Enhancement of Growth, Antioxidant Activity, and Immunity in Nile Tilapia (Oreochromis niloticus) Through Recombinant Bacillus subtilis Expressing L-Gulonolactone Oxidase
Abstract
1. Introduction
2. Materials and Methods
2.1. Construction of Recombinant Probiotic B. subtilis Expressing GULO
2.1.1. Primer Design, RNA Isolation, and cDNA Synthesis
2.1.2. Cloning of the Full-Length GULO cDNA of G. gallus into pGEM®T-Easy
2.1.3. Transformation of GULO Plasmid into Probiotic B. subtilis via Electroporation
2.1.4. Western Blotting Analysis
2.2. Ethics Statement
2.3. The Effect of Dietary Recombinant Probiotic B. subtilis Expressing GULO Supplementation in Normal Fish
2.3.1. Experimental Design
2.3.2. Diet Preparation
2.3.3. Growth Performance
2.3.4. Determination of Vitamin C in Nile Tilapia Serum Using HPLC Analysis
2.3.5. Immune Parameters
2.3.6. Serum Antioxidant Enzyme Activities
2.3.7. Expression of GULO mRNA in Normal Fish via qRT-PCR
2.4. The Effect of Dietary Supplementation with Probiotic B. subtilis Expressing GULO After a Challenge with S. agalactiae in Nile Tilapia
2.4.1. Experimental Design
2.4.2. Preparation of S. agalactiae and Challenge Test
2.4.3. Immune Parameters and Expression of Pro-Inflammation Genes in Challenged Fish
2.5. Statistical Analysis
3. Results
3.1. Construction of Recombinant B. subtilis Expressing GULO and Western Blot Analysis
3.2. Growth Performance
3.3. Determination of Vitamin C in Nile Tilapia Serum Using HPLC Analysis
3.4. Expression of GULO mRNA in Normal Fish by qRT-PCR
3.5. Immune Responses
3.6. Antioxidant Enzyme Parameters in Nile Tilapia Serum
3.7. Immune Parameter After S. agalactiae Injection
3.8. Pro-Inflammatory Gene Expression After S. agalactiae Injection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Assefa, A.; Abunna, F. Maintenance of Fish Health in Aquaculture: Review of Epidemiological Approaches for Prevention and Control of Infectious Disease of Fish. Vet. Med. Int. 2018, 2018, 5432497. [Google Scholar] [CrossRef]
- Debnath, S.C.; McMurtrie, J.; Temperton, B.; Delamare-Deboutteville, J.; Mohan, C.V.; Tyler, C. Tilapia Aquaculture, Emerging Diseases, and the Roles of the Skin Microbiomes in Health and Disease. Aquacult. Int. 2023, 31, 2945–2976. [Google Scholar] [CrossRef]
- Munguti, J.; Nairuti, R.; Iteba, J.; Obiero, K.; Kyule, D.; Opiyo, M.; Abwao, J.; Kirimi, J.; Outa, N.; Muthoka, M.; et al. Nile Tilapia (Oreochromis niloticus Linnaeus, 1758) Culture in Kenya: Emerging Production Technologies and Socio-Economic Impacts on Local Livelihoods. Aquacult. Fish Fish. 2022, 2, 265–276. [Google Scholar] [CrossRef]
- Nayak, S.K. Probiotics and Immunity: A Fish Perspective. Fish Shellfish Immunol. 2010, 29, 2–14. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Wang, S.; Cai, Y.; Guo, X.; Cao, Z.; Zhang, Y.; Liu, S.; Yuan, W.; Zhu, W.; Zheng, Y.; et al. Dietary Administration of Bacillus subtilis HAINUP40 Enhances Growth, Digestive Enzyme Activities, Innate Immune Responses, and Disease Resistance of Tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2017, 60, 326–333. [Google Scholar] [CrossRef]
- Liu, C.-H.; Chiu, C.-H.; Wang, S.-W.; Cheng, W. Dietary Administration of the Probiotic, Bacillus subtilis E20, Enhances the Growth, Innate Immune Responses, and Disease Resistance of the Grouper, Epinephelus coioides. Fish Shellfish Immunol. 2012, 33, 699–706. [Google Scholar] [CrossRef]
- Aly, S.M.; Ahmed, Y.A.-G.; Ghareeb, A.A.-A.; Mohamed, M.F. Studies on Bacillus subtilis and Lactobacillus acidophilus, as Potential Probiotics, on the Immune Response and Resistance of Tilapia nilotica (Oreochromis niloticus) to Challenge Infections. Fish Shellfish Immunol. 2008, 25, 128–136. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Liu, Y.; Shin, H.; Chen, R.; Wang, N.S.; Li, J.; Du, G.; Chen, J. Developing Bacillus spp. as a Cell Factory for Production of Microbial Enzymes and Industrially Important Biochemicals in the Context of Systems and Synthetic Biology. Appl. Microb. Biotechnol. 2013, 97, 6113–6127. [Google Scholar] [CrossRef] [PubMed]
- Cui, W.; Han, L.; Suo, F.; Liu, Z.; Zhou, L.; Zhou, Z. Exploitation of Bacillus subtilis as a Robust Workhorse for Production of Heterologous Proteins and Beyond. World J. Microbiol. Biotechnol. 2018, 34, 145. [Google Scholar] [CrossRef]
- Harsij, M.; Kanani, H.G.; Adineh, H. Effects of Antioxidant Supplementation (Nano-Selenium, Vitamin C, and E) on Growth Performance, Blood Biochemistry, Immune Status, and Body Composition of Rainbow Trout (Oncorhynchus mykiss) under Sub-Lethal Ammonia Exposure. Aquaculture 2020, 521, 734942. [Google Scholar] [CrossRef]
- Laosam, P.; Luasiri, P.; Nakharuthai, C.; Boonanuntanasarn, S.; Suwanangul, S.; Sarnthima, R.; Khammuang, S.; Sanachai, K.; Yongsawatdigul, J.; Rouabhia, M.; et al. Enzymatic Hydrolysis of Duck Blood Protein Produces Stable Bioactive Peptides: Pilot-Scale Production, Identification, and Stability during Gastrointestinal and Plasma Digestion. Int. J. Biol. Macromol. 2024, 283, 137864. [Google Scholar] [CrossRef]
- Suwanangul, S.; Jaichakan, P.; Narkprasom, N.; Kraithong, S.; Narkprasom, K.; Sangsawad, P. Innovative Insights for Establishing a Synbiotic Relationship with Bacillus coagulans: Viability, Bioactivity, and In Vitro-Simulated Gastrointestinal Digestion. Foods 2023, 12, 3692. [Google Scholar] [CrossRef] [PubMed]
- Zafar, N.; Khan, M.A. Effects of Dietary Iron on Growth, Hematology, Oxidative Stress, and Hepatic Ascorbic Acid Concentration of Stinging Catfish (Heteropneustes fossilis). Aquaculture 2020, 516, 734642. [Google Scholar] [CrossRef]
- John, T.; George, J.; Hilton, J.; Slinger, S. Influence of Dietary Ascorbic Acid on Plasma Lipid Levels in the Rainbow Trout. Int. J. Vitam. Nutr. Res. 1979, 49, 400–405. [Google Scholar]
- Barros, M.M.; Falcon, D.R.; De Oliveira Orsi, R.; Pezzato, L.E.; Fernandes, A.C.; Guimarães, I.G.; Fernandes, A.; Padovani, C.R.; Sartori, M.M.P. Non-Specific Immune Parameters and Physiological Response of Nile Tilapia Fed β-Glucan and Vitamin C for Different Periods and Submitted to Stress and Bacterial Challenge. Fish Shellfish Immunol. 2014, 39, 188–195. [Google Scholar] [CrossRef]
- Caxico Vieira, C.A.S.; Vieira, J.S.; Bastos, M.S.; Zancanela, V.; Barbosa, L.T.; Gasparino, E.; Vesco, A.P.D. Expression of Genes Related to Antioxidant Activity in Nile Tilapia Kept under Salinity Stress and Fed Diets Containing Different Levels of Vitamin C. J. Toxicol. Environ. Health Part A 2018, 81, 20–30. [Google Scholar] [CrossRef] [PubMed]
- Gasco, L.; Gai, F.; Maricchiolo, G.; Genovese, L.; Ragonese, S.; Bottari, T.; Caruso, G. Supplementation of Vitamins, Minerals, Enzymes and Antioxidants in Fish Feeds. In Feeds for the Aquaculture Sector: Current Situation and Alternative Sources; Springer: Cham, Switzerland, 2018; pp. 63–103. [Google Scholar] [CrossRef]
- Gouda, A.; Amer, S.A.; Gabr, S.; Tolba, S.A. Effect of Dietary Supplemental Ascorbic Acid and Folic Acid on the Growth Performance, Redox Status, and Immune Status of Broiler Chickens under Heat Stress. Trop. Anim. Health Prod. 2020, 52, 2987–2996. [Google Scholar] [CrossRef]
- Jauncey, K.; Soliman, A.; Roberts, R. Ascorbic Acid Requirements in Relation to Wound Healing in the Cultured Tilapia Oreochromis niloticus (Trewavas). Aquac. Res. 1985, 16, 139–149. [Google Scholar] [CrossRef]
- Mæland, A.; Waagbø, R. Examination of the Qualitative Ability of Some Cold Water Marine Teleosts to Synthesise Ascorbic Acid. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 1998, 121, 249–255. [Google Scholar] [CrossRef]
- Zehra, S.; Khan, M.A. Dietary Vitamin C Requirement of Fingerling, Cirrhinus mrigala (Hamilton), Based on Growth, Feed Conversion, Protein Retention, Hematological Indices, and Liver Vitamin C Concentration. J. World Aquac. Soc. 2012, 43, 648–658. [Google Scholar] [CrossRef]
- Xu, C.; Yu, H.; Li, L.; Li, M.; Qui, X.; Fan, X.; Fan, Y.; Shan, L. Effects of Dietary Vitamin C on the Growth Performance, Biochemical Parameters, and Antioxidant Activity of Coho Salmon Oncorhynchus kisutch (Walbaum, 1792) Postsmolts. Aquac. Nutr. 2022, 2022, 6866578. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.-F.; Shiau, S.-Y. Dietary L-Ascorbic Acid Affects Growth, Nonspecific Immune Responses, and Disease Resistance in Juvenile Grouper, Epinephelus malabaricus. Aquaculture 2005, 244, 215–221. [Google Scholar] [CrossRef]
- Roosta, Z.; Hajimoradloo, A.; Ghorbani, R.; Hoseinifar, S.H. The Effects of Dietary Vitamin C on Mucosal Immune Responses and Growth Performance in Caspian Roach (Rutilus rutilus caspicus) Fry. Fish Physiol. Biochem. 2014, 40, 1601–1607. [Google Scholar] [CrossRef]
- Ai, Q.; Mai, K.; Zhang, C.; Xu, W.; Duan, Q.; Tan, B.; Liufu, Z. Effects of Dietary Vitamin C on Growth and Immune Response of Japanese Seabass, Lateolabrax japonicus. Aquaculture 2004, 242, 489–500. [Google Scholar] [CrossRef]
- Abo-Al-Ela, H.G.; El-Nahas, A.F.; Mahmoud, S.; Ibrahim, E.M. Vitamin C Modulates the Immunotoxic Effect of 17α-Methyltestosterone in Nile Tilapia. Biochemistry 2017, 56, 2042–2050. [Google Scholar] [CrossRef] [PubMed]
- Shahkar, E.; Yun, H.; Kim, D.-J.; Kim, S.-K.; Lee, B.I.; Bai, S.C. Effects of Dietary Vitamin C Levels on Tissue Ascorbic Acid Concentration, Hematology, Non-Specific Immune Response and Gonad Histology in Broodstock Japanese Eel, Anguilla japonica. Aquaculture 2015, 438, 115–121. [Google Scholar] [CrossRef]
- Eo, J.; Lee, K.-J. Effect of Dietary Ascorbic Acid on Growth and Non-Specific Immune Responses of Tiger Puffer, Takifugu rubripes. Fish Shellfish Immunol. 2008, 25, 611–616. [Google Scholar] [CrossRef] [PubMed]
- Smirnoff, N. L-Ascorbic Acid Biosynthesis. Vitam. Horm. 2001, 61, 241–266. [Google Scholar] [CrossRef]
- Shanaka, K.A.S.N.; Jung, S.; Janson, N.D.; Jayasingha, J.R.P.; Madushani, K.P.; Kim, M.-J.; Lee, J. Growth and Antioxidant-Related Effects of the Reestablished Ascorbic Acid Pathway in Zebrafish (Danio rerio) by Genomic Integration of L-Gulonolactone Oxidase from Cloudy Catshark (Scyliorhinus torazame). Front. Physiol. 2021, 12, 685595. [Google Scholar] [CrossRef] [PubMed]
- Drouin, G.; Godin, J.-R.; Pagé, B. The Genetics of Vitamin C Loss in Vertebrates. Curr. Genom. 2011, 12, 371–378. [Google Scholar] [CrossRef]
- Wang, X.; Kim, K.-W.; Bai, S.C.; Huh, M.-D.; Cho, B.-Y. Effects of the Different Levels of Dietary Vitamin C on Growth and Tissue Ascorbic Acid Changes in Parrot Fish (Oplegnathus fasciatus). Aquaculture 2003, 215, 203–211. [Google Scholar] [CrossRef]
- Sheraz, M.; Khan, M.F.; Ahmed, S.; Kazi, S.H.; Ahmad, I. Stability and Stabilization of Ascorbic Acid. Househ. Pers. Care Today 2015, 10, 22–25. [Google Scholar]
- Yin, X.; Chen, K.; Cheng, H.; Chen, X.; Feng, S.; Song, Y.; Liang, L. Chemical Stability of Ascorbic Acid Integrated into Commercial Products: A Review on Bioactivity and Delivery Technology. Antioxidants 2022, 11, 153. [Google Scholar] [CrossRef] [PubMed]
- Comunian, T.A.; Abbaspourrad, A.; Favaro-Trindade, C.S.; Weitz, D.A. Fabrication of Solid Lipid Microcapsules Containing Ascorbic Acid Using a Microfluidic Technique. Food Chem. 2014, 152, 271–275. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Liu, C.; Li, J. Comparison of Vitamin C and Its Derivative Antioxidant Activity: Evaluated by Using Density Functional Theory. ACS Omega 2020, 5, 25467–25475. [Google Scholar] [CrossRef]
- Toyohara, H.; Nakata, T.; Touhata, K.; Hashimoto, H.; Kinoshita, M.; Sakaguchi, M.; Nishikimi, M.; Yagi, K.; Wakamatsu, Y.; Ozato, K. Transgenic Expression of l-Gulono-γ-lactone Oxidase in Medaka (Oryzias latipes), a Teleost Fish That Lacks This Enzyme Necessary for l-Ascorbic Acid Biosynthesis. Biochem. Biophys. Res. Commun. 1996, 223, 650–653. [Google Scholar] [CrossRef]
- Shi, M.; Gao, M.; Sun, H.; Yang, W.; Zhao, H.; Zhang, L.; Xu, H. Exogenous 2-Keto-L-Gulonic Acid Supplementation as a Novel Approach to Enhancing L-Ascorbic Acid Biosynthesis in Zebrafish (Danio rerio). Animals 2023, 13, 2502. [Google Scholar] [CrossRef]
- Crawford, T.C. Synthesis of L-Ascorbic Acid. ACS Publ. 1982, 200, 1–36. [Google Scholar] [CrossRef]
- Cutting, S.M.; Hong, H.A.; Baccigalupi, L.; Ricca, E. Oral Vaccine Delivery by Recombinant Spore Probiotics. Int. Rev. Immunol. 2009, 28, 487–505. [Google Scholar] [CrossRef]
- Yang, Y.; Zhang, G.; Wu, J.; Chen, X.; Tong, D.; Yang, Y.; Shi, H.; Yao, C.; Zhuang, L.; Wang, J.; et al. Recombinant HcGAPDH Protein Expressed on Probiotic Bacillus subtilis Spores Protects Sheep from Haemonchus contortus Infection by Inducing Both Humoral and Cell-Mediated Responses. mSystems 2020, 5, e00239-20. [Google Scholar] [CrossRef]
- Nakharuthai, C.; Boonanuntanasarn, S.; Kaewda, J.; Manassila, P. Isolation of Potential Probiotic Bacillus spp. from the Intestine of Nile Tilapia to Construct Recombinant Probiotic Expressing CC Chemokine and Its Effectiveness on Innate Immune Responses in Nile Tilapia. Animals 2023, 13, 986. [Google Scholar] [CrossRef]
- Amal, M.; Zamri-Saad, M. Streptococcosis in Tilapia (Oreochromis niloticus): A Review. Pertanika J. Trop. Agric. Sci. 2011, 34, 195–206. [Google Scholar]
- Chen, M.; Li, L.-P.; Wang, R.; Liang, W.-W.; Huang, Y.; Li, J.; Lei, A.-Y.; Huang, W.-Y.; Gan, X. PCR Detection and PFGE Genotype Analyses of Streptococcal Clinical Isolates from Tilapia in China. Vet. Microbiol. 2012, 159, 526–530. [Google Scholar] [CrossRef]
- Dangwetngam, M.; Suanyuk, N.; Kong, F.; Phromkunthong, W. Serotype Distribution and Antimicrobial Susceptibilities of Streptococcus agalactiae Isolated from Infected Cultured Tilapia (Oreochromis niloticus) in Thailand: Nine-Year Perspective. J. Med. Microbiol. 2016, 65, 247–254. [Google Scholar] [CrossRef] [PubMed]
- Xue, G.-P.; Johnson, J.S.; Dalrymple, B.P. High osmolarity improves the electro-transformation efficiency of the gram-positive bacteria Bacillus subtilis and Bacillus licheniformis. J. Microbiol. Methods 1999, 34, 183–191. [Google Scholar] [CrossRef]
- Association of Official Analytical Chemists (AOAC). Official Methods of Analysis of the Association of Official Analytical Chemists, 14th ed.; AOAC: Arlington, VA, USA, 1990. [Google Scholar]
- Pitaksong, T.; Kupittayanant, P.; Boonanuntanasarn, S. The Effects of Vitamins C and E on the Growth, Tissue Accumulation and Prophylactic Response to Thermal and Acidic Stress of Hybrid Catfish. Aquac. Nutr. 2012, 19, 148–162. [Google Scholar] [CrossRef]
- Siwicki, A.; Studnicka, M. The Phagocytic Ability of Neutrophils and Serum Lysozyme Activity in Experimentally Infected Carp, Cyprinus carpio L. J. Fish Biol. 1987, 31, 57–60. [Google Scholar] [CrossRef]
- Milla, S.; Mathieu, C.; Wang, N.; Lambert, S.; Nadzialek, S.; Massart, S.; Henrotte, E.; Douxfils, J.; Mélard, C.; Mandiki, S.N.M.; et al. Spleen Immune Status is Affected After Acute Handling Stress but Not Regulated by Cortisol in Eurasian Perch, Perca fluviatilis. Fish Shellfish Immunol. 2010, 28, 931–941. [Google Scholar] [CrossRef]
- Puangkaew, J.; Kiron, V.; Somamoto, T.; Okamoto, N.; Satoh, S.; Takeuchi, T.; Watanabe, T. Nonspecific Immune Response of Rainbow Trout (Oncorhynchus mykiss Walbaum) in Relation to Different Status of Vitamin E and Highly Unsaturated Fatty Acids. Fish Shellfish Immunol. 2004, 16, 25–39. [Google Scholar] [CrossRef] [PubMed]
- Boonanuntanasarn, S.; Nakharuthai, C.; Schrama, D.; Duangkaew, R.; Rodrigues, P.M. Effects of Dietary Lipid Sources on Hepatic Nutritive Contents, Fatty Acid Composition, and Proteome of Nile Tilapia (Oreochromis niloticus). J. Proteom. 2019, 192, 208–222. [Google Scholar] [CrossRef] [PubMed]
- Nakharuthai, C.; Srisapoome, P. Molecular Identification and Dual Functions of Two Different CXC Chemokines in Nile Tilapia (Oreochromis niloticus) Against Streptococcus agalactiae and Flavobacterium columnare. Microorganisms 2020, 8, 1058. [Google Scholar] [CrossRef] [PubMed]
- Bremus, C.; Herrmann, U.; Bringer-Meyer, S.; Sahm, H. The Use of Microorganisms in L-Ascorbic Acid Production. J. Biotechnol. 2006, 124, 196–205. [Google Scholar] [CrossRef] [PubMed]
- Jiménez-Fernández, E.; Ruyra, A.; Roher, N.; Zuasti, E.; Infante, C.; Fernández-Díaz, C. Nanoparticles as a Novel Delivery System for Vitamin C Administration in Aquaculture. Aquaculture 2014, 432, 426–433. [Google Scholar] [CrossRef]
- Ibrahim, R.E.; Amer, S.A.; Farroh, K.Y.; Al-Gabri, N.A.; Ahmed, A.I.; El-Araby, D.A.; Ahmed, S.A.A. The Effects of Chitosan-Vitamin C Nanocomposite Supplementation on the Growth Performance, Antioxidant Status, Immune Response, and Disease Resistance of Nile Tilapia (Oreochromis niloticus) Fingerlings. Aquaculture 2021, 534, 736269. [Google Scholar] [CrossRef]
- Tian, Y.-S.; Deng, Y.-D.; Zhang, W.-H.; Wang, Y.; Xu, J.; Gao, J.-J.; Wang, B.; Fu, X.-Y.; Han, H.-J.; Li, Z.-J.; et al. Metabolic Engineering of Escherichia coli for Direct Production of Vitamin C from D-Glucose. Biotechnol. Biofuels Bioprod. 2022, 15, 86. [Google Scholar] [CrossRef] [PubMed]
- Won, S.; Hamidoghli, A.; Choi, W.; Park, Y.; Jang, W.J.; Kong, I.-S.; Bai, S.C. Effects of Bacillus subtilis WB60 and Lactococcus lactis on Growth, Immune Responses, Histology and Gene Expression in Nile Tilapia, Oreochromis niloticus. Microorganisms 2020, 8, 67. [Google Scholar] [CrossRef] [PubMed]
- Dawood, M.; Koshio, S. Vitamin C Supplementation to Optimize Growth, Health and Stress Resistance in Aquatic Animals. Rev. Aquac. 2016, 10, 334–350. [Google Scholar] [CrossRef]
- Wang, L.; Chen, D.; Lou, B.; Zhan, W.; Chen, R.; Liu, F.; Mao, G. The Effects of Dietary Vitamin C on Growth Performance, Serum Enzyme Activities and Resistance to Vibrio alginolyticus Challenge of Yellow Drum (Nibea albiflora). Aquac. Res. 2017, 48, 4684–4695. [Google Scholar] [CrossRef]
- Chen, R.; Lochmann, R.; Goodwin, A.; Praveen, K.; Dabrowski, K.; Lee, K.-J. Effects of Dietary Vitamins C and E on Alternative Complement Activity, Hematology, Tissue Composition, Vitamin Concentrations and Response to Heat Stress in Juvenile Golden Shiner (Notemigonus crysoleucas). Aquaculture 2004, 242, 553–569. [Google Scholar] [CrossRef]
- Lim, C.; Yildirim-Aksoy, M.; Welker, T.; Klesius, P.H.; Li, M.H. Growth Performance, Immune Response, and Resistance to Streptococcus iniae of Nile Tilapia, Oreochromis niloticus, Fed Diets Containing Various Levels of Vitamins C and E. J. World Aquac. Soc. 2010, 41, 35–48. [Google Scholar] [CrossRef]
- Nayak, S.K.; Swain, P.; Mukherjee, S.C. Effect of Dietary Supplementation of Probiotic and Vitamin C on the Immune Response of Indian Major Carp, Labeo rohita (Ham.). Fish Shellfish Immunol. 2007, 23, 892–896. [Google Scholar] [CrossRef] [PubMed]
- Fong, F.L.Y.; Shah, N.P.; Kirjavainen, P.; El-Nezami, H. Mechanism of Action of Probiotic Bacteria on Intestinal and Systemic Immunities and Antigen-Presenting Cells. Int. Rev. Immunol. 2016, 35, 179–188. [Google Scholar] [CrossRef]
- Verlhac, V.; Gabaudan, J.; Obach, A.; Schüep, W.; Hole, R. Influence of Dietary Glucan and Vitamin C on Non-Specific and Specific Immune Responses of Rainbow Trout (Oncorhynchus mykiss). Aquaculture 1996, 143, 123–133. [Google Scholar] [CrossRef]
- Adorian, T.J.; Jamali, H.; Farsani, H.G.; DarvishiEffects, P.; Hasanpour, S.; Bagheri, T.; Roozbehfar, R. Effects of Probiotic Bacteria Bacillus on Growth Performance, Digestive Enzyme Activity, and Hematological Parameters of Asian Sea Bass, Lates calcarifer (Bloch). Probiotics Antimicrob. Proteins 2019, 11, 248–255. [Google Scholar] [CrossRef] [PubMed]
- Medagoda, N.; Chotikachinda, R.; Hasanthi, M.; Lee, K.-J. Dietary Supplementation of a Mixture of Nucleotides, β-Glucan and Vitamins C and E Improved the Growth and Health Performance of Olive Flounder, Paralichthys olivaceus. Fishes 2023, 8, 302. [Google Scholar] [CrossRef]
- Magnadottir, B. Immunological Control of Fish Diseases. Mar. Biotechnol. 2010, 12, 361–379. [Google Scholar] [CrossRef]
- Haque, M.M.; Hasan, N.A.; Eltholth, M.M.; Saha, P.; Mely, S.S.; Rahman, T.; Murray, F.J. Assessing the Impacts of In-Feed Probiotic on the Growth Performance and Health Condition of Pangasius (Pangasianodon hypophthalmus) in a Farm Trial. Aquac. Rep. 2021, 20, 100699. [Google Scholar] [CrossRef]
- Kumar, V.; Kumar, S. Effects of Dietary Administration of Probiotic (Bacillus subtilis) and Iron Oxide Nanoparticles on the Growth Parameters of the Fish Labeo rohita. Int. J. Fish. Aquat. Stud. 2024, 12, 124–127. [Google Scholar] [CrossRef]
- Chen, M.; Daha, M.R.; Kallenberg, C.G.M. The Complement System in Systemic Autoimmune Disease. J. Autoimmun. 2010, 34, J276–J286. [Google Scholar] [CrossRef]
- Panase, A.; Thirabunyanon, M.; Promya, J.; Chitmanat, C. Influences of Bacillus subtilis and Fructooligosaccharide on Growth Performances, Immune Responses, and Disease Resistance of Nile Tilapia, Oreochromis niloticus. Front. Vet. Sci. 2023, 9, 1094681. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Lovell, R.T. Elevated Levels of Dietary Ascorbic Acid Increase Immune Responses in Channel Catfish. J. Nutr. 1985, 115, 123–131. [Google Scholar] [CrossRef] [PubMed]
- Hardie, L.J.; Fletcher, T.C.; Secombes, C.J. The Effect of Dietary Vitamin C on the Immune Response of the Atlantic Salmon (Salmo salar L.). Aquaculture 1991, 95, 201–214. [Google Scholar] [CrossRef]
- Garcia, D.; Lima, D.; da Silva, D.G.H.; de Almeida, E.A. Decreased Malondialdehyde Levels in Fish (Astyanax altiparanae) Exposed to Diesel: Evidence of Metabolism by Aldehyde Dehydrogenase in the Liver and Excretion in Water. Ecotoxicol. Environ. Saf. 2020, 190, 110107. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Zommara, M.; Eweedah, N.M.; Helal, E.I.; Aboel-Darag, M.A. The Potential Role of Nano-Selenium and Vitamin C on the Performances of Nile Tilapia (Oreochromis niloticus). Environ. Sci. Pollut. Res. 2020, 27, 9843–9852. [Google Scholar] [CrossRef] [PubMed]
- Suanyuk, N.; Kong, F.; Ko, D.; Gilbert, G.L.; Supamattaya, K. Occurrence of Rare Genotypes of Streptococcus agalactiae in Cultured Red Tilapia (Oreochromis sp.) and Nile Tilapia (O. niloticus) in Thailand—Relationship to Human Isolates? Aquaculture 2008, 284, 35–40. [Google Scholar] [CrossRef]
- Chan, J.; Carmen, L.C.P.; Lee, S.Q.; Prabakaran, M. Identification and Characterization of Immunoglobulin Tau (IgT) in Asian Seabass (Lates calcarifer) and Mucosal Immune Response to Nervous Necrosis Virus. Front. Immunol. 2023, 14, 1146387. [Google Scholar] [CrossRef] [PubMed]
- Santos-Sánchez, N.F.; Salas-Coronado, R.; Villanueva-Cañongo, C.; Hernández-Carlos, B. Antioxidant Compounds and Their Antioxidant Mechanism. Antioxidants 2019, 10, 1–29. [Google Scholar] [CrossRef]
- Carr, A.C.; Maggini, S. Vitamin C and Immune Function. Nutrients 2017, 9, 1211. [Google Scholar] [CrossRef]
Primer Name | 5′ to 3′ Nucleotide Sequences | Size (bp) | Ta (°C) | Purposes | Accession No. |
---|---|---|---|---|---|
H-B-GULOF | AAGCTTGGATCCATGGTTCACGGCCAAGGAGG | 1323 | 55 | Cloning | XM_015285218 |
H-X-GULOR | AAGCTTCTCGAGGTAGAACACCTTTTCCAGAT | Cloning | |||
GULO-qPCRF | ACAGGGACGCACAACACTGG | 172 | 59 | qRT-PCR | XM_015285218 |
GULO-qPCRR | TGACGGTGAGCACAACACCC | qRT-PCR | |||
β-actinF | ACAGGATGCAGAAGGAGATCACAG | 155 | 55 | qRT-PCR | KJ126772.1 |
β-actinR | GTACTCCTGCTTGCTGATCCACAT | qRT-PCR | |||
OnCC-F | ACAGAGCCGATCTTGGGTTACTTG | 229 | 55 | qRT-PCR | KJ535436.1 |
OnCC-R | TGAAGGAGAGGCGGTGGATGTTAT | qRT-PCR | |||
OnTNF-αF | GAGGCCAATAAAATCATCATCCC | 161 | 55 | qRT-PCR | NM_001279533 |
OnTNF-αR | CTTCCCATAGACTCTGAGTAGCG | qRT-PCR |
Diet | Initial Weight | Final Weight | Initial Length | Final Length | Weight Gain | FCR | ADG | SGR | RGR | PER |
---|---|---|---|---|---|---|---|---|---|---|
(g) | (g) | (cm) | (cm) | (g) | (g day−1) | (% day−1) | (%) | |||
30 days | ||||||||||
CON | 75.11 ± 5.81 | 141.47 ± 13.78 | 15.97 ± 0.58 | 19.40 ± 0.51 | 66.36 ± 8.78 | 1.52 ± 0.06 | 2.21 ± 0.29 | 0.91 ± 0.06 | 88.23 ± 7.43 | 2.14 ± 0.07 a |
VC | 73.16 ± 2.39 | 138.80 ± 6.24 | 15.71 ± 0.19 | 19.19 ± 0.25 | 65.64 ± 4.90 | 1.55 ± 0.02 | 2.19 ± 0.16 | 0.93 ± 0.05 | 89.74 ± 6.13 | 2.15 ± 0.02 a |
BS | 80.18 ± 1.34 | 151.29 ± 10.30 | 16.30 ± 0.13 | 19.73 ± 0.46 | 71.11 ± 10.24 | 1.44 ± 0.07 | 2.57 ± 0.07 | 0.97 ± 0.04 | 95.94 ± 4.78 | 2.32 ± 0.12 b |
BS + GULO | 78.56 ± 3.50 | 158.64 ± 3.55 | 16.21 ± 0.45 | 19.99 ± 0.09 | 80.09 ± 0.50 | 1.41± 0.01 | 2.67 ± 0.02 | 1.02 ± 0.03 | 102.09 ± 4.56 | 2.37 ± 0.02 b |
90 days | ||||||||||
CON | 75.11 ± 5.81 | 268.75 ± 7.19 a | 15.97 ± 0.58 | 25.15 ± 1.74 | 195.72± 0.73 a | 1.60 ± 0.07 b | 2.17 ± 0.01 a | 0.63 ± 0.03 a | 268.99 ± 22.79 a | 2.23 ± 0.09 |
VC | 73.16 ± 2.39 | 312.17 ± 13.12 b | 15.71 ± 0.19 | 25.83 ± 0.35 | 237.73 ± 14.47 b | 1.52 ± 0.09 ab | 2.64 ± 0.16 b | 0.69 ± 0.03 a | 319.60 ± 24.91 a | 2.20 ± 0.13 |
BS | 80.18 ± 1.34 | 327.06 ± 12.45 b | 16.30 ± 0.13 | 25.94 ± 0.49 | 246.88 ± 12.08 b | 1.54 ± 0.03 ab | 2.74 ± 0.13 b | 0.68 ± 0.02 a | 307.93 ± 14.78 a | 2.17 ± 0.05 |
BS + GULO | 78.56 ± 3.50 | 381.25 ± 8.13 c | 16.21 ± 0.45 | 27.46 ± 0.41 | 302.75 ± 3.18 c | 1.42 ± 0.00 a | 3.36 ± 0.04 c | 0.76 ± 0.02 b | 386.31 ± 20.30 b | 2.34 ± 0.00 |
Diet | Ascorbic Acid Level (µg mL−1) |
---|---|
CON | 5.88 ± 1.21 a |
VC | 20.29 ± 2.91 c |
BS | 5.92 ± 0.66 a |
BS+GULO | 10.43 ± 1.20 b |
Diet | TAC | SOD | MDA | GSH-Px | CAT |
---|---|---|---|---|---|
µmol mL−1 | U mL−1 | nmol mL−1 | U mL−1 | nmol min−1 mL−1 | |
CON | 28.16 ± 0.91 a | 3.32 ± 0.10 a | 0.36 ± 0.006 c | 0.068 ± 0.001 a | 10.39 ± 0.83 a |
VC | 38.85 ± 1.32 b | 4.34 ± 0.34 b | 0.23 ± 0.025 a | 0.121 ± 0.013 b | 31.27 ± 2.59 c |
BS | 32.03 ± 1.02 ab | 4.04 ± 0.12 ab | 0.31 ± 0.002 b | 0.088 ± 0.007 ab | 17.29 ± 1.32 ab |
BS+GULO | 36.01 ± 1.78 b | 4.69 ± 0.32 b | 0.28 ± 0.006 b | 0.117 ± 0.016 b | 20.34 ± 4.16 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kaewda, J.; Boonanuntanasarn, S.; Sangsawad, P.; Manassila, P.; Nakharuthai, C. Enhancement of Growth, Antioxidant Activity, and Immunity in Nile Tilapia (Oreochromis niloticus) Through Recombinant Bacillus subtilis Expressing L-Gulonolactone Oxidase. Antioxidants 2025, 14, 50. https://doi.org/10.3390/antiox14010050
Kaewda J, Boonanuntanasarn S, Sangsawad P, Manassila P, Nakharuthai C. Enhancement of Growth, Antioxidant Activity, and Immunity in Nile Tilapia (Oreochromis niloticus) Through Recombinant Bacillus subtilis Expressing L-Gulonolactone Oxidase. Antioxidants. 2025; 14(1):50. https://doi.org/10.3390/antiox14010050
Chicago/Turabian StyleKaewda, Jirawadee, Surintorn Boonanuntanasarn, Papungkorn Sangsawad, Pimpisut Manassila, and Chatsirin Nakharuthai. 2025. "Enhancement of Growth, Antioxidant Activity, and Immunity in Nile Tilapia (Oreochromis niloticus) Through Recombinant Bacillus subtilis Expressing L-Gulonolactone Oxidase" Antioxidants 14, no. 1: 50. https://doi.org/10.3390/antiox14010050
APA StyleKaewda, J., Boonanuntanasarn, S., Sangsawad, P., Manassila, P., & Nakharuthai, C. (2025). Enhancement of Growth, Antioxidant Activity, and Immunity in Nile Tilapia (Oreochromis niloticus) Through Recombinant Bacillus subtilis Expressing L-Gulonolactone Oxidase. Antioxidants, 14(1), 50. https://doi.org/10.3390/antiox14010050