Lung Adenocarcinoma. Clin. Cancer Res. 2016, 22, 3630–3642. [Google Scholar] [CrossRef]
- Raggi, C.; Invernizzi, P.; Andersen, J.B. Impact of microenvironment and stem-like plasticity in cholangiocarcinoma: Molecular networks and biological concepts. J. Hepatol. 2015, 62, 198–207. [Google Scholar] [CrossRef]
- Kalluri, R.; Weinberg, R.A. The basics of epithelial-mesenchymal transition. J. Clin. Investig. 2009, 119, 1420–1428. [Google Scholar] [CrossRef] [PubMed]
- Kudo-Saito, C.; Shirako, H.; Takeuchi, T.; Kawakami, Y. Cancer metastasis is accelerated through immunosuppression during Snail-induced EMT of cancer cells. Cancer Cell 2009, 15, 195–206. [Google Scholar] [CrossRef]
- Mak, M.P.; Tong, P.; Diao, L.; Cardnell, R.J.; Gibbons, D.L.; William, W.N.; Skoulidis, F.; Parra, E.R.; Rodriguez-Canales, J.; Wistuba, I.I.; et al. A Patient-Derived, Pan-Cancer EMT Signature Identifies Global Molecular Alterations and Immune Target Enrichment Following Epithelial-to-Mesenchymal Transition. Clin. Cancer Res. 2016, 22, 609–620. [Google Scholar] [CrossRef]
- Ueno, T.; Tsuchikawa, T.; Hatanaka, K.C.; Hatanaka, Y.; Mitsuhashi, T.; Nakanishi, Y.; Noji, T.; Nakamura, T.; Okamura, K.; Matsuno, Y.; et al. Prognostic impact of programmed cell death ligand 1 (PD-L1) expression and its association with epithelial-mesenchymal transition in extrahepatic cholangiocarcinoma. Oncotarget 2018, 9, 20034–20047. [Google Scholar] [CrossRef] [PubMed]
- Jayachandran, A.; Dhungel, B.; Steel, J.C. Epithelial-to-mesenchymal plasticity of cancer stem cells: Therapeutic targets in hepatocellular carcinoma. J. Hematol. Oncol. 2016, 9, 74. [Google Scholar] [CrossRef] [PubMed]
- Tamai, K.; Nakamura, M.; Mizuma, M.; Mochizuki, M.; Yokoyama, M.; Endo, H.; Yamaguchi, K.; Nakagawa, T.; Shiina, M.; Unno, M.; et al. Suppressive expression of CD274 increases tumorigenesis and cancer stem cell phenotypes in cholangiocarcinoma. Cancer Sci. 2014, 105, 667–674. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Chen, M.; Wu, P.; Chen, C.; Xu, Z.P.; Gu, W. Increased PD-L1 expression in breast and colon cancer stem cells. Clin. Exp. Pharmacol. Physiol. 2017, 44, 602–604. [Google Scholar] [CrossRef] [PubMed]
- Aguirre-Gamboa, R.; Gomez-Rueda, H.; Martínez-Ledesma, E.; Martínez-Torteya, A.; Chacolla-Huaringa, R.; Rodriguez-Barrientos, A.; Tamez-Peña, J.G.; Treviño, V. SurvExpress: An online biomarker validation tool and database for cancer gene expression data using survival analysis. PLoS ONE 2013, 8, e74250. [Google Scholar] [CrossRef]
- Gao, J.; Aksoy, B.A.; Dogrusoz, U.; Dresdner, G.; Gross, B.; Sumer, S.O.; Sun, Y.; Jacobsen, A.; Sinha, R.; Larsson, E.; et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci. Signal 2013, 6, pl1. [Google Scholar] [CrossRef]
- Jayachandran, A.; Shrestha, R.; Dhungel, B.; Huang, I.T.; Vasconcelos, M.Y.K.; Morrison, B.J.; Ramlogan-Steel, C.A.; Steel, J.C. Murine hepatocellular carcinoma derived stem cells reveal epithelial-to-mesenchymal plasticity. World J. Stem Cells 2017, 9, 159–168. [Google Scholar] [CrossRef] [PubMed]
- Shrestha, R.; Bridle, K.R.; Crawford, D.H.; Jayachandran, A. TNF-α-mediated epithelial-to-mesenchymal transition regulates expression of immune checkpoint molecules in hepatocellular carcinoma. Mol. Med. Rep. 2020, 21, 1849–1860. [Google Scholar] [CrossRef] [PubMed]
- Awan, F.M.; Naz, A.; Obaid, A.; Ali, A.; Ahmad, J.; Anjum, S.; Janjua, H.A. Identification of Circulating Biomarker Candidates for Hepatocellular Carcinoma (HCC): An Integrated Prioritization Approach. PLoS ONE 2015, 10, e0138913. [Google Scholar] [CrossRef]
- Cardinale, V.; Renzi, A.; Carpino, G.; Torrice, A.; Bragazzi, M.C.; Giuliante, F.; DeRose, A.M.; Fraveto, A.; Onori, P.; Napoletano, C.; et al. Profiles of cancer stem cell subpopulations in cholangiocarcinomas. Am. J. Pathol. 2015, 185, 1724–1739. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.J.; Chu, P.Y. Role of Cancer Stem Cells in Cholangiocarcinoma and Therapeutic Implications. Int. J. Mol. Sci. 2019, 20. [Google Scholar] [CrossRef]
- Celià-Terrassa, T.; Jolly, M.K. Cancer Stem Cells and Epithelial-to-Mesenchymal Transition in Cancer Metastasis. Cold Spring Harb. Perspect. Med. 2020, 10. [Google Scholar] [CrossRef] [PubMed]
- Cheong, J.E.; Sun, L. Targeting the IDO1/TDO2-KYN-AhR Pathway for Cancer Immunotherapy—Challenges and Opportunities. Trends Pharmacol. Sci. 2018, 39, 307–325. [Google Scholar] [CrossRef] [PubMed]
- Ferdinande, L.; Decaestecker, C.; Verset, L.; Mathieu, A.; Moles Lopez, X.; Negulescu, A.M.; Van Maerken, T.; Salmon, I.; Cuvelier, C.A.; Demetter, P. Clinicopathological significance of indoleamine 2,3-dioxygenase 1 expression in colorectal cancer. Br. J. Cancer 2012, 106, 141–147. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Han, X.; Lyu, N.; Xie, Q.; Deng, H.; Mu, L.; Pan, T.; Huang, X.; Wang, X.; Shi, Y.; et al. Mechanism and prognostic value of indoleamine 2,3-dioxygenase 1 expressed in hepatocellular carcinoma. Cancer Sci. 2018, 109, 3726–3736. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Liu, X.; Wang, Y.; Zhou, K.; Wu, J.; Chen, J.C.; Chen, C.; Chen, L.; Zheng, J. Identification of immune subtypes and prognosis of hepatocellular carcinoma based on immune checkpoint gene expression profile. Biomed. Pharmacother. 2020, 126, 109903. [Google Scholar] [CrossRef] [PubMed]
- Brown, Z.J.; Yu, S.J.; Heinrich, B.; Ma, C.; Fu, Q.; Sandhu, M.; Agdashian, D.; Zhang, Q.; Korangy, F.; Greten, T.F. Indoleamine 2,3-dioxygenase provides adaptive resistance to immune checkpoint inhibitors in hepatocellular carcinoma. Cancer Immunol. Immunother. 2018, 67, 1305–1315. [Google Scholar] [CrossRef]
- Li, Z.Y.; Zou, S.Q. Fas counterattack in cholangiocarcinoma: A mechanism for immune evasion in human hilar cholangiocarcinomas. World J. Gastroenterol. 2001, 7, 860–863. [Google Scholar] [CrossRef] [PubMed]
- Hay, C.M.; Sult, E.; Huang, Q.; Mulgrew, K.; Fuhrmann, S.R.; McGlinchey, K.A.; Hammond, S.A.; Rothstein, R.; Rios-Doria, J.; Poon, E.; et al. Targeting CD73 in the tumor microenvironment with MEDI9447. Oncoimmunology 2016, 5, e1208875. [Google Scholar] [CrossRef]
- Loi, S.; Pommey, S.; Haibe-Kains, B.; Beavis, P.A.; Darcy, P.K.; Smyth, M.J.; Stagg, J. CD73 promotes anthracycline resistance and poor prognosis in triple negative breast cancer. Proc. Natl. Acad. Sci. USA 2013, 110, 11091–11096. [Google Scholar] [CrossRef]
- Ghidini, M.; Pizzo, C.; Botticelli, A.; Hahne, J.C.; Passalacqua, R.; Tomasello, G.; Petrelli, F. Biliary tract cancer: Current challenges and future prospects. Cancer Manag. Res. 2019, 11, 379–388. [Google Scholar] [CrossRef] [PubMed]
- Anderson, A.C. Tim-3: An emerging target in the cancer immunotherapy landscape. Cancer Immunol. Res. 2014, 2, 393–398. [Google Scholar] [CrossRef]
- Ngiow, S.F.; von Scheidt, B.; Akiba, H.; Yagita, H.; Teng, M.W.; Smyth, M.J. Anti-TIM3 antibody promotes T cell IFN-γ-mediated antitumor immunity and suppresses established tumors. Cancer Res. 2011, 71, 3540–3551. [Google Scholar] [CrossRef]
- Xie, N.; Cai, J.B.; Zhang, L.; Zhang, P.F.; Shen, Y.H.; Yang, X.; Lu, J.C.; Gao, D.M.; Kang, Q.; Liu, L.X.; et al. Upregulation of B7-H4 promotes tumor progression of intrahepatic cholangiocarcinoma. Cell Death Dis. 2017, 8, 3205. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Guo, F.; Li, Z.; Jiang, P.; Deng, X.; Tian, F.; Li, X.; Wang, S. Aberrant expression of B7-H4 correlates with poor prognosis and suppresses tumor-infiltration of CD8+ T lymphocytes in human cholangiocarcinoma. Oncol. Rep. 2016, 36, 419–427. [Google Scholar] [CrossRef]
- Kobayashi, K.; Morishita, A.; Iwama, H.; Fujita, K.; Okura, R.; Fujihara, S.; Yamashita, T.; Fujimori, T.; Kato, K.; Kamada, H.; et al. Galectin-9 suppresses cholangiocarcinoma cell proliferation by inducing apoptosis but not cell cycle arrest. Oncol. Rep. 2015, 34, 1761–1770. [Google Scholar] [CrossRef] [PubMed]
- Blessin, N.C.; Simon, R.; Kluth, M.; Fischer, K.; Hube-Magg, C.; Li, W.; Makrypidi-Fraune, G.; Wellge, B.; Mandelkow, T.; Debatin, N.F.; et al. Patterns of TIGIT Expression in Lymphatic Tissue, Inflammation, and Cancer. Dis. Markers 2019, 5160565. [Google Scholar] [CrossRef] [PubMed]
- Chauvin, J.M.; Pagliano, O.; Fourcade, J.; Sun, Z.; Wang, H.; Sander, C.; Kirkwood, J.M.; Chen, T.H.; Maurer, M.; Korman, A.J.; et al. TIGIT and PD-1 impair tumor antigen-specific CD8⁺ T cells in melanoma patients. J. Clin. Investig. 2015, 125, 2046–2058. [Google Scholar] [CrossRef] [PubMed]
- Sato, Y.; Tanaka, S.; Kinoshita, M.; Takemura, S.; Shinkawa, H.; Kokudo, T.; Hasegawa, K.; Tanaka, H.; Yoshimoto, H.; Mori, A.; et al. Immunosuppressive tumor microenvironment in occupational cholangiocarcinoma: Supportive evidence for the efficacy of immune checkpoint inhibitor therapy. J. Hepato-Biliary-Pancreat Sci. 2020, 27, 860–869. [Google Scholar] [CrossRef] [PubMed]
- Xu, G.; Sun, L.; Li, Y.; Xie, F.; Zhou, X.; Yang, H.; Du, S.; Xu, H.; Mao, Y. The Clinicopathological and Prognostic Value of PD-L1 Expression in Cholangiocarcinoma: A Meta-Analysis. Front. Oncol. 2019, 9, 897. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Wang, X.Y.; Zhang, Y.; Xu, D.; Dong, J.; Zhang, Z.; Yi, C.H.; Jia, H.L.; Yang, X. Programmed death ligand 1 expression in human intrahepatic cholangiocarcinoma and its association with prognosis and CD8. Cancer Manag. Res. 2018, 10, 4113–4123. [Google Scholar] [CrossRef] [PubMed]
- Cai, X.; Li, J.; Yuan, X.; Xiao, J.; Dooley, S.; Wan, X.; Weng, H.; Lu, L. CD133 expression in cancer cells predicts poor prognosis of non-mucin producing intrahepatic cholangiocarcinoma. J. Transl. Med. 2018, 16, 50. [Google Scholar] [CrossRef] [PubMed]
- Cerami, E.; Gao, J.; Dogrusoz, U.; Gross, B.E.; Sumer, S.O.; Aksoy, B.A.; Jacobsen, A.; Byrne, C.J.; Heuer, M.L.; Larsson, E.; et al. The cBio Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer Genomics Data. Cancer Discov. 2012, 2, 401–404. [Google Scholar] [CrossRef] [PubMed]









| Primers | Forward Sequence (5′–3′) | Reverse Sequence (5′–3′) |
|---|---|---|
| ActB | CCAACCGCGAGAAGATGA | CCAGAGGCGTACAGGGATAG |
| CD13 | CAGTGACACGACGATTCTCC | CCTGTTTCCTCGTTGTCCTT |
| CD24 | CACGCAGATTTATTCCAGTGAAAC | GACCACGAAGAGACTGGCTGTT |
| CD44 | CACGTGGAATACACCTGCAA | GACAAGTTTTGGTGGCACG |
| CD90 | AGGACGAGGGCACCTACAC | GCCCTCACACTTGACCAGTT |
| CD133 | GCTTCAGGAGTTTCATGTTGG | GGGGAATGCCTACATCTGG |
| ALDH1A1 | CGGGAAAAGCAATCTGAAGAGGG | GATGCGGCTATACAACACTGGC |
| EpCAM | CCCATCTCCTTTATCTCAGCC | CTGAATTCTCAATGCAGGGTC |
| OCT4 | TTGTGCCAGGGTTTTTGG | ACTTCACCTTCCCTCCAACC |
| SOX2 | ATGGGTTCGGTGGTCAAGT | GGAGGAAGAGGTAACCACAGG |
| NANOG | CTCCAACATCCTGAACCTCAGC | CGTCACACCATTGCTATTCTTCG |
| KLF4 | CATCTCAAGGCACACCTGCGAA | TCGGTCGCATTTTTGGCACTGG |
| ZO1 | GTCCAGAATCTCGGAAAAGTGCC | CTTTCAGCGCACCATACCAACC |
| KRT19 | GGTCAGTGTGGAGGTGGATT | TCAGTAACTCGGACCTGCT |
| E-Cad | AGGCCAAGCAGCAGTACATT | ATTCACATCCAGCACATCCA |
| N-cad | TCCTTGCTTCTGACAATGGA | TTCGCAAGTCTCTGCCTCTT |
| Occludin | TAGTCAGATGGGGGTGAAGG | CATTTATGATGAGCAGCCCC |
| ZEB1 | GGCATACACCTACTCAACTACGG | TGGGCGGTGTAGAATCAGAGTC |
| Slug | TGGTTGCTTCAAGGACACAT | GTTGCAGTGAGGGCAAGAA |
| Fibronectin | CAGTGGGAGACCTCGAGAAG | TCCCTCGGAACATCAGAAAC |
| LGALS9 | ACACCCAGATCGACAACTCCTG | CAAACAGGTGCTGACCATCCAC |
| TNFRSF14 | TTCTCTCAGGGAGCCTCGTCAT | CTCACCTTCTGCCTCCTGTCTT |
| FASLG | CCTTGGTAGGATTGGGCCTG | TCTGGCTGGTAGACTCTCGG |
| TGF-β1 | TACCTGAACCCGTGTTGCTCTC | GTTGCTGAGGTATCGCCAGGAA |
| TNF-α | CCCAGGGACCTCTCTCTAATC | TCTCAGCTCCACGCCATT |
| PD-L1 | GCTGCACTAATTGTCTATTGGGA | AATTCGCTTGTAGTCGGCACC |
| NT5E | TTGGAAATTTGGCCTCTTTG | ACTTCATGAACGCCCTGC |
| VTCN1 | TCTGGGCATCCCAAGTTGAC | TCCGCCTTTTGATCTCCGATT |
| Antibodies | Cat. No. | Manufacturer | Antibody Category | Dilution |
|---|---|---|---|---|
| NT5E | ab175396 | Abcam | Primary | 1:6000 |
| LGALS9 | ab227046 | Abcam | Primary | 1:1000 |
| β-Actin | 4967s | Cell Signaling | Primary | 1:4000 |
| Goat anti-mouse HRP | 62-6520 | Invitrogen | Secondary | 1:50,000 |
| Goat anti-rabbit HRP | 65-6120 | Invitrogen | Secondary | 1:50,000 |
| CCA Patient ID | Diagnosed Age | Sex | Ablation Embolization Tx Adjuvant | Surgical Margin Resection Status | Adjuvant Postoperative Pharmaceutical Therapy Administered Indicator | American Joint Committee on Cancer Tumor Stage Code | American Joint Committee on Cancer Metastasis Stage Code |
|---|---|---|---|---|---|---|---|
| TCGA-3X-AAV9 | 72 | Male | NO | R0 | YES | T1 | M0 |
| TCGA-5A-A8ZF | NA | NA | NA | NA | NA | NA | NA |
| TCGA-5A-A8ZG | NA | NA | NA | NA | NA | NA | NA |
| TCGA-W7-A93N | NA | NA | NA | NA | NA | NA | NA |
| TCGA-W7-A930 | NA | NA | NA | NA | NA | NA | NA |
| TCGA-W7-A93P | NA | NA | NA | NA | NA | NA | NA |
| TCGA-ZK-AAYZ | NA | NA | NA | NA | NA | NA | NA |
| TCGA-3X-AAVA | 50 | Male | NO | R0 | YES | T1 | M0 |
| TCGA-3X-AAVB | 70 | Female | NO | R0 | NO | T2b | M1 |
| TCGA-3X-AAVC | 72 | Female | NA | R0 | NA | T3 | M0 |
| TCGA-3X-AAVE | 60 | Female | NO | R0 | NO | T1 | M0 |
| TCGA-4G-AAZF | 74 | Male | NO | R0 | NO | T2 | MX |
| TCGA-4G-AAZG | 75 | Female | NO | R0 | NO | T3 | MX |
| TCGA-4G-AAZ0 | 71 | Female | NO | R1 | YES | T2a | M0 |
| TCGA-4G-AAZR | 74 | Male | NO | R1 | NO | T2a | MX |
| TCGA-4G-AAZT | 62 | Male | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA2G | 62 | Female | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA2H | 70 | Female | NO | R0 | YES | T3 | M0 |
| TCGA-W5-AA2I | 66 | Male | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA2J | 66 | Female | NO | R0 | NO | T4 | M0 |
| TCGA-W5-AA2K | 75 | Female | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA2M | 49 | Male | NO | R0 | NO | T3 | M1 |
| TCGA-W5-AA2O | 57 | Male | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA2Q | 68 | Male | NO | R0 | NO | T2b | M0 |
| TCGA-W5-AA2R | 77 | Female | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA2T | 64 | Female | NO | R0 | YES | T2 | M0 |
| TCGA-W5-AA2U | 78 | Female | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA2W | 31 | Female | NO | R0 | NO | T2a | M0 |
| TCGA-W5-AA2X | 67 | Male | NO | RX | NO | T2b | M1 |
| TCGA-W5-AA2Z | 29 | Female | NO | R1 | YES | T2 | M0 |
| TCGA-W5-AA30 | 82 | Male | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA31 | 71 | Male | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA33 | 60 | Male | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA34 | 75 | Female | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA36 | 51 | Female | NO | R0 | YES | T3 | M1 |
| TCGA-W5-AA38 | 55 | Female | NO | R0 | NO | T1 | M0 |
| TCGA-W5-AA39 | 81 | Male | NO | RX | NO | T2 | M0 |
| TCGA-W6-AA0S | 46 | Female | NO | R0 | YES | T1 | Mx |
| TCGA-W6-AA0T | 62 | Female | NO | R0 | YES | T3 | M0 |
| TCGA-WD-A7RX | 71 | Female | NO | RX | NO | T2b | MX |
| TCGA-YR-A95A | 52 | Male | NO | R1 | NO | T2 | M1 |
| TCGA-ZD-A8I3 | 73 | Female | NA | R0 | NA | T2 | MO |
| TCGA-ZH-A8Y1 | 74 | Female | NO | R1 | NO | T3 | MO |
| TCGA-ZH-A8Y2 | 59 | Female | NO | R0 | NO | T1 | MO |
| TCGA-ZH-A8Y3 | 61 | Female | NO | R1 | YES | T2a | MO |
| TCGA-ZH-A8Y4 | 58 | Male | NO | R1 | YES | T1 | MO |
| TCGA-ZH-A8Y5 | 69 | Male | NO | R0 | YES | T3 | M1 |
| TCGA-ZH-A8Y6 | 41 | Female | NA | R0 | NA | T1 | MO |
| TCGA-ZH-A8Y7 | 59 | Male | NO | R1 | NO | T3 | M1 |
| TCGA-ZH-A8Y8 | 73 | Male | NO | R0 | NO | T1 | MO |
| TCGA-ZU-A8S4 | 52 | Male | NO | R0 | YES | T1 | MX |
| Immune Modulatory Gene | Risk Groups Hazard Ratio | Confidence Interval | Log-Rank Equal Curves (p-Value) |
|---|---|---|---|
| FASLG | 1.27 | 0.17–9.69 | 0.817 |
| LAG3 | 0.84 | 0.32–2.18 | 0.720 |
| HAVCR2 | 1.87 | 0.71–14.96 | 0.198 |
| VSIR | 1.69 | 0.61–4.68 | 0.309 |
| VTCN1 | 0.87 | 0.33–2.27 | 0.776 |
| TNFRSF9 | 81853258 | 0–∞ | 0.132 |
| TNFRSF14 | 1.39 | 0.53–3.66 | 0.503 |
| TIGIT | 1.37 | 0.5–3.71 | 0.536 |
| CD276 | 0.67 | 0.26–1.75 | 0.414 |
| CD27 | 1.15 | 0.42–3.11 | 0.785 |
| PDCD1LG2 | 1.53 | 0.55–4.21 | 0.409 |
| NT5E | 0.56 | 0.21–1.5 | 0.247 |
| CD80 | 3.41 | 0.45–25.04 | 0.208 |
| TNFRSF18 | 1.92 | 0.73–5.08 | 0.178 |
| BTLA | 1.36 | 0.31–5.97 | 0.686 |
| CD28 | 2.3 | 0.8–6.64 | 0.112 |
| Immune Modulatory Gene | Overall Survival Log-Rank Test (p-Value) | Progression-Free Survival Log-Rank Test (p-Value) |
|---|---|---|
| FASLG | 1.370 × 10−3 | 3.843 × 10−3 |
| LGALS9 | 0.286 | 0.759 |
| LAG3 | 0.464 | 0.898 |
| HAVCR2 | 0.095 | 0.225 |
| VSIR | 0.515 | 0.290 |
| VTCN1 | 0.361 | 0.900 |
| IDO1 | 0.450 | 0.242 |
| TNFRSF9 | NA | NA |
| TNFRSF14 | NA | NA |
| TIGIT | 0.515 | 0.290 |
| CD276 | 0.514 | 0.290 |
| CD27 | 0.515 | 0.290 |
| CD274 | 0.054 | 0.109 |
| PDCD1LG2 | 0.464 | 0.898 |
| NT5E | 2.826 × 10−3 | 4.072 × 10−3 |
| CD80 | 0.515 | 0.290 |
| TNFRSF18 | NA | NA |
| BTLA | 0.515 | 0.290 |
| CD28 | 0.515 | 0.290 |
| Clinical Attribute | p = 1.874 × 10−3 | p = 0.937 | p = 0.969 | |||
|---|---|---|---|---|---|---|
| Neoplasm disease stage American Joint Committee on Cancer Code | Altered IDO1 | Unaltered | Altered FASLG | Unaltered | Altered NT5E | Unaltered |
| Stage I | 0% | 55.88% | 20% | 58.06% | 100% | 51.43% |
| Stage II | 50% | 23.53% | 60% | 19.35% | 0% | 25.71% |
| Stage III | 50% | 0% | 0% | 3.23% | 0% | 2.86% |
| Stage IV | 0% | 5.88% | 0% | 6.45% | 0% | 5.71% |
| Stage IVA | 0% | 5.88% | 20% | 3.23% | 0% | 5.71% |
| Stage IVB | 0% | 8.82% | 0% | 9.68% | 0% | 8.57% |
| p = 0.739 | p = 0.018 | p = 3.492 × 10−3 | ||||
| Metastasis stage American Joint Committee on Cancer Code | Altered IDO1 | Unaltered | Altered FASLG | Unaltered | Altered NT5E | Unaltered |
| M0 | 100% | 76.47% | 60% | 80.65% | 0% | 80% |
| M1 | 0% | 14.71% | 0% | 16.13% | 0% | 14.29% |
| MX (No information available) | 0% | 8.82% | 40% | 3.23% | 100% | 5.71% |
| p = 0.665 | p = 0.041 | p = 0.041 | ||||
| Neoplasm disease lymph node stage American Joint Committee on Cancer Code | Altered IDO1 | Unaltered | Altered FASLG | Unaltered | Altered NT5E | Unaltered |
| N0 | 0% | 70.59% | 40% | 77.42% | 0% | 74.29% |
| N1 | 74.29% | 14.71% | 20% | 12.9% | 0% | 14.29% |
| NX (No information available) | 14.29% | 14.71% | 40% | 9.68% | 100% | 11.43% |
| p = 0.301 | p = 0.937 | p = 0.922 | ||||
| Tumor stage American Joint Committee on Cancer Code | Altered IDO1 | Unaltered | Altered FASLG | Unaltered | Altered NT5E | Unaltered |
| T1 | 0% | 55.88% | 20% | 58.06% | 100% | 51.43% |
| T2 | 50% | 14.71% | 0% | 19.35% | 0% | 17.14% |
| T2a | 0% | 5.88% | 40% | 0% | 0% | 5.71% |
| T2b | 0% | 11.76% | 40% | 6.45% | 0% | 11.43% |
| T3 | 50% | 11.76% | 0% | 16.13% | 0% | 14.29% |
| p = 0.049 | p = 1.046 × 10−3 | p = 3.565 × 10−3 | ||||
| Neoadjuvant therapy type administered prior to resection | Altered IDO1 | Unaltered | Altered FASLG | Unaltered | Altered NT5E | Unaltered |
| YES | 0% | 2.94% | 0% | 2.86% | 0% | 2.86% |
| NO | 100% | 97.06% | 100% | 97.14% | 100% | 97.14% |
| p = 0.012 | p = 1.00 | p = 0.998 | ||||
| History hepatocellular risk factor | Altered IDO1 | Unaltered | Altered FASLG | Unaltered | Altered NT5E | Unaltered |
| Hepatitis B and smoking | 50% | 0% | 60% | 6.67% | 0% | 26.47% |
| No history of primary risk factors | 50% | 58.82% | 20% | 63.33% | 100% | 55.88% |
| Other risk factors (cirrhosis/diabetes mellitus/NAFLD/ smoking/ulcerative colitis) | 0% | 41.1% | 20% | 30% | 0% | 17.65% |
| p = 0.569 | p = 0.910 | p = 0.930 | ||||
| Gender | Altered IDO1 | Unaltered | Altered FASLG | Unaltered | AlteredNT5E | Unaltered |
| Male | 50% | 44.12% | 40% | 45.16% | 100% | 44.12% |
| Female | 50% | 55.88% | 60% | 54.84% | 0% | 55.88% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, L.; Prithviraj, P.; Shrestha, R.; Sharma, R.; Anaka, M.; Bridle, K.R.; Kannourakis, G.; Crawford, D.H.G.; Jayachandran, A. Prognostic Role of Immune Checkpoint Regulators in Cholangiocarcinoma: A Pilot Study. J. Clin. Med. 2021, 10, 2191. https://doi.org/10.3390/jcm10102191
Cao L, Prithviraj P, Shrestha R, Sharma R, Anaka M, Bridle KR, Kannourakis G, Crawford DHG, Jayachandran A. Prognostic Role of Immune Checkpoint Regulators in Cholangiocarcinoma: A Pilot Study. Journal of Clinical Medicine. 2021; 10(10):2191. https://doi.org/10.3390/jcm10102191
Chicago/Turabian StyleCao, Lu, Prashanth Prithviraj, Ritu Shrestha, Revati Sharma, Matthew Anaka, Kim R. Bridle, George Kannourakis, Darrell H.G. Crawford, and Aparna Jayachandran. 2021. "Prognostic Role of Immune Checkpoint Regulators in Cholangiocarcinoma: A Pilot Study" Journal of Clinical Medicine 10, no. 10: 2191. https://doi.org/10.3390/jcm10102191
APA StyleCao, L., Prithviraj, P., Shrestha, R., Sharma, R., Anaka, M., Bridle, K. R., Kannourakis, G., Crawford, D. H. G., & Jayachandran, A. (2021). Prognostic Role of Immune Checkpoint Regulators in Cholangiocarcinoma: A Pilot Study. Journal of Clinical Medicine, 10(10), 2191. https://doi.org/10.3390/jcm10102191

