Generation and Characterization of ORF55/ORF57-Deleted Recombinant Cyprinid herpesvirus 2 Mutants with Chimeric Capsid Protein Gene of Grouper Nervous Necrosis Virus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals, Cells and Virus
2.2. Construction of Transfer Vectors and Virus Recombinants
2.3. DNA Extraction and Sequence Analysis
2.4. Western Blotting Analysis
2.5. Indirect Immunofluorescence Analysis
2.6. Virus Purification and Transmission Electron Microscope (TEM)
2.7. TCID50 Assay
2.8. In Vivo Virulence Assay
2.9. Absolute Quantitative PCR (qPCR)
2.10. NNV-Specific IgM Determined via ELISA
2.11. Statistics Analysis
3. Results
3.1. Construction of the CyHV-2 Recombinant Mutants
3.2. Characteristics of the CyHV-2 Recombinant Mutants
3.3. The Expression of the NNV-CP Fusion Protein
3.4. Virulence Attenuation in the CyHV-2 Recombinant Mutants
3.5. Infected GiCF Cell Lysates of CyHV-2-Δ57-CP Induced Antibody Response in Grouper
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Thangaraj, R.S.; Nithianantham, S.R.; Dharmaratnam, A.; Kumar, R.; Pradhan, P.K.; Thangalazhy Gopakumar, S.; Sood, N. Cyprinid herpesvirus-2 (CyHV-2): A comprehensive review. Rev. Fish. Sci. 2020, 13, 796–821. [Google Scholar] [CrossRef]
- Dadar, M.; Dhama, K.; Vakharia, V.N.; Hoseinifar, S.H.; Karthik, K.; Tiwari, R.; Khandia, R.; Munjal, A.; Salgado-Miranda, C.; Joshi, S.K. Advances in Aquaculture Vaccines Against Fish Pathogens: Global Status and Current Trends. Rev. Fish. Sci. 2016, 25, 184–217. [Google Scholar] [CrossRef]
- Saito, H.; Okamura, T.; Shibata, T.; Kato, G.; Sano, M. Development of a live attenuated vaccine candidate against herpesviral hematopoietic necrosis of goldfish. Aquaculture 2022, 552, 737974. [Google Scholar] [CrossRef]
- Sun, Y.; Xu, C.; Wang, H.; Qiao, G.; Wang, Z.; Li, Z.; Li, Q.; Wei, C. An attenuated strain of cyprinid herpesvirus 2 as a vaccine candidate against herpesviral hematopoietic necrosis disease in gibel carp, Carassius auratus gibelio. Fish Shellfish Immunol. 2023, 138, 108826. [Google Scholar] [CrossRef] [PubMed]
- Ototake, M.; Ito, T. Vaccination against cyprinid herpesvirus 2 (CyHV-2) infection in goldfish Carassius auratus. Bull. Eur. Assoc. Fish Pathol. 2013, 33, 158–164. [Google Scholar]
- Zhang, L.L.; Ma, J.; Fan, Y.D.; Zhou, Y.; Xu, J.; Liu, W.Z.; Gu, Z.M.; Zeng, L.B. Immune response and protection in gibel carp, Carassius gibelio, after vaccination with β-propiolactone inactivated cyprinid herpesvirus 2. Fish Shellfish Immunol. 2016, 49, 344–350. [Google Scholar] [CrossRef] [PubMed]
- Yan, Y.; Huo, X.; Ai, T.; Su, J. β-glucan and anisodamine can enhance the immersion immune efficacy of inactivated cyprinid herpesvirus 2 vaccine in Carassius auratus gibelio. Fish Shellfish Immunol. 2020, 98, 285–295. [Google Scholar] [CrossRef]
- Dharmaratnam, A.; Sudhagar, A.; Das, S.; Nair, R.R.; Nithianantham, S.R.; Preena, P.G.; Lekshmi, N.; Swaminathan, T.R. Immune gene expression and protective effects in goldfish (Carassius auratus L.) immunized with formalin-inactivated cyprinid herpesvirus-2 (CyHV-2) vaccine. Microb. Pathog. 2022, 164, 105452. [Google Scholar] [CrossRef] [PubMed]
- Huo, X.; Fan, C.; Ai, T.; Su, J. The Combination of Molecular Adjuvant CCL35.2 and DNA Vaccine Significantly Enhances the Immune Protection of Carassius auratus gibelio against CyHV-2 Infection. Vaccines 2020, 8, 567. [Google Scholar] [CrossRef]
- Yuan, X.; Shen, J.; Pan, X.; Yao, J.; Lyu, S.; Liu, L.; Zhang, H. Screening for protective antigens of Cyprinid herpesvirus 2 and construction of DNA vaccines. J. Virol. Methods 2020, 280, 113877. [Google Scholar] [CrossRef]
- Zhou, Y.; Jiang, N.; Ma, J.; Fan, Y.D.; Zhang, L.; Xu, J.; Zeng, L.B. Protective immunity in gibel carp, Carassius gibelio of the truncated proteins of cyprinid herpesvirus 2 expressed in Pichia pastoris. Fish Shellfish Immunol. 2015, 47, 1024–1031. [Google Scholar] [CrossRef]
- Yan, N.; Xu, K.; Li, X.; Liu, Y.; Bai, Y.; Zhang, X.; Han, B.; Chen, Z.; Zhang, Z. Recombinant Saccharomyces cerevisiae serves as novel carrier for oral DNA vaccines in Carassius auratus. Fish Shellfish Immunol. 2015, 47, 758–765. [Google Scholar] [CrossRef] [PubMed]
- Cao, Z.W.; Liu, S.J.; Nan, H.; Zhao, K.X.; Xu, X.D.; Wang, G.X.; Ji, H.; Chen, H.Y. Immersion immunization with recombinant baculoviruses displaying cyprinid herpesvirus 2 membrane proteins induced protective immunity in gibel carp. Fish Shellfish Immunol. 2019, 93, 879–887. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Yuan, R.; Zhang, M.T.; Zhang, T.T.; Gu, Y.C.; Zhou, Y.; Dai, Y.; Fang, P.; Feng, Y.; Hu, X.; et al. Recombinant baculovirus BacCarassius-D4ORFs has potential as a live vector vaccine against CyHV-2. Fish Shellfish Immunol. 2019, 92, 101–110. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Gu, Y.; Liu, X.; Yuan, R.; Zhou, Y.; Dai, Y.; Fang, P.; Feng, Y.; Cao, G.; Chen, H.; et al. Incidence of Carassius auratus Gibelio Gill Hemorrhagic Disease Caused by CyHV-2 Infection Can Be Reduced by Vaccination with Polyhedra Incorporating Antigens. Vaccines 2021, 9, 397. [Google Scholar] [CrossRef] [PubMed]
- Dong, Z.R.; Mu, Q.J.; Kong, W.G.; Qin, D.C.; Zhou, Y.; Wang, X.Y.; Cheng, G.F.; Luo, Y.Z.; Ai, T.S.; Xu, Z. Gut mucosal immune responses and protective efficacy of oral yeast Cyprinid herpesvirus 2 (CyHV-2) vaccine in Carassius auratus gibelio. Front. Immunol. 2022, 13, 932722. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Yang, M.; Luo, S.; Yang, G.; Lu, X.; Lu, J.; Chen, J. Oral Vaccination of Recombinant Saccharomyces cerevisiae Expressing ORF132 Induces Protective Immunity against Cyprinid Herpesvirus-2. Vaccines 2023, 11, 186. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Ji, W.; Xu, Z. Current use and development of fish vaccines in China. Fish Shellfish Immunol. 2020, 96, 223–234. [Google Scholar] [CrossRef]
- Ma, J.; Bruce, T.J.; Jones, E.M.; Cain, K.D. A Review of Fish Vaccine Development Strategies: Conventional Methods and Modern Biotechnological Approaches. Microorganisms 2019, 7, 569. [Google Scholar] [CrossRef]
- Mondal, H.; Thomas, J. A review on the recent advances and application of vaccines against fish pathogens in aquaculture. Aquac. Int. 2022, 30, 1971–2000. [Google Scholar] [CrossRef]
- Su, H.; Su, J. Cyprinid viral diseases and vaccine development. Fish Shellfish Immunol. 2018, 83, 84–95. [Google Scholar] [CrossRef] [PubMed]
- Current ICTV Taxonomy Release. Available online: https://ictv.global/taxonomy (accessed on 7 December 2023).
- Davison, A.J.; Kurobe, T.; Gatherer, D.; Cunningham, C.; Korf, I.; Fukuda, H.; Hedrick, R.P.; Waltzek, T.B. Comparative genomics of carp herpesviruses. J. Virol. 2013, 87, 2908–2922. [Google Scholar] [CrossRef] [PubMed]
- Boutier, M.; Ronsmans, M.; Ouyang, P.; Fournier, G.; Reschner, A.; Rakus, K.; Wilkie, G.S.; Farnir, F.; Bayrou, C.; Lieffrig, F.; et al. Rational development of an attenuated recombinant cyprinid herpesvirus 3 vaccine using prokaryotic mutagenesis and in vivo bioluminescent imaging. PLoS Pathog. 2015, 11, e1004690. [Google Scholar] [CrossRef] [PubMed]
- Boutier, M.; Gao, Y.; Vancsok, C.; Suarez, N.M.; Davison, A.J.; Vanderplasschen, A. Identification of an essential virulence gene of cyprinid herpesvirus 3. Antivir. Res. 2017, 145, 60–69. [Google Scholar] [CrossRef]
- Boutier, M.; Gao, Y.; Donohoe, O.; Vanderplasschen, A. Current knowledge and future prospects of vaccines against cyprinid herpesvirus 3 (CyHV-3). Fish Shellfish Immunol. 2019, 93, 531–541. [Google Scholar] [CrossRef] [PubMed]
- Jin, L.P. Study of Potential Virulence Genes of Cyprinid herpesvirus 2 (CyHV-2); Shanghai Ocean University: Shanghai, China, 2021. [Google Scholar]
- Zhang, H.G.; Hanson, L.A. Deletion of Thymidine Kinase Gene Attenuates Channel Catfish Herpesvirus While Maintaining Infectivity. Virology 1995, 209, 658–663. [Google Scholar] [CrossRef] [PubMed]
- Fuchs, W.; Fichtner, D.; Bergmann, S.M.; Mettenleiter, T.C. Generation and characterization of koi herpesvirus recombinants lacking viral enzymes of nucleotide metabolism. Arch. Virol. 2011, 156, 1059–1063. [Google Scholar] [CrossRef]
- Schroder, L.; Klafack, S.; Bergmann, S.M.; Fichtner, D.; Jin, Y.; Lee, P.Y.; Hoper, D.; Mettenleiter, T.C.; Fuchs, W. Generation of a potential koi herpesvirus live vaccine by simultaneous deletion of the viral thymidine kinase and dUTPase genes. J. Gen. Virol. 2019, 100, 642–655. [Google Scholar] [CrossRef]
- Qian, M.; Xiao, S.; Yang, Y.; Yu, F.; Wen, J.; Lu, L.; Wang, H. Screening and identification of cyprinid herpesvirus 2 (CyHV-2) ORF55-interacting proteins by phage display. Virol. J. 2023, 20, 66. [Google Scholar] [CrossRef]
- Yang, Z.; Yue, G.H.; Wong, S.-M. VNN disease and status of breeding for resistance to NNV in aquaculture. Aquac. Fish. 2022, 7, 147–157. [Google Scholar] [CrossRef]
- Bandin, I.; Souto, S. Betanodavirus and VER Disease: A 30-year Research Review. Pathogens 2020, 9, 106. [Google Scholar] [CrossRef] [PubMed]
- Souto, S.; Merour, E.; Le Coupanec, A.; Lamoureux, A.; Bernard, J.; Bremont, M.; Millet, J.K.; Biacchesi, S. Recombinant viral hemorrhagic septicemia virus with rearranged genomes as vaccine vectors to protect against lethal betanodavirus infection. Front. Immunol. 2023, 14, 1138961. [Google Scholar] [CrossRef] [PubMed]
- McCann, N.; O’Connor, D.; Lambe, T.; Pollard, A.J. Viral vector vaccines. Curr. Opin. Immunol. 2022, 77, 102210. [Google Scholar] [CrossRef] [PubMed]
- Sasso, E.; D’Alise, A.M.; Zambrano, N.; Scarselli, E.; Folgori, A.; Nicosia, A. New viral vectors for infectious diseases and cancer. Semin. Immunol. 2020, 50, 101430. [Google Scholar] [CrossRef]
- Allam, A.M.; Elbayoumy, M.K.; Ghazy, A.A. Perspective vaccines for emerging viral diseases in farm animals. Clin. Exp. Vaccine Res. 2023, 12, 179–192. [Google Scholar] [CrossRef]
- Kamel, M.; El-Sayed, A. Utilization of herpesviridae as recombinant viral vectors in vaccine development against animal pathogens. Virus Res. 2019, 270, 197648. [Google Scholar] [CrossRef]
- Li, S.; Xie, H.; Yan, Z.; Li, B.; Wu, P.; Qian, X.; Zhang, X.; Wu, J.; Liu, J.; Zhao, X. Development of a live vector vaccine against infectious hematopoietic necrosis virus in rainbow trout. Fish Shellfish Immunol. 2019, 89, 516–524. [Google Scholar] [CrossRef]
- Li, S.; Hu, Y.; Li, X.; Han, S.; Zhang, B.; Yan, Z.; Xue, R.; Gao, Q.; Wu, J.; Zhao, X.; et al. Development of a live vector vaccine against infectious pancreatic necrosis virus in rainbow trout. Aquaculture 2020, 524, 735275. [Google Scholar] [CrossRef]
- McKenna, B.M.; Fitzpatrick, R.M.; Phenix, K.V.; Todd, D.; Vaughan, L.M.; Atkins, G.J. Formation of infectious pancreatic necrosis virus-like particles following expression of segment A by recombinant semliki forest virus. Mar. Biotechnol. 2001, 3, 103–110. [Google Scholar] [CrossRef]
- Hikke, M.C.; Verest, M.; Vlak, J.M.; Pijlman, G.P. Salmonid alphavirus replication in mosquito cells: Towards a novel vaccine production system. Microb. Biotechnol. 2014, 7, 480–484. [Google Scholar] [CrossRef]
- Wolf, A.; Hodneland, K.; Frost, P.; Braaen, S.; Rimstad, E. A hemagglutinin-esterase-expressing salmonid alphavirus replicon protects Atlantic salmon (Salmo salar) against infectious salmon anemia (ISA). Vaccine 2021, 31, 661–669. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.Z.; Liu, M.; Xu, L.M.; Zhang, Z.Y.; Cao, Y.S.; Shao, Y.Z.; Yin, J.S.; Liu, H.B.; Lu, T.Y. A chimeric recombinant infectious hematopoietic necrosis virus induces protective immune responses against infectious hematopoietic necrosis and infectious pancreatic necrosis in rainbow trout. Mol. Immunol. 2019, 116, 180–190. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.G.; Hanson, L.A. Recombinant channel catfish virus (Ictalurid herpesvirus 1) can express foreign genes and induce antibody production against the gene product. J. Fish Dis. 1996, 19, 121–128. [Google Scholar] [CrossRef]
- Lu, J.F.; Xu, D.; Lu, L.Q. A novel cell line established from caudal fin tissue of Carassius auratus gibelio is susceptible to cyprinid herpesvirus 2 infection with the induction of apoptosis. Virus Res. 2018, 258, 19–27. [Google Scholar] [CrossRef]
- Xu, L.; Podok, P.; Xie, J.; Lu, L. Comparative analysis of differential gene expression in kidney tissues of moribund and surviving crucian carp (Carassius auratus gibelio) in response to cyprinid herpesvirus 2 infection. Arch. Virol. 2014, 159, 1961–1974. [Google Scholar] [CrossRef] [PubMed]
- Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Guo, Y.X.; Dallmann, K.; Kwang, J. Identification of nucleolus localization signal of betanodavirus GGNNV protein α. Virology 2003, 306, 225–235. [Google Scholar] [CrossRef]
- He, B.; Sridhar, A.; Streiff, C.; Deketelaere, C.; Zhang, H.; Gao, Y.; Hu, Y.; Pirotte, S.; Delrez, N.; Davison, A.J.; et al. In Vivo Imaging Sheds Light on the Susceptibility and Permissivity of Carassius auratus to Cyprinid Herpesvirus 2 According to Developmental Stage. Viruses 2023, 15, 1746. [Google Scholar] [CrossRef]
- Kancharla, S.; Kancharla, S. Production and shedding of channel catfish virus (CCV) and thymidine kinase negative CCV in immersion exposed channel catfish fingerlings. Dis. Aquat. Org. 1996, 27, 25–34. [Google Scholar] [CrossRef]
- Kunec, D.; Hanson, L.A.; van Haren, S.; Nieuwenhuizen, I.F.; Burgess, S.C. An overlapping bacterial artificial chromosome system that generates vectorless progeny for channel catfish herpesvirus. J. Virol. 2008, 82, 3872–3881. [Google Scholar] [CrossRef]
- Vanderheijden, N.; Alard, P.; Lecomte, C.; Martial, J.A. The Attenuated V60 Strain of Channel Catfish Virus Possesses a Deletion in ORF50 Coding for a Potentially Secreted Glycoprotein. Virology 1996, 218, 422–426. [Google Scholar] [CrossRef]
- Costes, B.; Fournier, G.; Michel, B.; Delforge, C.; Raj, V.S.; Dewals, B.; Gillet, L.; Drion, P.; Body, A.; Schynts, F.; et al. Cloning of the koi herpesvirus genome as an infectious bacterial artificial chromosome demonstrates that disruption of the thymidine kinase locus induces partial attenuation in Cyprinus carpio koi. J. Virol. 2008, 82, 4955–4964. [Google Scholar] [CrossRef] [PubMed]
- Adamek, M.; Matras, M.; Rebl, A.; Stachnik, M.; Falco, A.; Bauer, J.; Miebach, A.C.; Teitge, F.; Jung-Schroers, V.; Abdullah, M.; et al. Don’t Let It Get Under Your Skin!—Vaccination Protects the Skin Barrier of Common Carp From Disruption Caused by Cyprinid Herpesvirus 3. Front. Immunol. 2022, 13, 787021. [Google Scholar] [CrossRef]
- Vancsok, C.; Penaranda, M.M.D.; Raj, V.S.; Leroy, B.; Jazowiecka-Rakus, J.; Boutier, M.; Gao, Y.; Wilkie, G.S.; Suarez, N.M.; Wattiez, R.; et al. Proteomic and Functional Analyses of the Virion Transmembrane Proteome of Cyprinid Herpesvirus 3. J. Virol. 2017, 91, e01209-17. [Google Scholar] [CrossRef] [PubMed]
- Schroder, L.; Klafack, S.; Bergmann, S.M.; Lee, P.A.; Franzke, K.; Hoper, D.; Mettenleiter, T.C.; Fuchs, W. Characterization of gene deletion mutants of Cyprinid herpesvirus 3 (koi herpesvirus) lacking the immunogenic envelope glycoproteins pORF25, pORF65, pORF148 and pORF149. Virus Res. 2019, 261, 21–30. [Google Scholar] [CrossRef] [PubMed]
- Klafack, S.; Schroder, L.; Jin, Y.; Lenk, M.; Lee, P.Y.; Fuchs, W.; Avarre, J.C.; Bergmann, S.M. Development of an attenuated vaccine against Koi Herpesvirus Disease (KHVD) suitable for oral administration and immersion. NPJ Vaccines 2022, 7, 106. [Google Scholar] [CrossRef] [PubMed]
- Michel, B.; Leroy, B.; Stalin Raj, V.; Lieffrig, F.; Mast, J.; Wattiez, R.; Vanderplasschen, A.F.; Costes, B. The genome of cyprinid herpesvirus 3 encodes 40 proteins incorporated in mature virions. J. Gen. Virol. 2010, 91, 452–462. [Google Scholar] [CrossRef] [PubMed]
- Beurden, S.J.V.; Leroy, B.; Wattiez, R.; Haenen, O.L.; Boeren, S.; Vervoort, J.J.; Peeters, B.P.; Rottier, P.J.; Engelsma, M.Y.; Vanderplasschen, A.F. Identification and localization of the structural proteins of anguillid herpesvirus 1. Vet. Res. 2011, 42, 105. [Google Scholar] [CrossRef]
- Gao, W.; Wen, H.; Wang, H.; Lu, J.Q.; Lu, L.Q.; Jiang, Y.S. Identification of structure proteins of cyprinid herpesvirus 2. Aquaculture 2020, 523, 735184. [Google Scholar] [CrossRef]
- Wu, H.C.; Chiu, C.S.; Wu, J.L.; Gong, H.Y.; Chen, M.C.; Lu, M.W.; Hong, J.R. Zebrafish anti-apoptotic protein zfBcl-xL can block betanodavirus protein alpha-induced mitochondria-mediated secondary necrosis cell death. Fish Shellfish Immunol. 2008, 24, 436–449. [Google Scholar] [CrossRef]
- Lin, T.; Xing, J.; Tang, X.; Sheng, X.; Chi, H.; Zhan, W. Immune and protective effects of subunit vaccines from S-domain or P-domain in capsid protein against nervous necrosis virus in pearl gentian grouper. Aquaculture 2023, 566, 739177. [Google Scholar] [CrossRef]
- Cho, S.Y.; Kim, H.J.; Lan, N.T.; Han, H.J.; Lee, D.C.; Hwang, J.Y.; Kwon, M.G.; Kang, B.K.; Han, S.Y.; Moon, H.; et al. Oral vaccination through voluntary consumption of the convict grouper Epinephelus septemfasciatus with yeast producing the capsid protein of red-spotted grouper nervous necrosis virus. Vet. Microbiol. 2017, 204, 159–164. [Google Scholar] [CrossRef] [PubMed]
- Thiery, R.; Cozien, J.; Cabon, J.; Lamour, F.; Baud, M.; Schneemann, A. Induction of a protective immune response against viral nervous necrosis in the European sea bass Dicentrarchus labrax by using betanodavirus virus-like particles. J. Virol. 2006, 80, 10201–10207. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.N.; Lin, L.; Weng, S.P.; He, J.G. High expression of capsid protein of red-spotted grouper nervous necrosis virus in an avian cell line requires viral RNA2 non-coding regions. J. Fish Dis. 2007, 30, 439–444. [Google Scholar] [CrossRef] [PubMed]
- Marsian, J.; Hurdiss, D.L.; Ranson, N.A.; Ritala, A.; Paley, R.; Cano, I.; Lomonossoff, G.P. Plant-Made Nervous Necrosis Virus-Like Particles Protect Fish Against Disease. Front. Plant. Sci. 2019, 10, 880. [Google Scholar] [CrossRef]
- Yang, J.I.; Kim, K.H. Display of Streptococcus iniae alpha-Enolase on the Surface of Virus-Like Particles (VLPs) of Nervous Necrosis Virus (NNV) Using SpyTag/SpyCatcher. Mar. Biotechnol. 2022, 24, 1066–1072. [Google Scholar] [CrossRef]
- Zheng, J.; Yang, J.; Zhang, Z.; Liang, X.; Liu, S.; Pan, Y.; Wei, J.; Huang, Y.; Huang, X.; Qin, Q. An improved oral vaccine with molecular adjuvant beta-defensin protects grouper against nervous necrosis virus infection. Fish Shellfish Immunol. 2023, 136, 108709. [Google Scholar] [CrossRef]








| Function | Name | Sequence (5′-3′) |
|---|---|---|
| For amplification of the NNV-CP gene segment | CP-F | ATGGTACGCAAAGGTGAGAAGAAATTG |
| CP-R | GTTTTCCGAGTCAACCCTAGTGC | |
| For construction of the NNV-CP gene segment with overlapping sequence termini (lowercase) | CP-EcoRI-F | gatctcgagctcaagcttcgaattcATGGTACGCAAAGGTGAGAAGAAATTG |
| CP-Overlap-R | gtgggcttgtactcggtcatGTTTTCCGAGTCAACCCTAGTGC | |
| For amplification of the Puror gene segment | Puro-F | ATGACCGAGTACAAGCCCACG |
| Puro-R | GGCACCGGGCTTGCG | |
| For construction of the Puror gene segment with overlapping sequence termini (lowercase) | Puro-Overlap-F | ctagggttgactcggaaaacATGACCGAGTACAAGCCCACG |
| Puro-BamHI-R | tgctcaccatggtggcgatggatctGGCACCGGGCTTGCG | |
| For amplification of the NNV-CP fusion protein expression cassette | CP-box-F | CGTTACATAACTTACGGTAAATGGCCC |
| CP-box-R | TTACTTGTACAGCTCGTCCATGCC | |
| For construction of the NNV-CP fusion protein expression cassette with overlapping sequence termini (lowercase) | Δ55-CP-KpnI-F | ctgacaatcgttacacggacggtacCGTTACATAACTTACGGTAAATGGCCC |
| Δ55-CP-EcoRI-R | ctctgagggttcgggagtgaagaattTTACTTGTACAGCTCGTCCATGCC | |
| Δ57-CP-BamHI-F | tgacatcatgagcgggggatccCGTTACATAACTTACGGTAAATGGCCC | |
| Δ57-CP-EcoRI-R | ctttgggtttagcgccgaattcTTACTTGTACAGCTCGTCCATGCC | |
| For amplification of the ORF55 upstream arm | Δ55-U-F | GGGTATGTTATCCTTGTTGATGGCG |
| Δ55-U-R | GTCCGTGTAACGATTGTCAGCAG | |
| For construction of the ORF55 upstream arm with overlapping sequence termini (lowercase) | Δ55-U-BamHI-F | gcctgcaggtcgactctagaggatcGGGTATGTTATCCTTGTTGATGGCG |
| Δ55-U-Overlap-R | cgggagtgaagaattcgacatctatggtaccGTCCGTGTAACGATTGTCAGCAG | |
| For amplification of the ORF55 downstream arm (lowercase) | Δ55-D-F | TTCACTCCCGAACCCTCAGAGG |
| Δ55-D-R | CGACTGGTTCATATCCAACAGAGAAGT | |
| For construction of the ORF55 downstream arm with overlapping sequence termini (lowercase) | Δ55-D-Overlap-F | ttacacggacggtaccatagatgtcgaattcTTCACTCCCGAACCCTCAGAGG |
| Δ55-D-EcoRI-R | aacagctatgaccatgattacgaattgCGACTGGTTCATATCCAACAGAGAAGT | |
| For amplification of the ORF57 upstream arm | Δ57-U--F | AGCTTGTTTCTGAAACCAGAGATGC |
| Δ57-U-R | CCCGCTCATGATGTCACACTTG | |
| For construction of the ORF57 upstream arm with overlapping sequence termini (lowercase) | Δ57-U-BamHI-F | gcctgcaggtcgactctagaggatcAGCTTGTTTCTGAAACCAGAGATGC |
| Δ57-U-Overlap-R | tgggtttagcgccgaattcgacatctatggatccCCCGCTCATGATGTCACACTTG | |
| For amplification of the ORF57 downstream arm | Δ57-D-F | GGCGCTAAACCCAAAGCTC |
| Δ57-D-R | AGCAAGCTGCGCTCTGG | |
| For construction of the ORF57 downstream arm with overlapping sequence termini (lowercase) | Δ57-D-Overlap-F | atcatgagcgggggatccatagatgtcgaattcGGCGCTAAACCCAAAGCTC |
| Δ57-D-EcoRI-R | acagctatgaccatgattacgaattAGCAAGCTGCGCTCTGG |
| Varieties | Weight (g) | Survival Rates (%) | ||
|---|---|---|---|---|
| Intraperitoneal Injection | Immersion for 2 h | Immersion for 2 Days | ||
| Gibel carp var. CAS V (C. auratus gibelio) | 8 ± 2 | 100 | 100 | 100 |
| 200 ± 20 | 100 | 100 | 100 | |
| Gibel carp var. CAS III (C. auratus gibelio) | 200 ± 20 | 100 | 100 | 100 |
| Fang Zheng crucian carp (C. auratus gibelio) | 200 ± 20 | 100 | 100 | 100 |
| White crucian carps (C. auratus cuvieri) | 200 ± 20 | 100 | 100 | 100 |
| Goldfish (C. auratus L.) | 8 ± 2 | 90 | 100 | 30 |
| 100 ± 10 | 100 | 100 | 100 | |
| Virus Concentration | Mean Survival Rates (%) | ||
|---|---|---|---|
| CyHV-2-WT | CyHV-2-Δ55-CP | CyHV-2-Δ57-CP | |
| 102 TCID50/mL | 89.17 | 93.33 | 92.5 |
| 103 TCID50/mL | 36.67 | 55 | 72.5 |
| 104 TCID50/mL | 29.17 | 37.5 | 47.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feng, Z.; Cheng, W.; Ma, M.; Yu, C.; Zhang, Y.; Lu, L.; Wang, H.; Gui, L.; Xu, D.; Dong, C. Generation and Characterization of ORF55/ORF57-Deleted Recombinant Cyprinid herpesvirus 2 Mutants with Chimeric Capsid Protein Gene of Grouper Nervous Necrosis Virus. Vaccines 2024, 12, 43. https://doi.org/10.3390/vaccines12010043
Feng Z, Cheng W, Ma M, Yu C, Zhang Y, Lu L, Wang H, Gui L, Xu D, Dong C. Generation and Characterization of ORF55/ORF57-Deleted Recombinant Cyprinid herpesvirus 2 Mutants with Chimeric Capsid Protein Gene of Grouper Nervous Necrosis Virus. Vaccines. 2024; 12(1):43. https://doi.org/10.3390/vaccines12010043
Chicago/Turabian StyleFeng, Zizhao, Wenjie Cheng, Mingyang Ma, Chenwei Yu, Ye Zhang, Liqun Lu, Hao Wang, Lang Gui, Dan Xu, and Chuanfu Dong. 2024. "Generation and Characterization of ORF55/ORF57-Deleted Recombinant Cyprinid herpesvirus 2 Mutants with Chimeric Capsid Protein Gene of Grouper Nervous Necrosis Virus" Vaccines 12, no. 1: 43. https://doi.org/10.3390/vaccines12010043
APA StyleFeng, Z., Cheng, W., Ma, M., Yu, C., Zhang, Y., Lu, L., Wang, H., Gui, L., Xu, D., & Dong, C. (2024). Generation and Characterization of ORF55/ORF57-Deleted Recombinant Cyprinid herpesvirus 2 Mutants with Chimeric Capsid Protein Gene of Grouper Nervous Necrosis Virus. Vaccines, 12(1), 43. https://doi.org/10.3390/vaccines12010043

