Dietary Intervention Accelerates NASH Resolution Depending on Inflammatory Status with Minor Additive Effects on Hepatic Injury by Vitamin E Supplementation
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. Plasma Samples
2.3. Liver Samples
2.4. Histology
2.5. qPCR
2.6. Statistical Analyses
3. Results
3.1. Dyslipidemia
3.2. Plasma Biochemical Markers
3.3. Liver Status
3.4. Histopathological Evaluation
3.5. Expression of Target Genes/qPCR
3.6. Subanalyses of Chow and CvitE/Correlation
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Liu, W.; Baker, R.D.; Bhatia, T.; Zhu, L.; Baker, S.S. Pathogenesis of nonalcoholic steatohepatitis. Cell Mol. Life Sci. 2016, 73, 1969–1987. [Google Scholar] [CrossRef] [Scilit]
- Chalasani, N.; Younossi, Z.; Lavine, J.E.; Charlton, M.; Cusi, K.; Rinella, M.; Harrison, S.A.; Brunt, E.M.; Sanyal, A.J. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology 2018, 67, 328–357. [Google Scholar] [CrossRef] [Scilit]
- Younossi, Z.; Tacke, F.; Arrese, M.; Chander Sharma, B.; Mostafa, I.; Bugianesi, E.; Wai-Sun Wong, V.; Yilmaz, Y.; George, J.; Fan, J.; et al. Global perspectives on nonalcoholic fatty liver disease and nonalcoholic steatohepatitis. Hepatology 2019, 69, 2672–2682. [Google Scholar] [CrossRef] [Scilit]
- Younossi, Z.; Anstee, Q.M.; Marietti, M.; Hardy, T.; Henry, L.; Eslam, M.; George, J.; Bugianesi, E. Global burden of NAFLD and NASH: Trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 11–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ipsen, D.H.; Tveden-Nyborg, P.; Lykkesfeldt, J. Dyslipidemia: Obese or not obese-that is not the question. Curr. Obes. Rep. 2016, 5, 405–412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hojland Ipsen, D.; Tveden-Nyborg, P.; Lykkesfeldt, J. Normal weight dyslipidemia: Is it all about the liver? Obesity 2016, 24, 556–567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koek, G.H.; Liedorp, P.R.; Bast, A. The role of oxidative stress in non-alcoholic steatohepatitis. Clin. Chim. Acta 2011, 412, 1297–1305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pessayre, D.; Berson, A.; Fromenty, B.; Mansouri, A. Mitochondria in steatohepatitis. Semin. Liver Dis. 2001, 21, 57–69. [Google Scholar] [CrossRef] [Scilit]
- Richter, K.; Konzack, A.; Pihlajaniemi, T.; Heljasvaara, R.; Kietzmann, T. Redox-fibrosis: Impact of TGFbeta1 on ROS generators, mediators and functional consequences. Redox Biol. 2015, 6, 344–352. [Google Scholar] [CrossRef] [Scilit]
- Liu, R.M.; Desai, L.P. Reciprocal regulation of TGF-beta and reactive oxygen species: A perverse cycle for fibrosis. Redox Biol. 2015, 6, 565–577. [Google Scholar] [CrossRef] [Scilit]
- Nagashimada, M.; Ota, T. Role of vitamin E in nonalcoholic fatty liver disease. IUBMB Life 2019, 71, 516–522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amanullah, I.; Khan, Y.H.; Anwar, I.; Gulzar, A.; Mallhi, T.H.; Raja, A.A. Effect of vitamin E in non-alcoholic fatty liver disease: A systematic review and meta-analysis of randomised controlled trials. Postgrad. Med. J. 2019, 95, 601–611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nath, P.; Singh, P.S. Nonalcoholic fatty liver disease: Time to take the bull by the horns. Euroasian J. Hepato Gastroenterol. 2018, 8, 47–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seki, S.; Kitada, T.; Yamada, T.; Sakaguchi, H.; Nakatani, K.; Wakasa, K. In situ detection of lipid peroxidation and oxidative DNA damage in non-alcoholic fatty liver diseases. J. Hepatol. 2002, 37, 56–62. [Google Scholar] [CrossRef] [Scilit]
- Koruk, M.; Taysi, S.; Savas, M.C.; Yilmaz, O.; Akcay, F.; Karakok, M. Oxidative stress and enzymatic antioxidant status in patients with nonalcoholic steatohepatitis. Ann. Clin. Lab. Sci. 2004, 34, 57–62. [Google Scholar]
- Estes, C.; Razavi, H.; Loomba, R.; Younossi, Z.; Sanyal, A.J. Modeling the epidemic of nonalcoholic fatty liver disease demonstrates an exponential increase in burden of disease. Hepatology 2018, 67, 123–133. [Google Scholar] [CrossRef] [Scilit]
- Marchesini, G.; European Association for the Study of Obesity (EASO). EASL-EASD-EASO clinical practice guidelines for the management of non-alcoholic fatty liver disease. J. Hepatol. 2016, 64, 1388–1402. [Google Scholar] [CrossRef] [Scilit]
- Musso, G.; Cassader, M.; Rosina, F.; Gambino, R. Impact of current treatments on liver disease, glucose metabolism and cardiovascular risk in non-alcoholic fatty liver disease (NAFLD): A systematic review and meta-analysis of randomised trials. Diabetologia 2012, 55, 885–904. [Google Scholar] [CrossRef] [Scilit]
- Gehrke, N.; Biedenbach, J.; Huber, Y.; Straub, B.K.; Galle, P.R.; Simon, P.; Schattenberg, J.M. Voluntary exercise in mice fed an obesogenic diet alters the hepatic immune phenotype and improves metabolic parameters—An animal model of life style intervention in NAFLD. Sci. Rep. 2019, 9, 4007. [Google Scholar] [CrossRef] [Scilit]
- Klaebel, J.H.; Skjodt, M.; Skat-Rordam, J.; Rakipovski, G.; Ipsen, D.H.; Schou-Pedersen, A.M.V.; Lykkesfeldt, J.; Tveden-Nyborg, P. Atorvastatin and vitamin E accelerates NASH resolution by dietary intervention in a preclinical guinea pig model. Nutrients 2019, 11, 2834. [Google Scholar] [CrossRef] [Scilit]
- Vilar-Gomez, E.; Martinez-Perez, Y.; Calzadilla-Bertot, L.; Torres-Gonzalez, A.; Gra-Oramas, B.; Gonzalez-Fabian, L.; Friedman, S.L.; Diago, M.; Romero-Gomez, M. Weight loss through lifestyle modification significantly reduces features of nonalcoholic steatohepatitis. Gastroenterology 2015, 149, 367–378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Younossi, Z.M.; Loomba, R.; Rinella, M.E.; Bugianesi, E.; Marchesini, G.; Neuschwander-Tetri, B.A.; Serfaty, L.; Negro, F.; Caldwell, S.H.; Ratziu, V.; et al. Current and future therapeutic regimens for nonalcoholic fatty liver disease and nonalcoholic steatohepatitis. Hepatology 2018, 68, 361–371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lassailly, G.; Caiazzo, R.; Pattou, F.; Mathurin, P. Perspectives on treatment for nonalcoholic steatohepatitis. Gastroenterology 2016, 150, 1835–1848. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- European Association for the Study of the Liver. EASL-EASD-EASO clinical practice guidelines for the management of non-alcoholic fatty liver disease. Obes. Facts 2016, 9, 65–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rinella, M.E.; Sanyal, A.J. Management of NAFLD: A stage-based approach. Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 196–205. [Google Scholar] [CrossRef] [Scilit]
- Sanyal, A.J.; Chalasani, N.; Kowdley, K.V.; McCullough, A.; Diehl, A.M.; Bass, N.M.; Neuschwander-Tetri, B.A.; Lavine, J.E.; Tonascia, J.; Unalp, A.; et al. Pioglitazone, vitamin E, or placebo for nonalcoholic steatohepatitis. N. Engl. J. Med. 2010, 362, 1675–1685. [Google Scholar] [CrossRef] [Scilit]
- Lavine, J.E.; Schwimmer, J.B.; Van Natta, M.L.; Molleston, J.P.; Murray, K.F.; Rosenthal, P.; Abrams, S.H.; Scheimann, A.O.; Sanyal, A.J.; Chalasani, N.; et al. Effect of vitamin E or metformin for treatment of nonalcoholic fatty liver disease in children and adolescents: The TONIC randomized controlled trial. JAMA 2011, 305, 1659–1668. [Google Scholar] [CrossRef] [Scilit]
- Sato, K.; Gosho, M.; Yamamoto, T.; Kobayashi, Y.; Ishii, N.; Ohashi, T.; Nakade, Y.; Ito, K.; Fukuzawa, Y.; Yoneda, M. Vitamin E has a beneficial effect on nonalcoholic fatty liver disease: A meta-analysis of randomized controlled trials. Nutrition 2015, 31, 923–930. [Google Scholar] [CrossRef] [Scilit]
- Xu, R.; Tao, A.; Zhang, S.; Deng, Y.; Chen, G. Association between vitamin E and non-alcoholic steatohepatitis: A meta-analysis. Int. J. Clin. Exp. Med. 2015, 8, 3924–3934. [Google Scholar]
- El Hadi, H.; Vettor, R.; Rossato, M. Vitamin E as a treatment for nonalcoholic fatty liver disease: Reality or myth? Antioxidants 2018, 7, 12. [Google Scholar] [CrossRef] [Scilit]
- Azzi, A.; Breyer, I.; Feher, M.; Pastori, M.; Ricciarelli, R.; Spycher, S.; Staffieri, M.; Stocker, A.; Zimmer, S.; Zingg, J.M. Specific cellular responses to alpha-tocopherol. J. Nutr. 2000, 130, 1649–1652. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rimbach, G.; Moehring, J.; Huebbe, P.; Lodge, J.K. Gene-regulatory activity of alpha-tocopherol. Molecules 2010, 15, 1746–1761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Podszun, M.C.; Grebenstein, N.; Spruss, A.; Schlueter, T.; Kremoser, C.; Bergheim, I.; Frank, J. Dietary alpha-tocopherol and atorvastatin reduce high-fat-induced lipid accumulation and down-regulate CD36 protein in the liver of guinea pigs. J. Nutr. Biochem. 2014, 25, 573–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perumpail, B.J.; Li, A.A.; John, N.; Sallam, S.; Shah, N.D.; Kwong, W.; Cholankeril, G.; Kim, D.; Ahmed, A. The role of vitamin E in the treatment of NAFLD. Diseases 2018, 6, 86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, E.R., 3rd; Pastor-Barriuso, R.; Dalal, D.; Riemersma, R.A.; Appel, L.J.; Guallar, E. Meta-analysis: High-dosage vitamin E supplementation may increase all-cause mortality. Ann. Intern. Med. 2005, 142, 37–46. [Google Scholar] [CrossRef] [Scilit]
- Abner, E.L.; Schmitt, F.A.; Mendiondo, M.S.; Marcum, J.L.; Kryscio, R.J. Vitamin E and all-cause mortality: A meta-analysis. Curr. Aging Sci. 2011, 4, 158–170. [Google Scholar] [CrossRef] [Scilit]
- Ipsen, D.H.; Skat-Rordam, J.; Tsamouri, M.M.; Latta, M.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular drivers of non-alcoholic steatohepatitis are sustained in mild-to-late fibrosis progression in a guinea pig model. Mol. Genet. Genom. 2019, 294, 649–661. [Google Scholar] [CrossRef] [Scilit]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef] [Scilit]
- Tveden-Nyborg, P.; Birck, M.M.; Ipsen, D.H.; Thiessen, T.; Feldmann, L.B.; Lindblad, M.M.; Jensen, H.E.; Lykkesfeldt, J. Diet-induced dyslipidemia leads to nonalcoholic fatty liver disease and oxidative stress in guinea pigs. Transl. Res. 2016, 168, 146–160. [Google Scholar] [CrossRef] [Scilit]
- Ipsen, D.H.; Tveden-Nyborg, P.; Rolin, B.; Rakipovski, G.; Beck, M.; Mortensen, L.W.; Faerk, L.; Heegaard, P.M.; Moller, P.; Lykkesfeldt, J. High-fat but not sucrose intake is essential for induction of dyslipidemia and non-alcoholic steatohepatitis in guinea pigs. Nutr. Metab. 2016, 13, 51. [Google Scholar] [CrossRef] [Scilit]
- Frikke-Schmidt, H.; Tveden-Nyborg, P.; Birck, M.M.; Lykkesfeldt, J. High dietary fat and cholesterol exacerbates chronic vitamin C deficiency in guinea pigs. Br. J. Nutr. 2011, 105, 54–61. [Google Scholar] [CrossRef] [Scilit]
- Burton, G.W.; Webb, A.; Ingold, K.U. A mild, rapid, and efficient method of lipid extraction for use in determining vitamin E/lipid ratios. Lipids 1985, 20, 29–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kleiner, D.E.; Brunt, E.M.; Van Natta, M.; Behling, C.; Contos, M.J.; Cummings, O.W.; Ferrell, L.D.; Liu, Y.C.; Torbenson, M.S.; Unalp-Arida, A.; et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005, 41, 1313–1321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tveden-Nyborg, P.; Hasselholt, S.; Miyashita, N.; Moos, T.; Poulsen, H.E.; Lykkesfeldt, J. Chronic vitamin C deficiency does not accelerate oxidative stress in ageing brains of guinea pigs. Basic Clin. Pharmacol. Toxicol. 2012, 110, 524–529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chalasani, N.P.; Sanyal, A.J.; Kowdley, K.V.; Robuck, P.R.; Hoofnagle, J.; Kleiner, D.E.; Unalp, A.; Tonascia, J.; Group, N.C.R. Pioglitazone versus vitamin E versus placebo for the treatment of non-diabetic patients with non-alcoholic steatohepatitis: PIVENS trial design. Contemp. Clin. Trials 2009, 30, 88–96. [Google Scholar] [CrossRef] [Scilit]
- Landrier, J.F.; Gouranton, E.; El Yazidi, C.; Malezet, C.; Balaguer, P.; Borel, P.; Amiot, M.J. Adiponectin expression is induced by vitamin E via a peroxisome proliferator-activated receptor gamma-dependent mechanism. Endocrinology 2009, 150, 5318–5325. [Google Scholar] [CrossRef] [Scilit]
- Dadson, K.; Liu, Y.; Sweeney, G. Adiponectin action: A combination of endocrine and autocrine/paracrine effects. Front. Endocrinol. 2011, 2, 62. [Google Scholar] [CrossRef] [Scilit]
- Schuster, S.; Cabrera, D.; Arrese, M.; Feldstein, A.E. Triggering and resolution of inflammation in NASH. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 349–364. [Google Scholar] [CrossRef] [Scilit]
- Armstrong, M.J.; Gaunt, P.; Newsome, P.N. Identifying patients with nonalcoholic steatohepatitis that are nonresponders to therapy. Hepatology 2016, 64, 2265–2266. [Google Scholar] [CrossRef] [Scilit]
- Ratziu, V.; Goodman, Z.; Sanyal, A. Current efforts and trends in the treatment of NASH. J. Hepatol. 2015, 62, S65–S75. [Google Scholar] [CrossRef] [Scilit]
- Cheng, J.; Joyce, A.; Yates, K.; Aouizerat, B.; Sanyal, A.J. Metabolomic profiling to identify predictors of response to vitamin E for non-alcoholic steatohepatitis (NASH). PLoS ONE 2012, 7, e44106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Min, H.K.; Kapoor, A.; Fuchs, M.; Mirshahi, F.; Zhou, H.; Maher, J.; Kellum, J.; Warnick, R.; Contos, M.J.; Sanyal, A.J. Increased hepatic synthesis and dysregulation of cholesterol metabolism is associated with the severity of nonalcoholic fatty liver disease. Cell Metab. 2012, 15, 665–674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gottlieb, A.; Canbay, A. Why bile acids are so important in non-alcoholic fatty liver disease (NAFLD) progression. Cells 2019, 8, 1358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bechmann, L.P.; Kocabayoglu, P.; Sowa, J.P.; Sydor, S.; Best, J.; Schlattjan, M.; Beilfuss, A.; Schmitt, J.; Hannivoort, R.A.; Kilicarslan, A.; et al. Free fatty acids repress small heterodimer partner (SHP) activation and adiponectin counteracts bile acid-induced liver injury in superobese patients with nonalcoholic steatohepatitis. Hepatology 2013, 57, 1394–1406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Younossi, Z.M.; Stepanova, M.; Rafiq, N.; Henry, L.; Loomba, R.; Makhlouf, H.; Goodman, Z. Nonalcoholic steatofibrosis independently predicts mortality in nonalcoholic fatty liver disease. Hepatol. Commun. 2017, 1, 421–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Younossi, Z.M.; Stepanova, M.; Rafiq, N.; Makhlouf, H.; Younoszai, Z.; Agrawal, R.; Goodman, Z. Pathologic criteria for nonalcoholic steatohepatitis: Interprotocol agreement and ability to predict liver-related mortality. Hepatology 2011, 53, 1874–1882. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwak, M.S.; Kim, D. Non-alcoholic fatty liver disease and lifestyle modifications, focusing on physical activity. Korean J. Intern. Med. 2018, 33, 64–74. [Google Scholar] [CrossRef] [Scilit]
- Hannah, W.N., Jr.; Harrison, S.A. Lifestyle and dietary interventions in the management of nonalcoholic fatty liver disease. Dig. Dis. Sci. 2016, 61, 1365–1374. [Google Scholar] [CrossRef] [Scilit]
- Glass, L.M.; Dickson, R.C.; Anderson, J.C.; Suriawinata, A.A.; Putra, J.; Berk, B.S.; Toor, A. Total body weight loss of >/= 10% is associated with improved hepatic fibrosis in patients with nonalcoholic steatohepatitis. Dig. Dis. Sci. 2015, 60, 1024–1030. [Google Scholar] [CrossRef] [Scilit]
- Vilar-Gomez, E.; Calzadilla-Bertot, L.; Wai-Sun Wong, V.; Castellanos, M.; Aller-de la Fuente, R.; Metwally, M.; Eslam, M.; Gonzalez-Fabian, L.; Alvarez-Quinones Sanz, M.; Conde-Martin, A.F.; et al. Fibrosis severity as a determinant of cause-specific mortality in patients with advanced nonalcoholic fatty liver disease: A multi-national cohort study. Gastroenterology 2018, 155, 443–457. [Google Scholar] [CrossRef] [Scilit]
- Reddy, A.J.; George, E.S.; Roberts, S.K.; Tierney, A.C. Effect of dietary intervention, with or without co-interventions, on inflammatory markers in patients with nonalcoholic fatty liver disease: A systematic literature review. Nutr. Rev. 2019, 77, 765–786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manco, M.; Marcellini, M.; Giannone, G.; Nobili, V. Correlation of serum TNF-alpha levels and histologic liver injury scores in pediatric nonalcoholic fatty liver disease. Am. J. Clin. Pathol. 2007, 127, 954–960. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hui, J.M.; Hodge, A.; Farrell, G.C.; Kench, J.G.; Kriketos, A.; George, J. Beyond insulin resistance in NASH: TNF-alpha or adiponectin? Hepatology 2004, 40, 46–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spahis, S.; Delvin, E.; Borys, J.M.; Levy, E. Oxidative stress as a critical factor in nonalcoholic fatty liver disease pathogenesis. Antioxid. Redox Signal. 2017, 26, 519–541. [Google Scholar] [CrossRef] [Scilit]
- Kakino, S.; Ohki, T.; Nakayama, H.; Yuan, X.; Otabe, S.; Hashinaga, T.; Wada, N.; Kurita, Y.; Tanaka, K.; Hara, K.; et al. Pivotal role of TNF-alpha in the development and progression of nonalcoholic fatty liver disease in a murine model. Horm. Metab. Res. 2018, 50, 80–87. [Google Scholar] [CrossRef] [Scilit]






| Nutrient | HF | Control | Chow | CvitE |
|---|---|---|---|---|
| Protein (%) | 16.7 | 16.8 | 16.8 | 16.8 |
| Carbohydrates (%) | 37.9 | 47.1 | 47.1 | 47.1 |
| Fat (%) | 20 | 4 | 4 | 4 |
| Cholesterol (%) | 0.35 | - | - | - |
| Sucrose (%) | 15 | - | - | - |
| Vitamin E (all-rac-alpha-tocopherylacetate (mg/kg feed)) | 125 | 125 | 125 | 1125 |
| Gene | Accession No. | Forward (5′-3′) | Reverse (3′-5′) | Product (bp) |
|---|---|---|---|---|
| IL-8 | NM_001173399.2 | GGCAGCCTTCCTGCTCTCT | CAGCTCCGAGACCAACTTTGT | 67 |
| TNF-α | NM_001173025.1 | GCCGTCTCCTACCCGGAAAA | TAGATCTGCCCGGAATCGGC | 203 |
| MCP-1 | NM_001172926.1 | TGCCAAACTGGACCAGAGAA | CGAATGTTCAAAGGCTTTGAAGT | 75 |
| CYP7A1 | GQ507494.1 | CTGGAGAAGGCAGGTCAACA | CTCCTTAGCTGTCCGGATGT | 150 |
| TGF-β | NM_001173023.1 | AACCCGAGCCGGACTACTATG | TGCTTTTATAGATATTGTGGCTGT TGT | 78 |
| col1a1 | XM_003466865.2 | CTGGACAGCGTGGTGTAGTC | TCCAGAAGGACCTTGTTTGC | 104 |
| α-sma | ENSCPOT00000011693.2 | GACATCAAGGAGAAGCTGTG | GCTGTTGTAGGTGGTTTCAT | 273 |
| HF | Control 25 | Control | Chow | CvitE | |
|---|---|---|---|---|---|
| TC (mmol/L) j | 3.77 (2.65–5.35) | 0.82 (0.46–1.48) #### | 0.70 (0.53–0.94) #### | 2.08 (1.69–2.55) #,**** | 2.48 (1.95–3.16) **** |
| TG (mmol/L) j | 0.53 (0.44–0.65) | 2.73 (1.04–7.19) #### | 1.43 (1.16–1.78) #### | 0.44 (0.40–0.48) **** | 0.47 (0.43–0.51) **** |
| FFA (mmol/L) | 0.51 ± 0.16 | 0.79 ± 0.19 # | 0.68 ± 0.19 | 0.58 ± 0.15 | 0.59 ± 0.19 |
| ALP (U/L) | 28.42 ± 4.66 | 39.67 ± 1.97 # | 34.00 ± 10.33 | 34.24 ± 6.47 | 33.67 ± 7.27 |
| ALT (U/L) | 63.11 ± 17.77 | 40.67 ± 15.32 | 32.67 ± 8.74 ### | 52.19 ± 18.84 * | 52.38 ± 22.99 * |
| AST (U/L) | 546.0 ± 263.1 | 139.2 ± 231.3 ### | 87.48 ± 57.98 #### | 273.1 ± 133.5 ## | 322.2 ± 198.6 #,** |
| αToc (µmol/L) j | 2.17 (1.52–3.08) | 1.58 (0.74–3.41) | 1.19 (0.77–1.85) | 1.98 (1.56–2.50) | 6.89 (5.25–9.06) ####,****,†††† |
| HF | Control25 | Control | Chow | CvitE | |
|---|---|---|---|---|---|
| Liver weight (%) j | 6.63 (5.79–7.87) | 2.62 (2.28–3.0) #### | 2.65 (2.47–2.87) #### | 4.37 (4.03–4.85) ####,**** | 4.57 (4.18–5.14) ####,**** |
| HC (µmol/g) | 80.09 ± 26.47 | 32.38 ± 21.34 #### | 20.88 ± 17.77 #### | 47.19 ± 15.74 ###,** | 48.00 ± 17.65 ###,** |
| HT (µmol/g) | 43.20 ± 9.64 | 5.48 ± 0.61 #### | 5.06 ± 0.55 #### | 23.75 ± 5.15 ####,**** | 24.73 ± 6.84 ####,**** |
| αToc (nmol/g) j | 4.08 (3.08–5.4) | 7.09 (3.45–14.57) | 2.91 (2.11–4.01) | 7.55 (5.52–10.32) ** | 75.22 (49.03–115.4) ####,****,†††† |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Klaebel, J.H.; Rakipovski, G.; Andersen, B.; Lykkesfeldt, J.; Tveden-Nyborg, P. Dietary Intervention Accelerates NASH Resolution Depending on Inflammatory Status with Minor Additive Effects on Hepatic Injury by Vitamin E Supplementation. Antioxidants 2020, 9, 808. https://doi.org/10.3390/antiox9090808
Klaebel JH, Rakipovski G, Andersen B, Lykkesfeldt J, Tveden-Nyborg P. Dietary Intervention Accelerates NASH Resolution Depending on Inflammatory Status with Minor Additive Effects on Hepatic Injury by Vitamin E Supplementation. Antioxidants. 2020; 9(9):808. https://doi.org/10.3390/antiox9090808
Chicago/Turabian StyleKlaebel, Julie Hviid, Günaj Rakipovski, Birgitte Andersen, Jens Lykkesfeldt, and Pernille Tveden-Nyborg. 2020. "Dietary Intervention Accelerates NASH Resolution Depending on Inflammatory Status with Minor Additive Effects on Hepatic Injury by Vitamin E Supplementation" Antioxidants 9, no. 9: 808. https://doi.org/10.3390/antiox9090808
APA StyleKlaebel, J. H., Rakipovski, G., Andersen, B., Lykkesfeldt, J., & Tveden-Nyborg, P. (2020). Dietary Intervention Accelerates NASH Resolution Depending on Inflammatory Status with Minor Additive Effects on Hepatic Injury by Vitamin E Supplementation. Antioxidants, 9(9), 808. https://doi.org/10.3390/antiox9090808

